Starting /dee2/code/volunteer_pipeline.sh SRR7230823 current disk space = 3054125101056 free memory = 1402623912 SRR7230823 SRAfilesize 28c4e60336fc446ab360c6d443fb0d1c SRR7230823.sra SRR7230823.sra file validated SRR7230823 is paired end SRR7230823 is conventional basespace SRR7230823 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230823_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.64 33.0 33.0 34.0 32.0 34.0 2 33.073 34.0 33.0 34.0 32.0 34.0 3 33.20975 34.0 33.0 34.0 32.0 34.0 4 33.2615 34.0 33.0 34.0 33.0 34.0 5 31.71475 33.0 32.0 34.0 27.0 34.0 6 36.326 38.0 36.0 38.0 31.0 38.0 7 37.1665 38.0 38.0 38.0 36.0 38.0 8 37.40225 38.0 38.0 38.0 37.0 38.0 9 37.38875 38.0 38.0 38.0 37.0 38.0 10-14 37.3041 38.0 38.0 38.0 37.0 38.0 15-19 37.392 38.0 38.0 38.0 37.0 38.0 20-24 36.79085 38.0 38.0 38.0 35.0 38.0 25-29 37.2203 38.0 38.0 38.0 36.8 38.0 30-34 37.2068 38.0 38.0 38.0 36.8 38.0 35-39 36.918850000000006 38.0 38.0 38.0 35.8 38.0 40-44 36.64585 38.0 38.0 38.0 34.6 38.0 45-49 37.043 38.0 38.0 38.0 36.0 38.0 50-54 37.029 38.0 38.0 38.0 35.8 38.0 55-59 36.93545 38.0 38.0 38.0 36.0 38.0 60-64 37.0063 38.0 38.0 38.0 36.0 38.0 65-69 37.0159 38.0 38.0 38.0 36.0 38.0 70-74 29.938350000000003 38.0 19.0 38.0 15.2 38.0 75-79 31.01975 37.8 30.2 38.0 4.6 38.0 80-84 34.4636 38.0 36.6 38.0 25.0 38.0 85-89 35.889 38.0 37.2 38.0 30.6 38.0 90-94 36.232549999999996 38.0 37.2 38.0 33.2 38.0 95-99 36.12820000000001 38.0 37.2 38.0 33.0 38.0 100-104 36.2257 38.0 37.2 38.0 33.6 38.0 105-109 36.2371 38.0 37.4 38.0 33.6 38.0 110-114 36.02055 38.0 37.2 38.0 32.8 38.0 115-119 35.78340000000001 38.0 36.8 38.0 31.2 38.0 120-124 35.355650000000004 38.0 36.0 38.0 29.2 38.0 125-129 34.85565 38.0 35.0 38.0 27.4 38.0 130-134 34.812650000000005 38.0 35.0 38.0 27.2 38.0 135-139 34.62865000000001 38.0 35.0 38.0 26.8 38.0 140-144 33.859750000000005 38.0 34.6 38.0 21.4 38.0 145-149 33.161500000000004 38.0 33.2 38.0 19.0 38.0 150-151 28.762625 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 6.0 19 0.0 20 5.0 21 6.0 22 12.0 23 13.0 24 14.0 25 17.0 26 28.0 27 29.0 28 46.0 29 55.0 30 75.0 31 74.0 32 128.0 33 229.0 34 315.0 35 495.0 36 870.0 37 1577.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.186546636659166 16.27906976744186 8.502125531382845 29.03225806451613 2 20.575 20.125 33.550000000000004 25.75 3 17.0 28.925 29.15 24.925 4 22.1 34.5 22.85 20.549999999999997 5 20.275000000000002 37.475 23.25 19.0 6 17.45 35.525 26.650000000000002 20.375 7 14.45 22.125 44.05 19.375 8 15.4 22.900000000000002 31.1 30.599999999999998 9 17.825 23.35 32.9 25.924999999999997 10-14 20.544999999999998 29.154999999999998 26.68 23.62 15-19 19.675 28.494999999999997 28.044999999999998 23.785 20-24 19.415 28.89 27.91 23.785 25-29 20.36 28.42 27.694999999999997 23.525 30-34 19.645000000000003 29.425 27.785 23.145 35-39 20.03 29.060000000000002 26.995 23.915 40-44 19.791927174511077 29.200220077026962 27.59465813034562 23.41319461811634 45-49 20.31 28.73 27.79 23.169999999999998 50-54 20.205000000000002 28.945 27.884999999999998 22.965 55-59 20.121036310893267 28.65859757927378 27.663298989696912 23.55706712013604 60-64 20.49 28.634999999999998 27.794999999999998 23.080000000000002 65-69 20.02900580116023 28.21564312862572 27.68553710742148 24.06981396279256 70-74 19.966895537027955 28.341098577734186 28.0223148602256 23.66969102501226 75-79 20.346120565330256 28.318430920103836 28.11075858090568 23.224689933660226 80-84 20.01472057199937 27.911255980232376 27.800851690237106 24.273171757531152 85-89 20.873199717997785 28.084399234565417 27.35925067982677 23.683150367610033 90-94 20.064999999999998 28.12 28.33 23.485 95-99 20.395 27.91 27.805000000000003 23.89 100-104 20.375 28.62 27.47 23.535 105-109 20.025000000000002 28.725 27.639999999999997 23.61 110-114 20.905 28.365000000000002 27.310000000000002 23.419999999999998 115-119 20.66 28.315 27.725 23.3 120-124 20.855 28.610000000000003 26.779999999999998 23.755000000000003 125-129 20.855 27.845 27.425 23.875 130-134 20.72 29.085 27.015 23.18 135-139 21.310000000000002 28.249999999999996 26.825 23.615 140-144 21.055 28.875 26.765 23.305 145-149 21.0 29.38 25.679999999999996 23.94 150-151 20.974999999999998 28.5875 26.2125 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.5 22 2.5 23 4.0 24 4.0 25 7.0 26 9.5 27 14.5 28 23.5 29 23.5 30 35.5 31 49.5 32 48.5 33 63.5 34 80.0 35 98.5 36 114.0 37 135.0 38 161.5 39 182.0 40 197.0 41 228.5 42 243.0 43 231.5 44 239.0 45 246.5 46 241.0 47 222.5 48 206.0 49 177.0 50 138.5 51 103.5 52 93.5 53 89.5 54 69.0 55 55.0 56 47.5 57 38.0 58 26.5 59 17.0 60 10.0 61 4.5 62 3.0 63 2.0 64 0.5 65 0.0 66 0.5 67 2.0 68 2.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.034999999999999996 45-49 0.0 50-54 0.0 55-59 0.03 60-64 0.0 65-69 0.02 70-74 18.44 75-79 13.325000000000001 80-84 4.8950000000000005 85-89 0.7100000000000001 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24318869828456 98.35000000000001 2 0.6559031281533804 1.3 3 0.050454086781029264 0.15 4 0.050454086781029264 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.6124999999999998 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 1.9874999999999998 0.0 0.0 0.0 0.0 118-119 2.35 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 3.0375 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.625 0.0 0.0 0.0 0.0 128-129 4.0375 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 4.925000000000001 0.0 0.0 0.0 0.0 134-135 5.5375 0.0 0.0 0.0 0.0 136-137 5.987500000000001 0.0 0.0 0.0 0.0 138-139 6.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGCA 10 0.007391405 141.225 7 TCATCTC 10 0.007391405 141.225 7 >>END_MODULE SRR7230823 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230823_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.699 33.0 33.0 34.0 32.0 34.0 2 32.7875 34.0 33.0 34.0 32.0 34.0 3 32.8095 34.0 33.0 34.0 32.0 34.0 4 32.736 34.0 33.0 34.0 32.0 34.0 5 32.341 34.0 33.0 34.0 31.0 34.0 6 36.36 38.0 38.0 38.0 34.0 38.0 7 36.57175 38.0 38.0 38.0 35.0 38.0 8 36.59775 38.0 38.0 38.0 36.0 38.0 9 36.574 38.0 38.0 38.0 35.0 38.0 10-14 36.31625 38.0 38.0 38.0 33.6 38.0 15-19 36.6925 38.0 38.0 38.0 36.0 38.0 20-24 36.5994 38.0 38.0 38.0 35.8 38.0 25-29 36.271550000000005 38.0 38.0 38.0 33.8 38.0 30-34 36.510000000000005 38.0 38.0 38.0 35.4 38.0 35-39 36.19025 38.0 38.0 38.0 33.6 38.0 40-44 35.9064 38.0 38.0 38.0 32.0 38.0 45-49 36.2094 38.0 38.0 38.0 33.8 38.0 50-54 36.35425 38.0 38.0 38.0 35.0 38.0 55-59 36.3274 38.0 38.0 38.0 35.0 38.0 60-64 36.15645 38.0 38.0 38.0 33.4 38.0 65-69 35.8643 38.0 37.8 38.0 32.2 38.0 70-74 36.0615 38.0 38.0 38.0 33.6 38.0 75-79 36.119200000000006 38.0 38.0 38.0 34.0 38.0 80-84 36.01645 38.0 38.0 38.0 33.8 38.0 85-89 36.080949999999994 38.0 38.0 38.0 34.0 38.0 90-94 35.98945 38.0 38.0 38.0 34.0 38.0 95-99 35.7633 38.0 38.0 38.0 33.2 38.0 100-104 35.1462 38.0 37.0 38.0 28.2 38.0 105-109 35.20865 38.0 37.0 38.0 28.8 38.0 110-114 35.2954 38.0 37.0 38.0 30.2 38.0 115-119 35.2919 38.0 37.0 38.0 30.2 38.0 120-124 34.93905 38.0 36.8 38.0 28.0 38.0 125-129 34.543850000000006 38.0 36.0 38.0 25.4 38.0 130-134 34.4424 38.0 36.0 38.0 25.0 38.0 135-139 34.111050000000006 38.0 35.4 38.0 23.8 38.0 140-144 33.37115 38.0 33.4 38.0 18.2 38.0 145-149 32.315099999999994 38.0 33.0 38.0 10.8 38.0 150-151 25.702875 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 15.0 4 7.0 5 4.0 6 1.0 7 4.0 8 3.0 9 4.0 10 4.0 11 3.0 12 3.0 13 4.0 14 11.0 15 5.0 16 4.0 17 10.0 18 7.0 19 9.0 20 5.0 21 4.0 22 16.0 23 8.0 24 20.0 25 31.0 26 29.0 27 27.0 28 33.0 29 43.0 30 48.0 31 64.0 32 79.0 33 112.0 34 168.0 35 267.0 36 577.0 37 2353.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.3 20.150000000000002 12.0 20.549999999999997 2 24.425 24.45 32.5 18.625 3 21.5 25.775 33.275 19.45 4 23.3 33.95 23.225 19.525000000000002 5 22.575 37.55 21.525 18.35 6 18.95 37.175000000000004 24.825 19.05 7 18.425 19.875 40.625 21.075 8 20.7 23.474999999999998 27.750000000000004 28.075 9 21.725 23.474999999999998 29.9 24.9 10-14 23.669999999999998 28.07 26.810000000000002 21.45 15-19 22.395 28.1 28.46 21.044999999999998 20-24 22.675 28.02 28.18 21.125 25-29 22.57 27.815 28.83 20.785 30-34 21.915000000000003 28.435 28.625 21.025 35-39 22.335 28.455000000000002 28.18 21.029999999999998 40-44 23.085 27.705000000000002 28.215 20.995 45-49 23.016150807540377 27.711385569278463 28.431421571078552 20.841042052102605 50-54 22.693154523618894 27.27181745396317 28.697958366693356 21.33706965572458 55-59 23.154362416107382 28.13783431834118 28.172893919663426 20.534909345888007 60-64 23.355 28.084999999999997 27.644999999999996 20.915 65-69 23.164011622081958 27.27682596934175 28.353872357479208 21.205290051097084 70-74 22.657384684729802 28.27164821956228 27.46531777432764 21.605649321380277 75-79 23.18 27.834999999999997 27.865000000000002 21.12 80-84 22.821141057052852 28.33641682084104 27.891394569728483 20.95104755237762 85-89 23.895 28.04 27.67 20.395 90-94 23.275000000000002 28.084999999999997 27.955000000000002 20.685000000000002 95-99 23.189999999999998 27.955000000000002 27.860000000000003 20.995 100-104 23.32 27.05 28.63 21.0 105-109 24.25 27.87 27.705000000000002 20.175 110-114 23.56 28.405 27.83 20.205000000000002 115-119 24.115000000000002 28.310000000000002 28.01 19.564999999999998 120-124 24.59 28.13 27.33 19.950000000000003 125-129 23.82 27.83 27.47 20.880000000000003 130-134 24.335 28.345 27.045 20.275000000000002 135-139 24.42 27.49 28.13 19.96 140-144 24.395 28.555000000000003 26.935 20.115 145-149 25.005 28.27 27.245 19.48 150-151 25.825 27.700000000000003 27.1 19.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.5 18 0.5 19 1.0 20 2.0 21 1.0 22 1.0 23 3.0 24 4.5 25 4.5 26 4.5 27 8.0 28 11.5 29 16.5 30 21.5 31 26.5 32 29.5 33 33.0 34 44.5 35 68.0 36 98.0 37 120.0 38 130.0 39 147.5 40 182.0 41 221.5 42 254.0 43 271.5 44 276.5 45 253.5 46 244.0 47 262.0 48 232.0 49 192.0 50 164.5 51 136.0 52 115.5 53 92.5 54 74.0 55 54.0 56 49.5 57 40.0 58 28.5 59 28.0 60 16.5 61 7.5 62 7.0 63 5.0 64 2.5 65 1.0 66 0.0 67 1.0 68 1.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.08 55-59 0.16999999999999998 60-64 0.0 65-69 0.19 70-74 0.165 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16687705124968 98.2 2 0.7321383489017925 1.4500000000000002 3 0.07573844988639232 0.22499999999999998 4 0.0 0.0 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.6375000000000002 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.0250000000000004 0.0 0.0 0.0 0.0 118-119 2.4 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 3.125 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 3.7125 0.0 0.0 0.0 0.0 128-129 4.1625 0.0 0.0 0.0 0.0 130-131 4.525 0.0 0.0 0.0 0.0 132-133 5.0 0.0 0.0 0.0 0.0 134-135 5.5375 0.0 0.0 0.0 0.0 136-137 5.9625 0.0 0.0 0.0 0.0 138-139 6.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGAGAAT 10 0.006830828 145.0 2 >>END_MODULE Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133218 spots for SRR7230823.sra Written 1133218 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra Read 1133206 spots for SRR7230823.sra Written 1133206 spots for SRR7230823.sra SRR ids: ['SRR7230823.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_975ax9ol SRR7230823.sra spots: 22664132 blocks: [[1, 1133206], [1133207, 2266412], [2266413, 3399618], [3399619, 4532824], [4532825, 5666030], [5666031, 6799236], [6799237, 7932442], [7932443, 9065648], [9065649, 10198854], [10198855, 11332060], [11332061, 12465266], [12465267, 13598472], [13598473, 14731678], [14731679, 15864884], [15864885, 16998090], [16998091, 18131296], [18131297, 19264502], [19264503, 20397708], [20397709, 21530914], [21530915, 22664132]] SRR7230823 file size 7658430 SRR7230823 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230823 SRR7230823_1.fastq SRR7230823_2.fastq Input file: SRR7230823_1.fastq Paired file: SRR7230823_2.fastq trimmed: SRR7230823-trimmed-pair1.fastq, SRR7230823-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:59:55 2025 >> started Tue Feb 11 10:00:34 2025 >> done (39.177s) 22664132 read pairs processed; of these: 65179 ( 0.29%) short read pairs filtered out after trimming by size control 59098 ( 0.26%) empty read pairs filtered out after trimming by size control 22539855 (99.45%) read pairs available; of these: 11000170 (48.80%) trimmed read pairs available after processing 11539685 (51.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 13 0.00% 21 8 0.00% 22 11 0.00% 23 6 0.00% 24 9 0.00% 25 12 0.00% 26 16 0.00% 27 15 0.00% 28 14 0.00% 29 17 0.00% 30 16 0.00% 31 7 0.00% 32 14 0.00% 33 13 0.00% 34 15 0.00% 35 21 0.00% 36 25 0.00% 37 23 0.00% 38 22 0.00% 39 28 0.00% 40 30 0.00% 41 40 0.00% 42 39 0.00% 43 40 0.00% 44 36 0.00% 45 56 0.00% 46 55 0.00% 47 70 0.00% 48 99 0.00% 49 81 0.00% 50 122 0.00% 51 96 0.00% 52 124 0.00% 53 134 0.00% 54 148 0.00% 55 168 0.00% 56 185 0.00% 57 205 0.00% 58 221 0.00% 59 243 0.00% 60 303 0.00% 61 316 0.00% 62 419 0.00% 63 438 0.00% 64 480 0.00% 65 573 0.00% 66 666 0.00% 67 835 0.00% 68 1156 0.01% 69 1611 0.01% 70 1332 0.01% 71 1250 0.01% 72 1361 0.01% 73 1413 0.01% 74 1579 0.01% 75 1729 0.01% 76 1944 0.01% 77 2174 0.01% 78 2398 0.01% 79 2704 0.01% 80 3132 0.01% 81 3573 0.02% 82 4109 0.02% 83 4780 0.02% 84 7769 0.03% 85 9680 0.04% 86 9770 0.04% 87 10391 0.05% 88 10382 0.05% 89 10975 0.05% 90 11482 0.05% 91 12214 0.05% 92 12727 0.06% 93 13624 0.06% 94 14537 0.06% 95 15271 0.07% 96 16320 0.07% 97 16721 0.07% 98 17458 0.08% 99 18660 0.08% 100 19924 0.09% 101 21198 0.09% 102 22569 0.10% 103 23873 0.11% 104 24990 0.11% 105 26659 0.12% 106 27907 0.12% 107 29161 0.13% 108 30215 0.13% 109 31451 0.14% 110 32707 0.15% 111 34865 0.15% 112 36505 0.16% 113 38400 0.17% 114 40655 0.18% 115 42718 0.19% 116 43919 0.19% 117 44791 0.20% 118 46464 0.21% 119 48386 0.21% 120 50445 0.22% 121 52901 0.23% 122 55211 0.24% 123 58213 0.26% 124 60834 0.27% 125 63523 0.28% 126 66064 0.29% 127 67668 0.30% 128 70710 0.31% 129 73819 0.33% 130 75820 0.34% 131 79410 0.35% 132 83866 0.37% 133 88478 0.39% 134 93439 0.41% 135 99515 0.44% 136 103503 0.46% 137 109385 0.49% 138 115475 0.51% 139 124749 0.55% 140 130161 0.58% 141 141448 0.63% 142 154393 0.68% 143 173229 0.77% 144 198783 0.88% 145 240721 1.07% 146 288704 1.28% 147 380895 1.69% 148 548979 2.44% 149 1053168 4.67% 150 5178534 22.98% 151 11539685 51.20% 22539855 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=7 prefix-density=0.66 prefix-fanout=3.0 sequence=CCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=313.71 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=16.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=15 prefix-density=0.46 prefix-fanout=2.2 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=51.08 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7230823 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:01:23 Started mapping on | Feb 11 10:01:23 Finished on | Feb 11 10:06:55 Mapping speed, Million of reads per hour | 244.41 Number of input reads | 22539855 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 20767348 Uniquely mapped reads % | 92.14% Average mapped length | 292.84 Number of splices: Total | 20037299 Number of splices: Annotated (sjdb) | 19537723 Number of splices: GT/AG | 19645128 Number of splices: GC/AG | 318956 Number of splices: AT/AC | 11156 Number of splices: Non-canonical | 62059 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 593800 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 148397 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.36% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1234611 1234611 1234611 N_multimapping 593800 593800 593800 N_noFeature 942320 20374313 1112260 N_ambiguous 391962 1794 167589 UnstrandedReadsAssigned:19433066 PositiveStrandReadsAssigned:391241 NegativeStrandReadsAssigned:19487499 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230823 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230823-trimmed-pair1.fastq SRR7230823-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,539,855 reads, 19,557,528 reads pseudoaligned [quant] estimated average fragment length: 240.304 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR7230823.ke.tsv 34699 SRR7230823.se.tsv 87100 total ==> SRR7230823.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.7 914 23.7625 Potri.005G024800.1.v4.1 1035 795.696 294 17.0863 Potri.004G059700.1.v4.1 961 721.813 7 0.448458 Potri.007G009000.2.v4.1 1416 1176.7 0 0 Potri.003G141000.2.v4.1 2943 2703.7 1320.55 22.5862 Potri.016G087400.1.v4.1 270 83.0039 939 523.137 Potri.015G069301.1.v4.1 564 331.941 0 0 Potri.010G195200.1.v4.1 1773 1533.7 114 3.43727 Potri.012G127500.1.v4.1 977 737.761 65 4.07423 ==> SRR7230823.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 653 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 417 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 114 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 5 SRR7230823 completed mapping pipeline successfully