Starting /dee2/code/volunteer_pipeline.sh SRR7230827 current disk space = 3051678928896 free memory = 1577644312 SRR7230827 SRAfilesize b4f9f834036bf6173db06a22f41c0cd8 SRR7230827.sra SRR7230827.sra file validated SRR7230827 is paired end SRR7230827 is conventional basespace SRR7230827 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230827_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3445 34.0 33.0 34.0 33.0 34.0 2 33.3985 34.0 33.0 34.0 33.0 34.0 3 33.42675 34.0 33.0 34.0 33.0 34.0 4 33.448 34.0 34.0 34.0 33.0 34.0 5 33.404 34.0 33.0 34.0 33.0 34.0 6 37.23975 38.0 38.0 38.0 36.0 38.0 7 37.484 38.0 38.0 38.0 37.0 38.0 8 37.4955 38.0 38.0 38.0 38.0 38.0 9 37.44875 38.0 38.0 38.0 38.0 38.0 10-14 37.54215 38.0 38.0 38.0 38.0 38.0 15-19 37.4071 38.0 38.0 38.0 37.6 38.0 20-24 37.2504 38.0 38.0 38.0 36.6 38.0 25-29 37.3365 38.0 38.0 38.0 37.2 38.0 30-34 37.44695 38.0 38.0 38.0 37.2 38.0 35-39 37.33895 38.0 38.0 38.0 37.0 38.0 40-44 36.6959 38.0 38.0 38.0 35.0 38.0 45-49 37.088 38.0 38.0 38.0 36.2 38.0 50-54 37.27365 38.0 38.0 38.0 37.0 38.0 55-59 37.13225 38.0 38.0 38.0 36.2 38.0 60-64 37.11155 38.0 38.0 38.0 36.0 38.0 65-69 37.072399999999995 38.0 38.0 38.0 36.0 38.0 70-74 30.715899999999998 38.0 21.4 38.0 15.2 38.0 75-79 31.65845 38.0 32.2 38.0 2.0 38.0 80-84 34.55265000000001 38.0 36.8 38.0 25.2 38.0 85-89 36.16025 38.0 37.8 38.0 32.8 38.0 90-94 36.2037 38.0 37.8 38.0 33.4 38.0 95-99 36.318599999999996 38.0 38.0 38.0 33.8 38.0 100-104 36.25895 38.0 37.8 38.0 33.8 38.0 105-109 36.301249999999996 38.0 38.0 38.0 34.0 38.0 110-114 34.64205 38.0 35.0 38.0 25.2 38.0 115-119 34.371050000000004 37.8 34.4 38.0 25.6 38.0 120-124 34.9833 38.0 35.4 38.0 27.2 38.0 125-129 34.1314 38.0 34.4 38.0 22.8 38.0 130-134 34.403200000000005 38.0 35.0 38.0 24.6 38.0 135-139 33.68045 37.8 33.8 38.0 21.8 38.0 140-144 34.0691 38.0 34.2 38.0 23.8 38.0 145-149 33.229200000000006 38.0 33.6 38.0 18.6 38.0 150-151 29.107125000000003 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 2.0 16 3.0 17 2.0 18 4.0 19 3.0 20 5.0 21 8.0 22 8.0 23 13.0 24 17.0 25 22.0 26 23.0 27 32.0 28 44.0 29 50.0 30 50.0 31 88.0 32 110.0 33 198.0 34 328.0 35 514.0 36 854.0 37 1617.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.85 14.499999999999998 11.450000000000001 40.2 2 19.400000000000002 22.15 36.475 21.975 3 19.6 25.5 26.950000000000003 27.950000000000003 4 23.0 35.125 20.724999999999998 21.15 5 20.349999999999998 36.8 24.675 18.175 6 16.2 36.075 27.125 20.599999999999998 7 14.299999999999999 21.925 44.725 19.05 8 18.0 23.549999999999997 29.975 28.475 9 17.025000000000002 23.925 32.0 27.05 10-14 19.676967696769676 30.25302530253025 26.65766576657666 23.412341234123414 15-19 20.32 28.804999999999996 27.725 23.150000000000002 20-24 20.105 28.560000000000002 27.98 23.355 25-29 19.75080064051241 28.753002401921535 28.237590072057646 23.258606885508406 30-34 19.44597229861493 28.59142957147857 27.891394569728483 24.07120356017801 35-39 19.491949194919492 29.27292729272927 27.95779577957796 23.27732773277328 40-44 19.66111890916383 28.850010026067775 28.022859434529778 23.46601163023862 45-49 20.01 29.265 27.275 23.45 50-54 20.265 28.57 27.375 23.79 55-59 20.37231646899865 28.62433068107892 27.553420407346245 23.44993244257619 60-64 20.261208967173737 28.1775420336269 27.797237790232188 23.764011208967172 65-69 19.734867433716857 28.68934467233617 27.64382191095548 23.931965982991496 70-74 20.157913626031824 29.106352434501737 27.35973202536189 23.376001914104556 75-79 20.037850547685956 28.720536789585367 27.757068303033776 23.4845443596949 80-84 19.65982466271195 28.06971494566644 28.153708856107933 24.116751535513675 85-89 20.535130513504 28.562088216063973 27.601468591258865 23.301312679173165 90-94 20.696208862658796 28.018405521656497 27.658297489246774 23.627088126437933 95-99 20.327032703270326 28.477847784778476 27.652765276527653 23.54235423542354 100-104 20.417041704170416 28.437843784378437 27.437743774377438 23.707370737073706 105-109 20.985 28.525 27.589999999999996 22.900000000000002 110-114 20.421021051052552 28.346417320866042 27.60138006900345 23.631181559077955 115-119 20.843126468970347 28.564284642696403 26.724008601290194 23.868580287043056 120-124 20.387426168785662 28.236059665632197 27.445189708679546 23.93132445690259 125-129 20.29 29.035 27.33 23.345 130-134 20.72 28.560000000000002 26.755000000000003 23.965 135-139 20.765 28.57 26.97 23.695 140-144 20.125 28.405 27.134999999999998 24.335 145-149 20.456136841052317 28.02840852255677 27.393217965389617 24.1222366710013 150-151 20.875 28.487499999999997 26.775 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 2.5 19 1.5 20 0.5 21 2.5 22 4.0 23 2.5 24 2.0 25 4.5 26 10.0 27 14.0 28 16.0 29 19.5 30 27.5 31 46.5 32 53.0 33 59.5 34 84.5 35 104.0 36 108.5 37 119.0 38 159.0 39 193.5 40 203.0 41 228.5 42 248.5 43 258.0 44 264.5 45 255.0 46 235.5 47 219.0 48 201.0 49 164.5 50 143.5 51 128.5 52 98.0 53 77.0 54 67.0 55 51.5 56 33.5 57 22.0 58 19.5 59 16.0 60 12.0 61 7.0 62 3.0 63 2.5 64 1.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.0 20-24 0.0 25-29 0.08 30-34 0.005 35-39 0.01 40-44 0.26 45-49 0.0 50-54 0.0 55-59 0.08499999999999999 60-64 0.08 65-69 0.05 70-74 16.41 75-79 12.814999999999998 80-84 4.755 85-89 0.585 90-94 0.03 95-99 0.01 100-104 0.01 105-109 0.0 110-114 0.005 115-119 0.015 120-124 0.11 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.03 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.4523749685850716 0.8999999999999999 3 0.0 0.0 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.85 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.0 0.0 0.0 122-123 3.2125 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 5.012499999999999 0.0 0.0 0.0 0.0 132-133 5.425000000000001 0.0 0.0 0.0 0.0 134-135 5.85 0.0 0.0 0.0 0.0 136-137 6.325 0.0 0.0 0.0 0.0 138-139 6.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230827 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230827_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.914 33.0 33.0 34.0 32.0 34.0 2 33.09675 34.0 33.0 34.0 32.0 34.0 3 33.13275 34.0 33.0 34.0 32.0 34.0 4 33.097 34.0 33.0 34.0 33.0 34.0 5 33.07125 34.0 33.0 34.0 32.0 34.0 6 36.99675 38.0 38.0 38.0 36.0 38.0 7 37.0795 38.0 38.0 38.0 37.0 38.0 8 37.05425 38.0 38.0 38.0 37.0 38.0 9 37.02325 38.0 38.0 38.0 37.0 38.0 10-14 37.02955 38.0 38.0 38.0 37.0 38.0 15-19 37.1474 38.0 38.0 38.0 37.0 38.0 20-24 37.0754 38.0 38.0 38.0 37.0 38.0 25-29 37.0284 38.0 38.0 38.0 36.8 38.0 30-34 36.9517 38.0 38.0 38.0 36.6 38.0 35-39 36.616949999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.45665 38.0 38.0 38.0 34.8 38.0 45-49 36.812400000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.87515 38.0 38.0 38.0 36.4 38.0 55-59 36.30975 38.0 38.0 38.0 33.8 38.0 60-64 36.74455 38.0 38.0 38.0 36.0 38.0 65-69 36.42625 38.0 38.0 38.0 35.2 38.0 70-74 36.33485 38.0 38.0 38.0 35.0 38.0 75-79 36.57299999999999 38.0 38.0 38.0 35.4 38.0 80-84 36.52915 38.0 38.0 38.0 35.0 38.0 85-89 36.496399999999994 38.0 38.0 38.0 35.0 38.0 90-94 36.416050000000006 38.0 38.0 38.0 34.6 38.0 95-99 35.8583 38.0 37.6 38.0 32.0 38.0 100-104 35.8772 38.0 38.0 38.0 32.8 38.0 105-109 35.364850000000004 38.0 36.8 38.0 28.8 38.0 110-114 35.75815 38.0 37.8 38.0 32.2 38.0 115-119 35.791700000000006 38.0 38.0 38.0 33.0 38.0 120-124 35.523649999999996 38.0 37.2 38.0 31.0 38.0 125-129 35.2803 38.0 36.8 38.0 29.4 38.0 130-134 35.105000000000004 38.0 36.0 38.0 29.4 38.0 135-139 34.7434 38.0 36.0 38.0 28.0 38.0 140-144 34.21985 38.0 35.2 38.0 25.0 38.0 145-149 33.273250000000004 38.0 33.2 38.0 18.6 38.0 150-151 27.563499999999998 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 3.0 5 2.0 6 1.0 7 4.0 8 3.0 9 1.0 10 1.0 11 1.0 12 3.0 13 1.0 14 4.0 15 6.0 16 5.0 17 3.0 18 3.0 19 5.0 20 7.0 21 5.0 22 12.0 23 16.0 24 18.0 25 22.0 26 26.0 27 24.0 28 29.0 29 44.0 30 39.0 31 68.0 32 95.0 33 102.0 34 139.0 35 207.0 36 530.0 37 2561.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.449999999999996 18.325 15.950000000000001 30.275000000000002 2 25.525 24.349999999999998 34.5 15.625 3 19.675 28.475 32.625 19.225 4 23.799999999999997 35.15 23.474999999999998 17.575 5 23.400000000000002 36.6 22.5 17.5 6 19.925 37.5 23.275000000000002 19.3 7 18.525 18.075 43.625 19.775000000000002 8 21.05 23.025000000000002 28.449999999999996 27.474999999999998 9 21.825 24.925 29.4 23.849999999999998 10-14 22.8 28.28 27.3 21.62 15-19 23.05 28.075 27.860000000000003 21.015 20-24 22.715 29.145 27.384999999999998 20.755000000000003 25-29 22.68 28.43 28.345 20.544999999999998 30-34 22.99 27.555000000000003 28.52 20.935000000000002 35-39 23.075768191372234 27.669902912621357 28.45060554499049 20.803723351015915 40-44 23.275818954738682 27.81695423855964 28.197049262315577 20.710177544386095 45-49 22.874149659863946 27.220888355342137 28.8265306122449 21.07843137254902 50-54 23.005 27.805000000000003 28.22 20.97 55-59 23.135004530353367 27.82643712876271 28.224101479915433 20.814456860968487 60-64 23.324664932986597 27.71054210842168 28.34066813362672 20.624124824964994 65-69 22.88682670970345 28.182368367964493 27.73350817026427 21.197296752067782 70-74 23.65385584042714 28.172064675363924 27.47191860172266 20.70216088248627 75-79 23.05615280764038 27.701385069253465 27.92139606980349 21.321066053302665 80-84 22.959107062415537 27.974373091746337 28.514940687722106 20.55157915811602 85-89 23.055 28.155 27.815 20.974999999999998 90-94 23.47 27.950000000000003 27.555000000000003 21.025 95-99 23.815 27.46 28.255000000000003 20.47 100-104 23.705000000000002 28.425 27.500000000000004 20.369999999999997 105-109 23.535 27.55 28.21 20.705000000000002 110-114 24.07 27.750000000000004 27.834999999999997 20.345 115-119 23.830000000000002 28.215 27.73 20.225 120-124 24.11 27.785 28.27 19.835 125-129 24.529999999999998 27.834999999999997 27.96 19.675 130-134 24.98 28.044999999999998 27.715 19.259999999999998 135-139 24.843726558983846 27.759163874581187 27.94919237885683 19.44791718757814 140-144 24.69605243408215 28.09326061940261 27.402811827687994 19.807875118827237 145-149 24.935 28.595 27.029999999999998 19.439999999999998 150-151 25.0 27.6375 27.125 20.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.5 22 2.5 23 2.0 24 3.5 25 5.5 26 5.0 27 5.5 28 10.5 29 14.0 30 18.0 31 26.5 32 26.5 33 32.0 34 54.0 35 66.5 36 87.5 37 120.5 38 136.0 39 173.5 40 207.5 41 205.0 42 229.0 43 262.0 44 277.0 45 284.5 46 267.0 47 252.0 48 236.5 49 200.5 50 169.0 51 141.5 52 101.0 53 80.0 54 72.0 55 54.5 56 44.5 57 35.5 58 26.5 59 19.0 60 12.0 61 7.5 62 5.5 63 5.5 64 4.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.09 40-44 0.025 45-49 0.04 50-54 0.0 55-59 0.67 60-64 0.02 65-69 0.86 70-74 0.735 75-79 0.005 80-84 0.105 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.015 140-144 0.065 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5285678328718851 1.05 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.075 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.675 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.325 0.0 0.0 0.0 0.0 124-125 3.825 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.637499999999999 0.0 0.0 0.0 0.0 130-131 5.137499999999999 0.0 0.0 0.0 0.0 132-133 5.5375 0.0 0.0 0.0 0.0 134-135 6.0 0.0 0.0 0.0 0.0 136-137 6.487500000000001 0.0 0.0 0.0 0.0 138-139 6.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAAGA 10 0.006875036 144.6875 8 >>END_MODULE Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942150 spots for SRR7230827.sra Written 942150 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra Read 942148 spots for SRR7230827.sra Written 942148 spots for SRR7230827.sra SRR ids: ['SRR7230827.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vkn2ckkf SRR7230827.sra spots: 18842962 blocks: [[1, 942148], [942149, 1884296], [1884297, 2826444], [2826445, 3768592], [3768593, 4710740], [4710741, 5652888], [5652889, 6595036], [6595037, 7537184], [7537185, 8479332], [8479333, 9421480], [9421481, 10363628], [10363629, 11305776], [11305777, 12247924], [12247925, 13190072], [13190073, 14132220], [14132221, 15074368], [15074369, 16016516], [16016517, 16958664], [16958665, 17900812], [17900813, 18842962]] SRR7230827 file size 6363561 SRR7230827 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230827 SRR7230827_1.fastq SRR7230827_2.fastq Input file: SRR7230827_1.fastq Paired file: SRR7230827_2.fastq trimmed: SRR7230827-trimmed-pair1.fastq, SRR7230827-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:36:14 2025 >> started Tue Feb 11 11:36:36 2025 >> done (21.279s) 18842962 read pairs processed; of these: 19829 ( 0.11%) short read pairs filtered out after trimming by size control 16799 ( 0.09%) empty read pairs filtered out after trimming by size control 18806334 (99.81%) read pairs available; of these: 8720846 (46.37%) trimmed read pairs available after processing 10085488 (53.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 5 0.00% 21 2 0.00% 22 6 0.00% 23 4 0.00% 24 6 0.00% 25 8 0.00% 26 6 0.00% 27 10 0.00% 28 6 0.00% 29 13 0.00% 30 16 0.00% 31 7 0.00% 32 11 0.00% 33 9 0.00% 34 11 0.00% 35 11 0.00% 36 15 0.00% 37 11 0.00% 38 19 0.00% 39 29 0.00% 40 20 0.00% 41 34 0.00% 42 31 0.00% 43 35 0.00% 44 33 0.00% 45 47 0.00% 46 69 0.00% 47 58 0.00% 48 67 0.00% 49 81 0.00% 50 80 0.00% 51 104 0.00% 52 98 0.00% 53 139 0.00% 54 121 0.00% 55 126 0.00% 56 132 0.00% 57 172 0.00% 58 177 0.00% 59 205 0.00% 60 261 0.00% 61 306 0.00% 62 315 0.00% 63 369 0.00% 64 410 0.00% 65 512 0.00% 66 491 0.00% 67 570 0.00% 68 743 0.00% 69 1303 0.01% 70 1177 0.01% 71 1012 0.01% 72 1052 0.01% 73 1188 0.01% 74 1360 0.01% 75 1524 0.01% 76 1684 0.01% 77 1842 0.01% 78 2079 0.01% 79 2169 0.01% 80 2568 0.01% 81 2950 0.02% 82 3804 0.02% 83 3787 0.02% 84 5107 0.03% 85 5800 0.03% 86 6367 0.03% 87 6739 0.04% 88 7172 0.04% 89 7938 0.04% 90 8447 0.04% 91 8967 0.05% 92 9600 0.05% 93 10503 0.06% 94 11207 0.06% 95 12282 0.07% 96 12929 0.07% 97 13853 0.07% 98 14315 0.08% 99 15365 0.08% 100 16487 0.09% 101 17272 0.09% 102 18572 0.10% 103 19853 0.11% 104 20726 0.11% 105 22413 0.12% 106 23682 0.13% 107 24318 0.13% 108 25802 0.14% 109 27010 0.14% 110 28243 0.15% 111 29473 0.16% 112 30963 0.16% 113 32537 0.17% 114 33795 0.18% 115 35549 0.19% 116 37103 0.20% 117 38302 0.20% 118 39795 0.21% 119 41085 0.22% 120 42362 0.23% 121 44699 0.24% 122 46311 0.25% 123 48278 0.26% 124 50735 0.27% 125 52262 0.28% 126 54250 0.29% 127 56347 0.30% 128 57809 0.31% 129 60149 0.32% 130 62594 0.33% 131 64427 0.34% 132 67606 0.36% 133 70788 0.38% 134 74222 0.39% 135 77699 0.41% 136 81741 0.43% 137 86731 0.46% 138 90295 0.48% 139 95841 0.51% 140 101177 0.54% 141 109972 0.58% 142 119505 0.64% 143 131955 0.70% 144 149491 0.79% 145 173844 0.92% 146 211947 1.13% 147 277309 1.47% 148 404606 2.15% 149 773155 4.11% 150 4227654 22.48% 151 10085488 53.63% 18806334 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=8 prefix-density=0.52 prefix-fanout=3.0 sequence=ATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=43.34 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.2 sequence=AAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGAC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=17 prefix-density=0.64 prefix-fanout=1.9 sequence=GTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=36.71 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.2 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCAT SRR7230827 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:37:19 Started mapping on | Feb 11 11:37:19 Finished on | Feb 11 11:39:41 Mapping speed, Million of reads per hour | 476.78 Number of input reads | 18806334 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17448138 Uniquely mapped reads % | 92.78% Average mapped length | 293.27 Number of splices: Total | 16683331 Number of splices: Annotated (sjdb) | 16261190 Number of splices: GT/AG | 16349843 Number of splices: GC/AG | 262717 Number of splices: AT/AC | 9915 Number of splices: Non-canonical | 60856 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 627834 % of reads mapped to multiple loci | 3.34% Number of reads mapped to too many loci | 109957 % of reads mapped to too many loci | 0.58% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.15% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 751542 751542 751542 N_multimapping 627834 627834 627834 N_noFeature 711494 17138848 833580 N_ambiguous 347483 1313 159495 UnstrandedReadsAssigned:16389161 PositiveStrandReadsAssigned:307977 NegativeStrandReadsAssigned:16455063 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7230827 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230827-trimmed-pair1.fastq SRR7230827-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,806,334 reads, 16,488,714 reads pseudoaligned [quant] estimated average fragment length: 240.714 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,027 rounds 52401 SRR7230827.ke.tsv 34699 SRR7230827.se.tsv 87100 total ==> SRR7230827.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.29 1140 35.5706 Potri.005G024800.1.v4.1 1035 795.286 231 16.1167 Potri.004G059700.1.v4.1 961 721.338 7 0.538452 Potri.007G009000.2.v4.1 1416 1176.29 0 0 Potri.003G141000.2.v4.1 2943 2703.29 956.458 19.6319 Potri.016G087400.1.v4.1 270 84.2729 1125 740.718 Potri.015G069301.1.v4.1 564 330.616 0 0 Potri.010G195200.1.v4.1 1773 1533.29 348 12.5934 Potri.012G127500.1.v4.1 977 737.323 197 14.8251 ==> SRR7230827.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1223 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 357 Potri.001G212900.v4.1 23 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 55 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7230827 completed mapping pipeline successfully