Starting /dee2/code/volunteer_pipeline.sh SRR7230825 current disk space = 3053243924480 free memory = 1452173128 SRR7230825 SRAfilesize 59fc3a2202006e4a3a0765eb26ce4376 SRR7230825.sra SRR7230825.sra file validated SRR7230825 is paired end SRR7230825 is conventional basespace SRR7230825 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230825_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.42325 34.0 33.0 34.0 33.0 34.0 2 33.473 34.0 34.0 34.0 33.0 34.0 3 33.44475 34.0 34.0 34.0 33.0 34.0 4 33.353 34.0 34.0 34.0 33.0 34.0 5 33.48375 34.0 34.0 34.0 33.0 34.0 6 37.26975 38.0 38.0 38.0 36.0 38.0 7 37.5255 38.0 38.0 38.0 37.0 38.0 8 37.5745 38.0 38.0 38.0 38.0 38.0 9 37.6575 38.0 38.0 38.0 38.0 38.0 10-14 37.6095 38.0 38.0 38.0 38.0 38.0 15-19 37.354499999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.536100000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.571250000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.5458 38.0 38.0 38.0 38.0 38.0 35-39 37.231700000000004 38.0 38.0 38.0 37.2 38.0 40-44 36.958749999999995 38.0 38.0 38.0 36.0 38.0 45-49 37.00255 38.0 38.0 38.0 36.0 38.0 50-54 36.77375 38.0 37.8 38.0 35.0 38.0 55-59 37.2587 38.0 38.0 38.0 37.0 38.0 60-64 37.308550000000004 38.0 38.0 38.0 37.0 38.0 65-69 37.252 38.0 38.0 38.0 37.0 38.0 70-74 33.40135 38.0 35.0 38.0 15.8 38.0 75-79 33.9317 38.0 36.8 38.0 20.2 38.0 80-84 35.7724 38.0 38.0 38.0 31.4 38.0 85-89 36.455650000000006 38.0 38.0 38.0 34.4 38.0 90-94 36.6071 38.0 38.0 38.0 34.6 38.0 95-99 36.7127 38.0 38.0 38.0 35.0 38.0 100-104 35.7934 38.0 37.0 38.0 30.0 38.0 105-109 36.25855 38.0 37.4 38.0 33.4 38.0 110-114 35.76965 38.0 36.8 38.0 30.8 38.0 115-119 36.0993 38.0 37.2 38.0 33.6 38.0 120-124 35.381449999999994 38.0 36.4 38.0 29.4 38.0 125-129 35.2326 38.0 35.8 38.0 29.0 38.0 130-134 34.96385 38.0 35.4 38.0 26.4 38.0 135-139 35.18300000000001 38.0 35.4 38.0 29.0 38.0 140-144 34.376599999999996 38.0 35.0 38.0 25.4 38.0 145-149 33.641450000000006 38.0 33.8 38.0 22.6 38.0 150-151 29.86025 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 3.0 14 0.0 15 1.0 16 1.0 17 2.0 18 2.0 19 2.0 20 1.0 21 3.0 22 8.0 23 9.0 24 10.0 25 19.0 26 17.0 27 25.0 28 35.0 29 27.0 30 48.0 31 72.0 32 103.0 33 162.0 34 220.0 35 331.0 36 766.0 37 2131.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.0 16.425 9.825000000000001 31.75 2 23.674999999999997 20.075000000000003 33.275 22.975 3 18.4 28.025 27.650000000000002 25.924999999999997 4 21.925 34.050000000000004 22.1 21.925 5 19.375 37.974999999999994 24.2 18.45 6 17.75887943971986 36.643321660830416 25.287643821910955 20.31015507753877 7 14.224999999999998 22.25 44.2 19.325 8 18.3 22.25 31.3 28.15 9 16.975 23.599999999999998 32.800000000000004 26.625 10-14 19.88 29.580000000000002 26.515 24.025 15-19 19.919999999999998 28.694999999999997 27.584999999999997 23.799999999999997 20-24 19.895 28.925 28.28 22.900000000000002 25-29 19.25 28.32 28.810000000000002 23.62 30-34 20.09 28.349999999999998 27.54 24.02 35-39 19.98898678414097 28.994793752503 27.823388065678817 23.192831397677214 40-44 20.279825485181284 28.88521137355198 27.455995185798105 23.37896795546863 45-49 20.584116823364674 28.445689137827568 27.185437087417487 23.78475695139028 50-54 19.98 28.595 27.589999999999996 23.835 55-59 20.02000500125031 28.037009252313077 27.84196049012253 24.10102525631408 60-64 19.86 28.235 27.905 24.0 65-69 20.329065813162632 28.615723144628923 27.20544108821764 23.849769953990798 70-74 19.996677372909513 28.724111197253293 27.43382434378115 23.845387086056043 75-79 20.162118346392866 28.921912996487436 26.738719265063498 24.1772493920562 80-84 19.941424314047886 28.83567978625013 27.28907614839174 23.933819751310246 85-89 21.092136416301447 28.300841267442443 27.439423706614274 23.167598609641832 90-94 20.079015803160633 28.170634126825366 27.61052210442088 24.13982796559312 95-99 20.122012201220123 28.57285728572857 27.632763276327633 23.672367236723673 100-104 20.135101325994494 28.34125594195647 27.400550412809604 24.12309231923943 105-109 20.671537229783826 28.217574059247397 27.53702962369896 23.573859087269817 110-114 20.76830732292917 27.911164465786314 27.756102440976388 23.564425770308123 115-119 20.59220727254539 28.239883959385786 27.339568849097184 23.82833991897164 120-124 20.945 28.18 26.85 24.025 125-129 20.823741367230507 27.865078570713642 26.829146231608448 24.482033830447403 130-134 21.090071135156798 27.66255886183749 27.62248271716261 23.6248872858431 135-139 20.828124218632794 27.729159373906086 27.139070860629094 24.303645546832026 140-144 21.48537134283571 28.012003000750184 26.916729182295573 23.585896474118528 145-149 21.304587064178882 28.042619178630385 26.59696863588615 24.055825121304586 150-151 21.270476428660746 27.897961735650867 26.35988495685882 24.471676878829562 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 2.5 24 4.0 25 5.0 26 6.5 27 9.5 28 19.5 29 21.5 30 20.5 31 39.0 32 53.5 33 57.0 34 67.0 35 96.0 36 120.5 37 135.5 38 156.0 39 166.5 40 181.0 41 213.0 42 234.0 43 237.5 44 244.5 45 241.0 46 240.0 47 233.5 48 207.5 49 184.0 50 168.5 51 141.5 52 107.5 53 79.5 54 66.0 55 59.5 56 47.0 57 40.0 58 30.5 59 21.5 60 12.5 61 4.5 62 5.0 63 6.0 64 2.5 65 1.5 66 1.5 67 1.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.12 40-44 0.295 45-49 0.02 50-54 0.0 55-59 0.025 60-64 0.0 65-69 0.02 70-74 9.71 75-79 7.475 80-84 2.69 85-89 0.745 90-94 0.02 95-99 0.01 100-104 0.075 105-109 0.08 110-114 0.04 115-119 0.034999999999999996 120-124 0.0 125-129 0.09 130-134 0.19 135-139 0.015 140-144 0.025 145-149 0.045 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06494819307557 98.0 2 0.859236795552186 1.7000000000000002 3 0.050543340914834464 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025271670457417232 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.4375 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.0375 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.8375000000000004 0.0 0.0 0.0 0.0 126-127 4.199999999999999 0.0 0.0 0.0 0.0 128-129 4.4375 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.1625 0.0 0.0 0.0 0.0 134-135 5.574999999999999 0.0 0.0 0.0 0.0 136-137 6.0 0.0 0.0 0.0 0.0 138-139 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCATGT 10 0.0072238143 142.3125 1 >>END_MODULE SRR7230825 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230825_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.817 33.0 33.0 34.0 32.0 34.0 2 32.92475 34.0 33.0 34.0 32.0 34.0 3 32.9495 34.0 33.0 34.0 32.0 34.0 4 32.906 34.0 33.0 34.0 32.0 34.0 5 32.955 34.0 33.0 34.0 32.0 34.0 6 37.02375 38.0 38.0 38.0 37.0 38.0 7 37.02475 38.0 38.0 38.0 37.0 38.0 8 36.9375 38.0 38.0 38.0 37.0 38.0 9 36.96425 38.0 38.0 38.0 37.0 38.0 10-14 36.89375 38.0 38.0 38.0 37.0 38.0 15-19 36.90365 38.0 38.0 38.0 37.0 38.0 20-24 36.8977 38.0 38.0 38.0 37.0 38.0 25-29 36.87045 38.0 38.0 38.0 37.0 38.0 30-34 36.84275 38.0 38.0 38.0 36.8 38.0 35-39 36.66115 38.0 38.0 38.0 36.0 38.0 40-44 36.71285 38.0 38.0 38.0 36.2 38.0 45-49 36.7251 38.0 38.0 38.0 36.2 38.0 50-54 36.72355 38.0 38.0 38.0 36.8 38.0 55-59 36.403600000000004 38.0 38.0 38.0 35.6 38.0 60-64 36.57435 38.0 38.0 38.0 35.8 38.0 65-69 36.450199999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.18095 38.0 38.0 38.0 34.4 38.0 75-79 36.4898 38.0 38.0 38.0 35.4 38.0 80-84 36.4285 38.0 38.0 38.0 35.6 38.0 85-89 36.37285000000001 38.0 38.0 38.0 35.2 38.0 90-94 36.34740000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.218199999999996 38.0 38.0 38.0 34.6 38.0 100-104 36.012899999999995 38.0 38.0 38.0 33.8 38.0 105-109 35.8236 38.0 38.0 38.0 33.4 38.0 110-114 35.813849999999995 38.0 38.0 38.0 33.6 38.0 115-119 35.7191 38.0 37.8 38.0 33.0 38.0 120-124 35.389050000000005 38.0 37.6 38.0 31.6 38.0 125-129 35.1916 38.0 37.0 38.0 31.0 38.0 130-134 35.02075 38.0 36.6 38.0 30.0 38.0 135-139 34.53920000000001 38.0 36.0 38.0 26.4 38.0 140-144 34.09335 38.0 35.4 38.0 24.8 38.0 145-149 33.092349999999996 38.0 33.4 38.0 16.4 38.0 150-151 27.888375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 6.0 4 8.0 5 2.0 6 3.0 7 1.0 8 4.0 9 6.0 10 2.0 11 4.0 12 4.0 13 3.0 14 5.0 15 6.0 16 9.0 17 2.0 18 5.0 19 5.0 20 7.0 21 14.0 22 11.0 23 18.0 24 17.0 25 13.0 26 21.0 27 16.0 28 24.0 29 24.0 30 46.0 31 50.0 32 53.0 33 76.0 34 126.0 35 205.0 36 507.0 37 2682.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.4121181772659 20.85628442663996 13.244867300951427 24.486730095142715 2 28.060075093867333 23.27909887359199 30.76345431789737 17.897371714643302 3 20.375 27.825 32.375 19.425 4 23.05 35.3 22.025 19.625 5 24.349999999999998 37.45 20.175 18.025 6 19.925 37.425000000000004 22.85 19.8 7 19.775000000000002 17.625 41.075 21.525 8 20.8 24.0 27.575 27.625 9 20.43010752688172 24.88122030507627 30.182545636409102 24.50612653163291 10-14 23.25697709312794 27.87336200860258 26.76803040912274 22.101630489146746 15-19 23.0880808282899 27.35957585154804 27.959785925073778 21.59255739508828 20-24 22.370066529938473 28.42779250662798 27.84753138912511 21.35460957430844 25-29 23.082695482515383 27.440092050627847 28.570713892640953 20.906498574215817 30-34 22.605172327547397 27.67745485468461 28.542844279925966 21.17452853784203 35-39 22.947210407805855 28.011008256192145 27.615711783837877 21.426069552164122 40-44 22.45234879183551 28.035419480714392 28.125469007954372 21.38676271949572 45-49 23.00490637829178 27.956343246220083 27.776108941624113 21.262641433864022 50-54 22.988275378294418 27.267261248622106 28.008818518889665 21.735644854193804 55-59 23.352118345577136 27.543524202475595 27.98128207708564 21.123075374861628 60-64 23.135937421651708 27.894499323070754 27.92458506744221 21.04497818783533 65-69 23.670987840418046 27.303788563963423 27.70073359461361 21.324490001004925 70-74 23.772467115172205 27.69856411286274 27.327040867556985 21.201927904408073 75-79 23.6806562953329 27.252263518583362 27.717472862788256 21.349607323295483 80-84 23.361066559743385 27.866880513231756 27.405773857257422 21.36627906976744 85-89 24.329731892757103 27.5110044017607 27.43097238895558 20.72829131652661 90-94 23.631815907953975 27.56378189094547 27.313656828414207 21.490745372686344 95-99 23.611805902951478 27.743871935967984 27.668834417208604 20.975487743871938 100-104 23.624724944988998 27.590518103620727 27.91058211642328 20.874174834966993 105-109 23.938590788618292 27.544131619742963 27.774166124918736 20.743111466720006 110-114 24.062672072883817 28.087300395454772 27.351454172298144 20.498573359363267 115-119 23.816671670169118 27.849494646252378 27.71440008005604 20.619433603522467 120-124 24.02240224022402 27.677767776777678 27.577757775777577 20.72207220722072 125-129 24.747474747474747 27.59275927592759 27.002700270027002 20.657065706570656 130-134 25.0112528132033 27.771942985746435 27.46686671667917 19.749937484371095 135-139 24.237568230757674 27.7980870349041 27.773048224748358 20.191296509589865 140-144 25.028754313146973 28.059208881332196 27.054058108716305 19.85797869680452 145-149 25.372537253725376 27.75777577757776 27.137713771377136 19.731973197319732 150-151 24.9 27.950000000000003 27.212500000000002 19.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 2.0 21 2.0 22 1.0 23 1.5 24 2.0 25 3.5 26 4.0 27 5.5 28 6.5 29 10.0 30 15.5 31 26.0 32 31.0 33 33.0 34 47.0 35 58.0 36 87.5 37 114.5 38 130.0 39 161.0 40 192.0 41 206.0 42 218.0 43 249.5 44 266.0 45 265.0 46 258.5 47 241.5 48 231.0 49 200.5 50 153.0 51 137.5 52 126.5 53 106.0 54 87.5 55 78.5 56 66.0 57 44.5 58 32.5 59 23.5 60 20.5 61 18.5 62 13.5 63 8.5 64 3.0 65 0.5 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.03 15-19 0.034999999999999996 20-24 0.045 25-29 0.055 30-34 0.045 35-39 0.075 40-44 0.055 45-49 0.13 50-54 0.21 55-59 0.63 60-64 0.28500000000000003 65-69 0.49 70-74 0.41000000000000003 75-79 0.045 80-84 0.24 85-89 0.04 90-94 0.05 95-99 0.05 100-104 0.02 105-109 0.015 110-114 0.11499999999999999 115-119 0.06999999999999999 120-124 0.01 125-129 0.01 130-134 0.025 135-139 0.155 140-144 0.015 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4206549118388 98.675 2 0.4534005037783375 0.8999999999999999 3 0.07556675062972291 0.22499999999999998 4 0.05037783375314861 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.6749999999999998 0.0 0.0 0.0 0.0 110-111 1.8624999999999998 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.1875 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 4.075 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 4.7125 0.0 0.0 0.0 0.0 130-131 4.9875 0.0 0.0 0.0 0.0 132-133 5.35 0.0 0.0 0.0 0.0 134-135 5.75 0.0 0.0 0.0 0.0 136-137 6.1875 0.0 0.0 0.0 0.0 138-139 6.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583272 spots for SRR7230825.sra Written 583272 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra Read 583258 spots for SRR7230825.sra Written 583258 spots for SRR7230825.sra SRR ids: ['SRR7230825.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wnrb89qj SRR7230825.sra spots: 11665174 blocks: [[1, 583258], [583259, 1166516], [1166517, 1749774], [1749775, 2333032], [2333033, 2916290], [2916291, 3499548], [3499549, 4082806], [4082807, 4666064], [4666065, 5249322], [5249323, 5832580], [5832581, 6415838], [6415839, 6999096], [6999097, 7582354], [7582355, 8165612], [8165613, 8748870], [8748871, 9332128], [9332129, 9915386], [9915387, 10498644], [10498645, 11081902], [11081903, 11665174]] SRR7230825 file size 3931244 SRR7230825 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230825 SRR7230825_1.fastq SRR7230825_2.fastq Input file: SRR7230825_1.fastq Paired file: SRR7230825_2.fastq trimmed: SRR7230825-trimmed-pair1.fastq, SRR7230825-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:28:31 2025 >> started Tue Feb 11 10:28:45 2025 >> done (14.359s) 11665174 read pairs processed; of these: 18032 ( 0.15%) short read pairs filtered out after trimming by size control 13382 ( 0.11%) empty read pairs filtered out after trimming by size control 11633760 (99.73%) read pairs available; of these: 5048252 (43.39%) trimmed read pairs available after processing 6585508 (56.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 0 0.00% 20 2 0.00% 21 3 0.00% 22 10 0.00% 23 4 0.00% 24 3 0.00% 25 1 0.00% 26 5 0.00% 27 1 0.00% 28 4 0.00% 29 3 0.00% 30 6 0.00% 31 9 0.00% 32 3 0.00% 33 10 0.00% 34 10 0.00% 35 12 0.00% 36 11 0.00% 37 13 0.00% 38 13 0.00% 39 11 0.00% 40 18 0.00% 41 21 0.00% 42 27 0.00% 43 13 0.00% 44 20 0.00% 45 24 0.00% 46 35 0.00% 47 48 0.00% 48 50 0.00% 49 60 0.00% 50 61 0.00% 51 59 0.00% 52 86 0.00% 53 81 0.00% 54 78 0.00% 55 94 0.00% 56 122 0.00% 57 118 0.00% 58 165 0.00% 59 183 0.00% 60 183 0.00% 61 197 0.00% 62 232 0.00% 63 279 0.00% 64 268 0.00% 65 369 0.00% 66 359 0.00% 67 416 0.00% 68 563 0.00% 69 1115 0.01% 70 918 0.01% 71 705 0.01% 72 805 0.01% 73 925 0.01% 74 973 0.01% 75 1059 0.01% 76 1136 0.01% 77 1256 0.01% 78 1481 0.01% 79 1635 0.01% 80 1931 0.02% 81 2566 0.02% 82 2438 0.02% 83 2672 0.02% 84 4234 0.04% 85 4244 0.04% 86 4387 0.04% 87 4875 0.04% 88 4999 0.04% 89 5640 0.05% 90 5912 0.05% 91 6337 0.05% 92 6757 0.06% 93 7124 0.06% 94 7826 0.07% 95 8168 0.07% 96 8473 0.07% 97 8977 0.08% 98 9220 0.08% 99 9941 0.09% 100 10476 0.09% 101 11233 0.10% 102 12050 0.10% 103 12540 0.11% 104 13444 0.12% 105 14176 0.12% 106 14524 0.12% 107 15297 0.13% 108 15936 0.14% 109 16696 0.14% 110 17488 0.15% 111 18413 0.16% 112 19223 0.17% 113 20316 0.17% 114 21441 0.18% 115 21992 0.19% 116 23047 0.20% 117 23450 0.20% 118 24017 0.21% 119 24682 0.21% 120 26130 0.22% 121 26757 0.23% 122 28084 0.24% 123 29915 0.26% 124 31119 0.27% 125 31859 0.27% 126 33422 0.29% 127 34427 0.30% 128 34838 0.30% 129 36416 0.31% 130 37395 0.32% 131 38777 0.33% 132 40593 0.35% 133 42460 0.36% 134 44520 0.38% 135 46802 0.40% 136 48848 0.42% 137 50614 0.44% 138 52900 0.45% 139 55343 0.48% 140 57824 0.50% 141 62714 0.54% 142 67151 0.58% 143 73842 0.63% 144 83708 0.72% 145 96429 0.83% 146 114860 0.99% 147 146741 1.26% 148 212149 1.82% 149 405910 3.49% 150 2472167 21.25% 151 6585508 56.61% 11633760 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=15 prefix-density=0.58 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=380.88 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=8 prefix-density=0.58 prefix-fanout=2.6 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=51.29 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.5 sequence=CACAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR7230825 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:29:36 Started mapping on | Feb 11 10:29:36 Finished on | Feb 11 10:31:12 Mapping speed, Million of reads per hour | 436.27 Number of input reads | 11633760 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 10608415 Uniquely mapped reads % | 91.19% Average mapped length | 293.38 Number of splices: Total | 10202376 Number of splices: Annotated (sjdb) | 9960836 Number of splices: GT/AG | 9985128 Number of splices: GC/AG | 178591 Number of splices: AT/AC | 5828 Number of splices: Non-canonical | 32829 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.53 Insertion rate per base | 0.03% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318689 % of reads mapped to multiple loci | 2.74% Number of reads mapped to too many loci | 176128 % of reads mapped to too many loci | 1.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.26% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 725323 725323 725323 N_multimapping 318689 318689 318689 N_noFeature 441661 10411023 521048 N_ambiguous 198824 1123 80045 UnstrandedReadsAssigned:9967930 PositiveStrandReadsAssigned:196269 NegativeStrandReadsAssigned:10007322 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230825 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230825-trimmed-pair1.fastq SRR7230825-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,633,760 reads, 10,129,185 reads pseudoaligned [quant] estimated average fragment length: 245.261 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,097 rounds 52401 SRR7230825.ke.tsv 34699 SRR7230825.se.tsv 87100 total ==> SRR7230825.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.74 582 29.5694 Potri.005G024800.1.v4.1 1035 790.739 130 14.8156 Potri.004G059700.1.v4.1 961 716.812 12 1.50864 Potri.007G009000.2.v4.1 1416 1171.74 0 0 Potri.003G141000.2.v4.1 2943 2698.74 554.475 18.5153 Potri.016G087400.1.v4.1 270 85.0876 407 431.06 Potri.015G069301.1.v4.1 564 327.796 0 0 Potri.010G195200.1.v4.1 1773 1528.74 54.8108 3.23104 Potri.012G127500.1.v4.1 977 732.761 66 8.11692 ==> SRR7230825.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 427 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 241 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 71 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7230825 completed mapping pipeline successfully