Starting /dee2/code/volunteer_pipeline.sh SRR7230826 current disk space = 3053334806528 free memory = 1445890080 SRR7230826 SRAfilesize 307e8a9fb687e1b35ca388270cae4890 SRR7230826.sra SRR7230826.sra file validated SRR7230826 is paired end SRR7230826 is conventional basespace SRR7230826 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230826_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.376 34.0 33.0 34.0 33.0 34.0 2 33.40625 34.0 33.0 34.0 33.0 34.0 3 33.43 34.0 34.0 34.0 33.0 34.0 4 33.4725 34.0 34.0 34.0 33.0 34.0 5 33.42375 34.0 34.0 34.0 33.0 34.0 6 37.28925 38.0 38.0 38.0 36.0 38.0 7 37.50975 38.0 38.0 38.0 37.0 38.0 8 37.40625 38.0 38.0 38.0 37.0 38.0 9 37.508 38.0 38.0 38.0 37.0 38.0 10-14 37.552350000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.50425 38.0 38.0 38.0 37.6 38.0 20-24 37.590250000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.48605 38.0 38.0 38.0 37.8 38.0 30-34 37.3706 38.0 38.0 38.0 37.4 38.0 35-39 37.273250000000004 38.0 38.0 38.0 36.8 38.0 40-44 36.9141 38.0 38.0 38.0 35.6 38.0 45-49 37.19385 38.0 38.0 38.0 36.8 38.0 50-54 37.282349999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.21405 38.0 38.0 38.0 36.8 38.0 60-64 37.130100000000006 38.0 38.0 38.0 36.2 38.0 65-69 37.14275 38.0 38.0 38.0 36.6 38.0 70-74 31.60335 38.0 26.2 38.0 15.6 38.0 75-79 32.4167 38.0 34.2 38.0 9.0 38.0 80-84 35.096399999999996 38.0 37.4 38.0 29.0 38.0 85-89 36.183299999999996 38.0 38.0 38.0 33.8 38.0 90-94 36.439800000000005 38.0 38.0 38.0 34.2 38.0 95-99 36.52199999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.418350000000004 38.0 38.0 38.0 34.0 38.0 105-109 35.7469 38.0 37.2 38.0 30.0 38.0 110-114 35.9428 38.0 37.0 38.0 32.4 38.0 115-119 35.89489999999999 38.0 37.4 38.0 32.8 38.0 120-124 35.6081 38.0 36.8 38.0 31.0 38.0 125-129 34.97115000000001 38.0 35.6 38.0 27.4 38.0 130-134 35.15405 38.0 36.0 38.0 29.0 38.0 135-139 35.03105 38.0 35.6 38.0 28.2 38.0 140-144 34.749 38.0 35.2 38.0 27.6 38.0 145-149 33.839 38.0 33.8 38.0 23.2 38.0 150-151 30.302125 35.5 28.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 4.0 14 2.0 15 2.0 16 1.0 17 4.0 18 0.0 19 4.0 20 0.0 21 8.0 22 5.0 23 11.0 24 12.0 25 13.0 26 12.0 27 33.0 28 30.0 29 52.0 30 53.0 31 68.0 32 88.0 33 160.0 34 266.0 35 440.0 36 728.0 37 2003.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.39619809904953 15.107553776888444 9.879939969984992 32.61630815407704 2 21.0 20.7 33.0 25.3 3 19.05 27.650000000000002 26.875 26.424999999999997 4 23.0 33.625 21.65 21.725 5 21.9 36.0 22.5 19.6 6 18.5 35.725 25.45 20.325 7 13.375 23.1 44.375 19.15 8 17.45 22.975 30.925000000000004 28.65 9 17.5 22.775000000000002 33.2 26.525 10-14 20.415 29.45 26.155 23.98 15-19 20.64 28.43 27.694999999999997 23.235 20-24 20.43 28.17 27.43 23.97 25-29 20.34 28.999999999999996 27.175 23.485 30-34 20.075000000000003 28.599999999999998 27.815 23.51 35-39 19.93199319931993 29.007900790079006 27.237723772377237 23.82238223822382 40-44 20.592355413247947 28.52711626976186 27.631578947368425 23.248949369621773 45-49 20.105 29.125 26.96 23.810000000000002 50-54 20.105 28.685 27.384999999999998 23.825 55-59 20.01 28.694999999999997 27.83 23.465 60-64 20.217021702170218 28.467846784678468 27.57275727572757 23.742374237423743 65-69 20.474999999999998 28.21 27.565 23.75 70-74 19.842565597667637 28.45481049562682 27.61516034985423 24.08746355685131 75-79 20.88486620193389 27.923319091522377 27.546660670114687 23.64515403642905 80-84 20.29076129435673 29.242874263977907 27.080402271898286 23.385962169767076 85-89 20.281732808239926 27.91073412097344 27.355346864586487 24.452186206200142 90-94 20.5129489555678 28.472674447728295 27.535941491759758 23.478435104944147 95-99 20.53656339156114 27.85925221482557 27.3136793633315 24.290505030281796 100-104 20.228376821755898 28.717383683077074 27.5504582561226 23.503781239044425 105-109 20.715357678839418 28.459229614807402 27.208604302151073 23.6168084042021 110-114 20.887088708870888 27.69276927692769 27.732773277327734 23.687368736873687 115-119 20.41992383243135 28.612948486670675 27.24493886550411 23.722188815393867 120-124 21.51028600100351 27.431008529854488 26.94430506773708 24.114400401404918 125-129 21.185000000000002 27.265 27.295 24.255 130-134 21.365000000000002 28.249999999999996 26.640000000000004 23.745 135-139 21.13 28.46 26.525 23.885 140-144 21.029999999999998 27.889999999999997 26.950000000000003 24.13 145-149 21.471839799749688 28.0450563204005 26.33291614518148 24.150187734668336 150-151 21.9 28.225 26.174999999999997 23.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.0 22 2.0 23 3.0 24 4.0 25 5.0 26 7.0 27 9.0 28 16.5 29 25.5 30 34.0 31 38.0 32 39.5 33 51.5 34 79.0 35 102.5 36 107.0 37 120.0 38 147.0 39 178.5 40 193.0 41 206.5 42 231.5 43 224.0 44 227.5 45 247.5 46 250.0 47 234.5 48 210.5 49 197.5 50 168.5 51 132.0 52 107.5 53 89.0 54 79.0 55 60.5 56 42.0 57 39.5 58 31.5 59 18.5 60 10.0 61 6.0 62 6.5 63 5.0 64 1.5 65 1.5 66 2.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.06 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.01 65-69 0.0 70-74 14.249999999999998 75-79 11.06 80-84 4.045 85-89 0.97 90-94 0.185 95-99 0.105 100-104 0.165 105-109 0.05 110-114 0.01 115-119 0.22 120-124 0.35000000000000003 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.125 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.7054673721340388 1.4000000000000001 3 0.0 0.0 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.55 0.0 0.0 0.0 0.0 106-107 1.725 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.0999999999999996 0.0 0.0 0.0 0.0 112-113 2.2750000000000004 0.0 0.0 0.0 0.0 114-115 2.5999999999999996 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.8875 0.0 0.0 0.0 0.0 124-125 4.325 0.0 0.0 0.0 0.0 126-127 4.637499999999999 0.0 0.0 0.0 0.0 128-129 4.85 0.0 0.0 0.0 0.0 130-131 5.1375 0.0 0.0 0.0 0.0 132-133 5.7 0.0 0.0 0.0 0.0 134-135 6.1 0.0 0.0 0.0 0.0 136-137 6.575 0.0 0.0 0.0 0.0 138-139 7.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGAT 10 0.007311787 141.7375 5 AAAGAGT 10 0.007311787 141.7375 145 >>END_MODULE SRR7230826 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230826_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.559 33.0 33.0 34.0 32.0 34.0 2 32.91825 34.0 33.0 34.0 32.0 34.0 3 32.9605 34.0 33.0 34.0 32.0 34.0 4 32.94975 34.0 33.0 34.0 32.0 34.0 5 32.9525 34.0 33.0 34.0 32.0 34.0 6 37.114 38.0 38.0 38.0 37.0 38.0 7 37.06725 38.0 38.0 38.0 37.0 38.0 8 37.0515 38.0 38.0 38.0 37.0 38.0 9 36.9715 38.0 38.0 38.0 37.0 38.0 10-14 36.86865 38.0 38.0 38.0 36.2 38.0 15-19 37.0719 38.0 38.0 38.0 37.0 38.0 20-24 37.0516 38.0 38.0 38.0 37.0 38.0 25-29 36.9212 38.0 38.0 38.0 37.0 38.0 30-34 36.9439 38.0 38.0 38.0 37.0 38.0 35-39 36.70795 38.0 38.0 38.0 35.8 38.0 40-44 36.4528 38.0 38.0 38.0 34.8 38.0 45-49 36.640049999999995 38.0 38.0 38.0 35.6 38.0 50-54 36.653200000000005 38.0 38.0 38.0 35.4 38.0 55-59 36.6779 38.0 38.0 38.0 35.8 38.0 60-64 36.7389 38.0 38.0 38.0 36.2 38.0 65-69 36.67205 38.0 38.0 38.0 36.0 38.0 70-74 36.6622 38.0 38.0 38.0 36.0 38.0 75-79 36.67695 38.0 38.0 38.0 36.0 38.0 80-84 36.647800000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.536899999999996 38.0 38.0 38.0 35.4 38.0 90-94 36.442699999999995 38.0 38.0 38.0 35.2 38.0 95-99 36.31345 38.0 38.0 38.0 34.4 38.0 100-104 35.5669 38.0 37.2 38.0 30.8 38.0 105-109 35.92530000000001 38.0 38.0 38.0 33.6 38.0 110-114 35.9953 38.0 38.0 38.0 34.0 38.0 115-119 35.96405 38.0 38.0 38.0 33.8 38.0 120-124 35.648250000000004 38.0 37.8 38.0 32.0 38.0 125-129 35.287949999999995 38.0 36.8 38.0 30.0 38.0 130-134 35.10555 38.0 36.0 38.0 29.8 38.0 135-139 34.762150000000005 38.0 36.0 38.0 27.8 38.0 140-144 34.39625 38.0 35.6 38.0 26.4 38.0 145-149 33.831950000000006 38.0 35.0 38.0 24.2 38.0 150-151 29.078500000000002 35.5 26.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 7.0 5 3.0 6 2.0 7 4.0 8 3.0 9 6.0 10 2.0 11 3.0 12 4.0 13 2.0 14 3.0 15 0.0 16 3.0 17 3.0 18 6.0 19 4.0 20 9.0 21 4.0 22 12.0 23 4.0 24 18.0 25 16.0 26 24.0 27 19.0 28 25.0 29 32.0 30 39.0 31 43.0 32 75.0 33 86.0 34 125.0 35 226.0 36 502.0 37 2672.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.30379746835443 18.936708860759495 13.822784810126581 24.936708860759495 2 25.25 25.724999999999998 31.3 17.724999999999998 3 20.75 27.625 31.825 19.8 4 25.5 34.375 22.075 18.05 5 22.725 38.0 22.025 17.25 6 20.875 36.5 22.5 20.125 7 19.175 18.224999999999998 40.275 22.325 8 20.9 23.724999999999998 28.449999999999996 26.924999999999997 9 23.175 24.85 27.575 24.4 10-14 23.843345170809783 28.309908467963783 26.064122442855 21.78262391837143 15-19 23.03 27.6 27.825 21.545 20-24 22.77183154946484 28.528558567570272 27.563268980694204 21.136340902270682 25-29 23.37233723372337 28.297829782978294 27.322732273227324 21.007100710071008 30-34 22.859143657462987 28.391356542617046 27.315926370548222 21.433573429371748 35-39 22.832283228322833 27.852785278527854 28.04280428042804 21.272127212721273 40-44 23.324664932986597 27.420484096819365 27.765553110622125 21.489297859571916 45-49 23.184343560738778 27.85424695930727 27.909304770008507 21.052104709945443 50-54 23.293152603411194 28.054819186715353 27.55964587605662 21.092382333816836 55-59 23.56416804366331 27.70517250012518 27.23949727104301 21.491162185168495 60-64 23.35467093418684 28.160632126425284 27.445489097819564 21.039207841568313 65-69 23.67696390126671 27.892655084363895 27.351925098883495 21.078455915485904 70-74 23.209283713485394 28.08623449379752 27.06582633053221 21.638655462184875 75-79 23.448206872405343 27.15450407642675 27.97979292752463 21.417496123643275 80-84 23.570892723180794 27.60190047511878 27.316829207301822 21.510377594398598 85-89 23.579147488493096 26.996197718631176 28.196918150890532 21.22773664198519 90-94 23.12656328164082 27.903951975987994 27.888944472236116 21.080540270135067 95-99 23.817381738173818 27.682768276827684 27.32773277327733 21.172117211721172 100-104 24.04240424042404 27.88278827882788 27.357735773577357 20.717071707170717 105-109 23.517351735173516 27.597759775977597 28.082808280828083 20.8020802080208 110-114 24.215 27.725 27.66 20.4 115-119 24.01 27.52 27.485 20.985 120-124 24.557455745574558 28.147814781478147 26.902690269026902 20.392039203920394 125-129 24.168458960636222 27.70469664382534 27.629670384634625 20.497174010903816 130-134 24.915000000000003 27.744999999999997 27.1 20.24 135-139 25.05750575057506 27.25272527252725 27.117711771177117 20.572057205720572 140-144 25.13379682889011 28.294903216125643 26.95443405191817 19.61686590306607 145-149 25.257525752575255 27.907790779077907 26.907690769076908 19.926992699269928 150-151 24.925 28.0625 27.0125 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 1.0 23 3.5 24 4.0 25 3.5 26 5.5 27 7.5 28 10.5 29 10.5 30 12.5 31 18.5 32 29.5 33 38.0 34 44.5 35 63.5 36 78.5 37 91.0 38 107.5 39 139.5 40 172.5 41 204.0 42 237.5 43 259.0 44 261.0 45 268.5 46 259.5 47 260.0 48 256.5 49 211.5 50 178.5 51 136.5 52 114.0 53 105.5 54 93.0 55 85.5 56 63.0 57 37.0 58 26.5 59 24.5 60 19.0 61 12.0 62 9.5 63 7.5 64 4.5 65 3.0 66 2.0 67 1.5 68 2.5 69 3.0 70 2.5 71 1.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.034999999999999996 15-19 0.0 20-24 0.03 25-29 0.01 30-34 0.04 35-39 0.01 40-44 0.02 45-49 0.105 50-54 0.034999999999999996 55-59 0.145 60-64 0.02 65-69 0.135 70-74 0.04 75-79 0.034999999999999996 80-84 0.025 85-89 0.06 90-94 0.05 95-99 0.01 100-104 0.01 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.01 125-129 0.034999999999999996 130-134 0.0 135-139 0.01 140-144 0.034999999999999996 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2938209331652 98.425 2 0.5800756620428752 1.15 3 0.07566204287515763 0.22499999999999998 4 0.05044136191677175 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.8 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.4749999999999996 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.0125 0.0 0.0125 0.0 0.0 120-121 3.3375 0.0 0.025 0.0 0.0 122-123 3.8375 0.0 0.025 0.0 0.0 124-125 4.275 0.0 0.025 0.0 0.0 126-127 4.574999999999999 0.0 0.025 0.0 0.0 128-129 4.7875 0.0 0.025 0.0 0.0 130-131 5.074999999999999 0.0 0.025 0.0 0.0 132-133 5.6125 0.0 0.025 0.0 0.0 134-135 5.9625 0.0 0.025 0.0 0.0 136-137 6.45 0.0 0.025 0.0 0.0 138-139 7.012499999999999 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACT 10 0.006830828 145.0 1 CGACTGC 10 0.006830828 145.0 4 >>END_MODULE Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra Read 780308 spots for SRR7230826.sra Written 780308 spots for SRR7230826.sra SRR ids: ['SRR7230826.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f5rk1o_k SRR7230826.sra spots: 15606160 blocks: [[1, 780308], [780309, 1560616], [1560617, 2340924], [2340925, 3121232], [3121233, 3901540], [3901541, 4681848], [4681849, 5462156], [5462157, 6242464], [6242465, 7022772], [7022773, 7803080], [7803081, 8583388], [8583389, 9363696], [9363697, 10144004], [10144005, 10924312], [10924313, 11704620], [11704621, 12484928], [12484929, 13265236], [13265237, 14045544], [14045545, 14825852], [14825853, 15606160]] SRR7230826 file size 5266715 SRR7230826 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230826 SRR7230826_1.fastq SRR7230826_2.fastq Input file: SRR7230826_1.fastq Paired file: SRR7230826_2.fastq trimmed: SRR7230826-trimmed-pair1.fastq, SRR7230826-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 10:20:47 2025 >> started Tue Feb 11 10:21:03 2025 >> done (15.918s) 15606160 read pairs processed; of these: 21558 ( 0.14%) short read pairs filtered out after trimming by size control 20531 ( 0.13%) empty read pairs filtered out after trimming by size control 15564071 (99.73%) read pairs available; of these: 7698453 (49.46%) trimmed read pairs available after processing 7865618 (50.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 4 0.00% 21 3 0.00% 22 2 0.00% 23 5 0.00% 24 5 0.00% 25 4 0.00% 26 7 0.00% 27 11 0.00% 28 13 0.00% 29 5 0.00% 30 16 0.00% 31 9 0.00% 32 5 0.00% 33 6 0.00% 34 10 0.00% 35 16 0.00% 36 16 0.00% 37 15 0.00% 38 13 0.00% 39 22 0.00% 40 16 0.00% 41 30 0.00% 42 47 0.00% 43 38 0.00% 44 30 0.00% 45 38 0.00% 46 45 0.00% 47 65 0.00% 48 65 0.00% 49 58 0.00% 50 74 0.00% 51 95 0.00% 52 116 0.00% 53 100 0.00% 54 125 0.00% 55 146 0.00% 56 126 0.00% 57 171 0.00% 58 230 0.00% 59 229 0.00% 60 267 0.00% 61 275 0.00% 62 314 0.00% 63 310 0.00% 64 382 0.00% 65 457 0.00% 66 489 0.00% 67 584 0.00% 68 708 0.00% 69 1415 0.01% 70 1503 0.01% 71 1079 0.01% 72 1167 0.01% 73 1232 0.01% 74 1365 0.01% 75 1476 0.01% 76 1667 0.01% 77 1900 0.01% 78 2077 0.01% 79 2353 0.02% 80 2674 0.02% 81 2932 0.02% 82 3450 0.02% 83 3795 0.02% 84 5285 0.03% 85 6014 0.04% 86 6535 0.04% 87 6820 0.04% 88 7225 0.05% 89 7587 0.05% 90 8111 0.05% 91 8741 0.06% 92 9459 0.06% 93 10090 0.06% 94 11008 0.07% 95 11463 0.07% 96 12327 0.08% 97 12634 0.08% 98 13533 0.09% 99 14590 0.09% 100 15330 0.10% 101 16169 0.10% 102 17177 0.11% 103 18162 0.12% 104 19318 0.12% 105 20349 0.13% 106 21108 0.14% 107 22045 0.14% 108 22875 0.15% 109 24541 0.16% 110 25511 0.16% 111 26351 0.17% 112 27454 0.18% 113 28969 0.19% 114 29890 0.19% 115 31690 0.20% 116 32902 0.21% 117 33538 0.22% 118 34732 0.22% 119 35568 0.23% 120 37401 0.24% 121 38334 0.25% 122 40448 0.26% 123 42388 0.27% 124 44112 0.28% 125 45656 0.29% 126 47299 0.30% 127 48749 0.31% 128 50569 0.32% 129 52773 0.34% 130 53813 0.35% 131 55685 0.36% 132 58814 0.38% 133 61983 0.40% 134 65553 0.42% 135 69269 0.45% 136 71491 0.46% 137 76079 0.49% 138 80146 0.51% 139 85125 0.55% 140 88495 0.57% 141 95928 0.62% 142 103406 0.66% 143 116816 0.75% 144 134024 0.86% 145 157954 1.01% 146 200794 1.29% 147 252511 1.62% 148 392517 2.52% 149 744337 4.78% 150 3594976 23.10% 151 7865618 50.54% 15564071 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=15 prefix-density=0.72 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=40.70 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.0 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=17 prefix-density=0.55 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=75.50 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.6 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCT SRR7230826 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 10:21:50 Started mapping on | Feb 11 10:21:50 Finished on | Feb 11 10:24:05 Mapping speed, Million of reads per hour | 415.04 Number of input reads | 15564071 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14205546 Uniquely mapped reads % | 91.27% Average mapped length | 292.69 Number of splices: Total | 13269220 Number of splices: Annotated (sjdb) | 12980251 Number of splices: GT/AG | 13004275 Number of splices: GC/AG | 222693 Number of splices: AT/AC | 7372 Number of splices: Non-canonical | 34880 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 386987 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 174813 % of reads mapped to too many loci | 1.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.79% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 994250 994250 994250 N_multimapping 386987 386987 386987 N_noFeature 538365 13966168 643415 N_ambiguous 235882 1090 100806 UnstrandedReadsAssigned:13431299 PositiveStrandReadsAssigned:238288 NegativeStrandReadsAssigned:13461325 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230826 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230826-trimmed-pair1.fastq SRR7230826-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,564,071 reads, 13,682,513 reads pseudoaligned [quant] estimated average fragment length: 234.175 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR7230826.ke.tsv 34699 SRR7230826.se.tsv 87100 total ==> SRR7230826.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.82 484 19.2868 Potri.005G024800.1.v4.1 1035 801.825 196 17.3855 Potri.004G059700.1.v4.1 961 727.881 23 2.24739 Potri.007G009000.2.v4.1 1416 1182.82 0 0 Potri.003G141000.2.v4.1 2943 2709.82 623.786 16.3722 Potri.016G087400.1.v4.1 270 84.7238 565 474.301 Potri.015G069301.1.v4.1 564 336.248 0 0 Potri.010G195200.1.v4.1 1773 1539.82 16 0.739026 Potri.012G127500.1.v4.1 977 743.845 165 15.7766 ==> SRR7230826.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 631 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 31 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 40 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7230826 completed mapping pipeline successfully