Starting /dee2/code/volunteer_pipeline.sh SRR7230824 current disk space = 3053010108416 free memory = 1504017264 SRR7230824 SRAfilesize e884ee4534a07c2363c393a749ee9629 SRR7230824.sra SRR7230824.sra file validated SRR7230824 is paired end SRR7230824 is conventional basespace SRR7230824 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230824_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79575 33.0 33.0 34.0 32.0 34.0 2 33.12975 34.0 33.0 34.0 32.0 34.0 3 33.299 34.0 33.0 34.0 33.0 34.0 4 33.29925 34.0 33.0 34.0 33.0 34.0 5 31.9425 34.0 33.0 34.0 28.0 34.0 6 36.52775 38.0 37.0 38.0 34.0 38.0 7 37.19275 38.0 38.0 38.0 36.0 38.0 8 37.48625 38.0 38.0 38.0 37.0 38.0 9 37.537 38.0 38.0 38.0 38.0 38.0 10-14 37.452450000000006 38.0 38.0 38.0 37.6 38.0 15-19 37.4735 38.0 38.0 38.0 37.6 38.0 20-24 36.9088 38.0 38.0 38.0 35.4 38.0 25-29 37.32305 38.0 38.0 38.0 37.0 38.0 30-34 37.28225 38.0 38.0 38.0 37.0 38.0 35-39 37.0258 38.0 38.0 38.0 35.8 38.0 40-44 36.6916 38.0 38.0 38.0 34.8 38.0 45-49 37.14829999999999 38.0 38.0 38.0 36.4 38.0 50-54 37.13439999999999 38.0 38.0 38.0 36.4 38.0 55-59 37.05945 38.0 38.0 38.0 36.0 38.0 60-64 37.05245 38.0 38.0 38.0 36.0 38.0 65-69 37.081849999999996 38.0 38.0 38.0 36.0 38.0 70-74 30.7991 38.0 21.4 38.0 15.4 38.0 75-79 31.924200000000003 38.0 32.2 38.0 7.4 38.0 80-84 34.88375 38.0 37.0 38.0 27.4 38.0 85-89 36.1519 38.0 38.0 38.0 33.0 38.0 90-94 36.3601 38.0 38.0 38.0 34.0 38.0 95-99 36.25415 38.0 37.8 38.0 33.6 38.0 100-104 36.29935 38.0 37.8 38.0 34.0 38.0 105-109 36.30355000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.190650000000005 38.0 37.8 38.0 33.8 38.0 115-119 35.857299999999995 38.0 37.0 38.0 32.2 38.0 120-124 35.4178 38.0 36.2 38.0 30.0 38.0 125-129 34.97895 38.0 35.8 38.0 28.0 38.0 130-134 34.817299999999996 38.0 35.2 38.0 26.8 38.0 135-139 34.703649999999996 38.0 35.0 38.0 27.2 38.0 140-144 34.132099999999994 38.0 34.8 38.0 23.6 38.0 145-149 33.40105 38.0 33.4 38.0 21.0 38.0 150-151 28.799 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 2.0 15 1.0 16 1.0 17 6.0 18 2.0 19 3.0 20 2.0 21 8.0 22 10.0 23 6.0 24 15.0 25 18.0 26 21.0 27 28.0 28 26.0 29 53.0 30 61.0 31 73.0 32 141.0 33 199.0 34 291.0 35 449.0 36 838.0 37 1744.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.234558639659916 15.95398849712428 9.852463115778946 35.95898974743686 2 20.225 22.900000000000002 34.925 21.95 3 19.35 27.875 26.775 26.0 4 21.8 35.199999999999996 22.225 20.775 5 20.424999999999997 36.25 23.599999999999998 19.725 6 16.35 37.0 26.325 20.325 7 13.350000000000001 21.5 45.85 19.3 8 17.925 22.875 30.7 28.499999999999996 9 17.8 24.45 32.300000000000004 25.45 10-14 20.025000000000002 29.425 26.384999999999998 24.165 15-19 19.384999999999998 28.610000000000003 28.044999999999998 23.96 20-24 19.355 29.525000000000002 27.779999999999998 23.34 25-29 19.787968195229286 29.044356653498028 27.114067110066507 24.053608041206182 30-34 19.425 29.349999999999998 28.09 23.135 35-39 20.0 29.145 27.83 23.025000000000002 40-44 19.730649844798236 28.36187043156103 28.11154500851106 23.79593471512967 45-49 20.355 28.84 27.405 23.400000000000002 50-54 20.497174010903816 28.364927724703648 27.779722903016058 23.35817536137648 55-59 19.46822893195133 29.002052976816383 27.474838515847978 24.05487957538431 60-64 20.323452833967554 28.54996995794112 27.86901662327258 23.257560584818744 65-69 19.465171015073363 29.220291451750214 28.073513946617258 23.241023586559166 70-74 20.10490552542171 27.937056684746974 27.54962150563271 24.408416284198605 75-79 20.146851171985315 28.805422197119455 27.319966111268002 23.727760519627225 80-84 20.33190689907108 27.789374804300177 27.966809310092895 23.911908986535853 85-89 19.834960249572305 28.54986414410788 27.659253295763307 23.955922310556506 90-94 20.03 28.384999999999998 28.075 23.51 95-99 20.495 28.439999999999998 27.655 23.41 100-104 20.39 28.53 27.450000000000003 23.630000000000003 105-109 20.48 28.139999999999997 27.650000000000002 23.73 110-114 20.555 27.96 27.52 23.965 115-119 20.4 28.435 28.015 23.150000000000002 120-124 20.89 28.465 27.455000000000002 23.189999999999998 125-129 20.810000000000002 28.110000000000003 27.0 24.08 130-134 20.77 28.449999999999996 27.0 23.78 135-139 20.955 28.015 26.924999999999997 24.104999999999997 140-144 21.04 28.249999999999996 27.165 23.544999999999998 145-149 21.17 28.549999999999997 26.33 23.95 150-151 20.825 27.987499999999997 27.525 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 2.0 22 2.5 23 5.0 24 5.5 25 6.5 26 7.0 27 9.0 28 17.5 29 21.0 30 28.5 31 39.5 32 53.0 33 66.0 34 77.5 35 97.5 36 127.0 37 143.5 38 145.0 39 178.0 40 216.5 41 220.0 42 226.0 43 255.5 44 274.5 45 258.5 46 241.0 47 238.5 48 203.0 49 159.5 50 137.0 51 122.0 52 104.0 53 77.5 54 56.5 55 45.5 56 40.0 57 26.5 58 19.5 59 19.0 60 9.5 61 6.0 62 5.5 63 2.5 64 1.5 65 0.5 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.0 35-39 0.0 40-44 0.13 45-49 0.0 50-54 0.034999999999999996 55-59 0.145 60-64 0.13999999999999999 65-69 0.155 70-74 16.115 75-79 11.475 80-84 4.19 85-89 0.63 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.5125000000000002 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.875 0.0 0.0 0.0 0.0 120-121 3.0999999999999996 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.9 0.0 0.0 0.0 0.0 126-127 4.2875 0.0 0.0 0.0 0.0 128-129 4.675 0.0 0.0 0.0 0.0 130-131 5.0875 0.0 0.0 0.0 0.0 132-133 5.4625 0.0 0.0 0.0 0.0 134-135 5.9625 0.0 0.0 0.0 0.0 136-137 6.4875 0.0 0.0 0.0 0.0 138-139 7.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATTGA 10 0.0073757805 141.325 4 >>END_MODULE SRR7230824 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230824_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65975 33.0 33.0 34.0 32.0 34.0 2 32.8535 33.0 33.0 34.0 32.0 34.0 3 32.89775 34.0 33.0 34.0 32.0 34.0 4 32.84875 34.0 33.0 34.0 32.0 34.0 5 32.4575 33.0 33.0 34.0 31.0 34.0 6 36.50175 38.0 38.0 38.0 34.0 38.0 7 36.75775 38.0 38.0 38.0 35.0 38.0 8 36.81125 38.0 38.0 38.0 36.0 38.0 9 36.81125 38.0 38.0 38.0 36.0 38.0 10-14 36.37335 38.0 37.8 38.0 33.2 38.0 15-19 36.92745 38.0 38.0 38.0 36.2 38.0 20-24 36.845749999999995 38.0 38.0 38.0 36.0 38.0 25-29 36.46725 38.0 38.0 38.0 34.4 38.0 30-34 36.65665 38.0 38.0 38.0 35.6 38.0 35-39 36.35655 38.0 38.0 38.0 34.0 38.0 40-44 35.944500000000005 38.0 38.0 38.0 31.6 38.0 45-49 36.30885 38.0 38.0 38.0 33.4 38.0 50-54 36.51115 38.0 38.0 38.0 34.8 38.0 55-59 36.4202 38.0 38.0 38.0 34.4 38.0 60-64 36.283899999999996 38.0 38.0 38.0 33.8 38.0 65-69 35.926700000000004 38.0 37.4 38.0 31.6 38.0 70-74 36.15554999999999 38.0 38.0 38.0 33.8 38.0 75-79 36.2408 38.0 38.0 38.0 34.0 38.0 80-84 36.125350000000005 38.0 38.0 38.0 33.6 38.0 85-89 36.22175 38.0 38.0 38.0 33.8 38.0 90-94 36.1462 38.0 38.0 38.0 34.0 38.0 95-99 35.902 38.0 38.0 38.0 32.6 38.0 100-104 35.1564 38.0 36.6 38.0 27.8 38.0 105-109 35.2855 38.0 37.0 38.0 28.2 38.0 110-114 35.399449999999995 38.0 37.0 38.0 29.6 38.0 115-119 35.4173 38.0 37.0 38.0 30.4 38.0 120-124 35.11825 38.0 36.4 38.0 28.2 38.0 125-129 34.563 38.0 35.6 38.0 24.6 38.0 130-134 34.42824999999999 38.0 35.0 38.0 24.0 38.0 135-139 34.10965 38.0 34.2 38.0 23.6 38.0 140-144 33.3504 38.0 33.0 38.0 19.8 38.0 145-149 32.11185 38.0 32.6 38.0 10.8 38.0 150-151 25.183 32.0 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 4.0 5 3.0 6 3.0 7 1.0 8 3.0 9 2.0 10 3.0 11 1.0 12 2.0 13 1.0 14 3.0 15 4.0 16 8.0 17 6.0 18 9.0 19 11.0 20 12.0 21 12.0 22 11.0 23 13.0 24 21.0 25 24.0 26 25.0 27 36.0 28 48.0 29 48.0 30 60.0 31 83.0 32 104.0 33 122.0 34 172.0 35 276.0 36 646.0 37 2211.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.175 18.45 14.45 27.925 2 24.425 26.174999999999997 32.300000000000004 17.1 3 21.125 27.975 30.975 19.925 4 24.6 36.075 21.349999999999998 17.974999999999998 5 23.825 37.15 21.45 17.575 6 18.45 38.15 24.025 19.375 7 17.625 17.349999999999998 43.05 21.975 8 21.175 23.25 27.825 27.750000000000004 9 21.0 23.65 29.875 25.474999999999998 10-14 23.3 28.99 25.97 21.740000000000002 15-19 23.305 28.005000000000003 27.560000000000002 21.13 20-24 22.915 28.4 27.950000000000003 20.735 25-29 23.185 27.96 28.110000000000003 20.745 30-34 23.055 28.415000000000003 28.000000000000004 20.53 35-39 23.525 27.685 28.005000000000003 20.785 40-44 23.145 28.060000000000002 27.855 20.94 45-49 23.51970394078816 27.620524104820966 27.730546109221844 21.129225845169035 50-54 23.05805805805806 28.098098098098095 28.083083083083082 20.76076076076076 55-59 22.944656105875275 28.083015841187088 28.168237417284942 20.8040906356527 60-64 23.047304730473048 28.012801280128013 28.337833783378336 20.602060206020603 65-69 23.57923223413852 28.03447930239551 28.189836624235742 20.196451839230228 70-74 23.817635270541082 27.414829659318634 27.70040080160321 21.067134268537075 75-79 23.465 28.13 27.625 20.78 80-84 23.532059617885366 27.503250975292588 27.698309492847855 21.26637991397419 85-89 23.76 27.785 27.944999999999997 20.51 90-94 23.39 27.68 28.804999999999996 20.125 95-99 23.189999999999998 27.794999999999998 28.605000000000004 20.41 100-104 23.54 27.66 28.355000000000004 20.445 105-109 23.005 28.134999999999998 28.155 20.705000000000002 110-114 23.885 28.355000000000004 27.57 20.19 115-119 23.465 28.395 27.915 20.225 120-124 24.605 27.855 27.445000000000004 20.095 125-129 24.18 27.735 27.88 20.205000000000002 130-134 25.035 27.73 27.515 19.72 135-139 24.42 28.38 27.765 19.435 140-144 25.15 27.85 27.515 19.485 145-149 25.19 28.365000000000002 26.83 19.615 150-151 25.337500000000002 28.425 26.625 19.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 2.0 22 2.0 23 1.5 24 2.5 25 3.0 26 3.0 27 4.5 28 9.0 29 11.0 30 18.5 31 24.5 32 28.5 33 37.0 34 55.5 35 74.5 36 82.5 37 99.5 38 130.0 39 156.0 40 180.0 41 227.0 42 256.5 43 249.5 44 254.5 45 279.0 46 282.5 47 263.0 48 234.0 49 212.0 50 183.0 51 135.5 52 103.0 53 82.0 54 72.0 55 59.0 56 46.0 57 38.5 58 29.5 59 23.0 60 13.5 61 10.0 62 8.5 63 3.5 64 2.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.02 50-54 0.1 55-59 0.26 60-64 0.01 65-69 0.22999999999999998 70-74 0.2 75-79 0.0 80-84 0.03 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5790533736153072 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.5374999999999996 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.175 0.0 0.0 0.0 0.0 122-123 3.5375 0.0 0.0 0.0 0.0 124-125 3.9625000000000004 0.0 0.0 0.0 0.0 126-127 4.375 0.0 0.0 0.0 0.0 128-129 4.8 0.0 0.0 0.0 0.0 130-131 5.175000000000001 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 6.025 0.0 0.0 0.0 0.0 136-137 6.5625 0.0 0.0 0.0 0.0 138-139 7.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTCCA 10 0.006830828 145.0 145 >>END_MODULE Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970274 spots for SRR7230824.sra Written 970274 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra Read 970263 spots for SRR7230824.sra Written 970263 spots for SRR7230824.sra SRR ids: ['SRR7230824.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5py3ccgc SRR7230824.sra spots: 19405271 blocks: [[1, 970263], [970264, 1940526], [1940527, 2910789], [2910790, 3881052], [3881053, 4851315], [4851316, 5821578], [5821579, 6791841], [6791842, 7762104], [7762105, 8732367], [8732368, 9702630], [9702631, 10672893], [10672894, 11643156], [11643157, 12613419], [12613420, 13583682], [13583683, 14553945], [14553946, 15524208], [15524209, 16494471], [16494472, 17464734], [17464735, 18434997], [18434998, 19405271]] SRR7230824 file size 6554109 SRR7230824 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230824 SRR7230824_1.fastq SRR7230824_2.fastq Input file: SRR7230824_1.fastq Paired file: SRR7230824_2.fastq trimmed: SRR7230824-trimmed-pair1.fastq, SRR7230824-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:47:10 2025 >> started Tue Feb 11 10:47:30 2025 >> done (20.353s) 19405271 read pairs processed; of these: 26388 ( 0.14%) short read pairs filtered out after trimming by size control 25303 ( 0.13%) empty read pairs filtered out after trimming by size control 19353580 (99.73%) read pairs available; of these: 9257255 (47.83%) trimmed read pairs available after processing 10096325 (52.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 7 0.00% 21 1 0.00% 22 5 0.00% 23 1 0.00% 24 3 0.00% 25 7 0.00% 26 4 0.00% 27 7 0.00% 28 8 0.00% 29 7 0.00% 30 7 0.00% 31 5 0.00% 32 16 0.00% 33 12 0.00% 34 14 0.00% 35 13 0.00% 36 10 0.00% 37 14 0.00% 38 20 0.00% 39 21 0.00% 40 30 0.00% 41 29 0.00% 42 28 0.00% 43 34 0.00% 44 32 0.00% 45 36 0.00% 46 54 0.00% 47 58 0.00% 48 52 0.00% 49 70 0.00% 50 73 0.00% 51 93 0.00% 52 114 0.00% 53 115 0.00% 54 121 0.00% 55 157 0.00% 56 132 0.00% 57 162 0.00% 58 186 0.00% 59 225 0.00% 60 246 0.00% 61 262 0.00% 62 290 0.00% 63 376 0.00% 64 375 0.00% 65 434 0.00% 66 527 0.00% 67 551 0.00% 68 763 0.00% 69 1306 0.01% 70 1121 0.01% 71 912 0.00% 72 1038 0.01% 73 1102 0.01% 74 1248 0.01% 75 1413 0.01% 76 1576 0.01% 77 1816 0.01% 78 1943 0.01% 79 2241 0.01% 80 2505 0.01% 81 2887 0.01% 82 3251 0.02% 83 3828 0.02% 84 5197 0.03% 85 6209 0.03% 86 6592 0.03% 87 7146 0.04% 88 7323 0.04% 89 8042 0.04% 90 8545 0.04% 91 9156 0.05% 92 9724 0.05% 93 10796 0.06% 94 11661 0.06% 95 12447 0.06% 96 13088 0.07% 97 14042 0.07% 98 14699 0.08% 99 15963 0.08% 100 16801 0.09% 101 17860 0.09% 102 19035 0.10% 103 20245 0.10% 104 21711 0.11% 105 23141 0.12% 106 24215 0.13% 107 25317 0.13% 108 26453 0.14% 109 27733 0.14% 110 29211 0.15% 111 30861 0.16% 112 32579 0.17% 113 33862 0.17% 114 35190 0.18% 115 36734 0.19% 116 38741 0.20% 117 39872 0.21% 118 42016 0.22% 119 42900 0.22% 120 44900 0.23% 121 46351 0.24% 122 48439 0.25% 123 50864 0.26% 124 53026 0.27% 125 54784 0.28% 126 57635 0.30% 127 59693 0.31% 128 61345 0.32% 129 63839 0.33% 130 66265 0.34% 131 69102 0.36% 132 72504 0.37% 133 75534 0.39% 134 79928 0.41% 135 84995 0.44% 136 88099 0.46% 137 92998 0.48% 138 98355 0.51% 139 104940 0.54% 140 109736 0.57% 141 118485 0.61% 142 129241 0.67% 143 142525 0.74% 144 164015 0.85% 145 196673 1.02% 146 235069 1.21% 147 307603 1.59% 148 447421 2.31% 149 862801 4.46% 150 4390980 22.69% 151 10096325 52.17% 19353580 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=13 prefix-density=0.46 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=19 fanout-score=35.98 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=11.1 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=20 prefix-density=0.45 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=44.82 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.3 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT SRR7230824 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:48:14 Started mapping on | Feb 11 10:48:15 Finished on | Feb 11 10:50:36 Mapping speed, Million of reads per hour | 494.13 Number of input reads | 19353580 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18038405 Uniquely mapped reads % | 93.20% Average mapped length | 293.19 Number of splices: Total | 17259976 Number of splices: Annotated (sjdb) | 16862426 Number of splices: GT/AG | 16920206 Number of splices: GC/AG | 281313 Number of splices: AT/AC | 9959 Number of splices: Non-canonical | 48498 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 518141 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 58099 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.71% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 821245 821245 821245 N_multimapping 518141 518141 518141 N_noFeature 679137 17752090 788832 N_ambiguous 300276 1041 123122 UnstrandedReadsAssigned:17058992 PositiveStrandReadsAssigned:285274 NegativeStrandReadsAssigned:17126451 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230824 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230824-trimmed-pair1.fastq SRR7230824-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,353,580 reads, 17,146,910 reads pseudoaligned [quant] estimated average fragment length: 233.267 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR7230824.ke.tsv 34699 SRR7230824.se.tsv 87100 total ==> SRR7230824.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.73 1094.6 33.367 Potri.005G024800.1.v4.1 1035 802.733 297 20.1402 Potri.004G059700.1.v4.1 961 728.791 11 0.821615 Potri.007G009000.2.v4.1 1416 1183.73 0 0 Potri.003G141000.2.v4.1 2943 2710.73 1077.44 21.6363 Potri.016G087400.1.v4.1 270 83.9233 1325 859.432 Potri.015G069301.1.v4.1 564 336.188 0 0 Potri.010G195200.1.v4.1 1773 1540.73 558 19.7145 Potri.012G127500.1.v4.1 977 744.775 143 10.4518 ==> SRR7230824.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1038 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 351 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7230824 completed mapping pipeline successfully