Starting /dee2/code/volunteer_pipeline.sh SRR7230828 current disk space = 3051509993472 free memory = 1567614264 SRR7230828 SRAfilesize a46bb4e35a139c15bbd25cd3d7562ff7 SRR7230828.sra SRR7230828.sra file validated SRR7230828 is paired end SRR7230828 is conventional basespace SRR7230828 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230828_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2885 34.0 33.0 34.0 33.0 34.0 2 33.413 34.0 33.0 34.0 33.0 34.0 3 33.39975 34.0 33.0 34.0 33.0 34.0 4 33.361 34.0 34.0 34.0 33.0 34.0 5 33.28225 34.0 34.0 34.0 33.0 34.0 6 37.21 38.0 38.0 38.0 36.0 38.0 7 37.4785 38.0 38.0 38.0 37.0 38.0 8 37.30575 38.0 38.0 38.0 37.0 38.0 9 37.43425 38.0 38.0 38.0 37.0 38.0 10-14 37.521100000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.432500000000005 38.0 38.0 38.0 37.4 38.0 20-24 37.5539 38.0 38.0 38.0 38.0 38.0 25-29 37.4096 38.0 38.0 38.0 37.4 38.0 30-34 37.28895 38.0 38.0 38.0 37.0 38.0 35-39 37.19285 38.0 38.0 38.0 37.0 38.0 40-44 36.77895 38.0 38.0 38.0 35.2 38.0 45-49 37.117399999999996 38.0 38.0 38.0 36.4 38.0 50-54 37.233850000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.14725 38.0 38.0 38.0 36.8 38.0 60-64 37.09060000000001 38.0 38.0 38.0 36.2 38.0 65-69 37.1106 38.0 38.0 38.0 36.0 38.0 70-74 31.413099999999996 38.0 26.2 38.0 15.4 38.0 75-79 32.45775 38.0 34.4 38.0 9.2 38.0 80-84 35.08325000000001 38.0 37.4 38.0 28.8 38.0 85-89 36.087199999999996 38.0 38.0 38.0 33.6 38.0 90-94 36.31365 38.0 38.0 38.0 33.6 38.0 95-99 36.5016 38.0 38.0 38.0 34.0 38.0 100-104 36.326 38.0 38.0 38.0 34.0 38.0 105-109 35.77525 38.0 37.2 38.0 30.2 38.0 110-114 35.943400000000004 38.0 37.0 38.0 32.2 38.0 115-119 35.8393 38.0 37.4 38.0 32.0 38.0 120-124 35.634299999999996 38.0 37.0 38.0 31.4 38.0 125-129 35.010999999999996 38.0 35.6 38.0 27.0 38.0 130-134 35.18495 38.0 36.0 38.0 28.4 38.0 135-139 35.080200000000005 38.0 36.0 38.0 28.6 38.0 140-144 34.85875 38.0 35.4 38.0 28.0 38.0 145-149 34.064750000000004 38.0 34.0 38.0 24.6 38.0 150-151 30.607875 35.5 29.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 1.0 16 2.0 17 1.0 18 2.0 19 4.0 20 6.0 21 3.0 22 4.0 23 14.0 24 14.0 25 19.0 26 25.0 27 31.0 28 37.0 29 54.0 30 54.0 31 72.0 32 90.0 33 139.0 34 272.0 35 399.0 36 711.0 37 2043.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.683420855213804 15.478869717429358 10.502625656414104 40.33508377094274 2 20.225 22.0 36.725 21.05 3 18.025 27.900000000000002 26.450000000000003 27.625 4 22.3 34.849999999999994 21.45 21.4 5 20.275000000000002 36.925000000000004 24.575 18.224999999999998 6 16.25 35.825 28.549999999999997 19.375 7 13.525 22.225 44.65 19.6 8 18.7 21.825 30.7 28.775000000000002 9 17.875 22.900000000000002 31.574999999999996 27.650000000000002 10-14 20.244999999999997 29.235 26.529999999999998 23.990000000000002 15-19 19.705000000000002 28.655 27.63 24.01 20-24 19.845 28.194999999999997 28.050000000000004 23.91 25-29 19.470000000000002 28.575 28.225 23.73 30-34 19.68 28.785 27.605 23.93 35-39 19.813962792558513 28.525705141028208 27.950590118023605 23.709741948389677 40-44 20.301391809352157 29.132872734554923 27.340542705517173 23.225192750575747 45-49 20.495 28.155 27.755000000000003 23.595 50-54 20.145 28.335 27.839999999999996 23.68 55-59 19.814999999999998 28.725 27.944999999999997 23.515 60-64 20.210052513128282 28.02200550137534 28.20205051262816 23.565891472868216 65-69 20.36 28.27 28.03 23.34 70-74 19.70841384155981 28.350606007377483 28.40915744481527 23.53182270624744 75-79 20.297418630751967 28.68686868686869 27.396184062850732 23.61952861952862 80-84 20.128345593989668 28.486461105024258 27.484739395836595 23.900453905149476 85-89 20.25098674223257 28.65094626049995 27.456735148264343 23.641331849003137 90-94 20.32080200501253 28.54636591478697 27.458646616541355 23.674185463659146 95-99 20.600750938673343 29.011264080100123 27.2540675844806 23.133917396745932 100-104 20.972994639009972 28.34811363294754 27.541459992985622 23.137431735056865 105-109 20.792475485291178 28.116870122073244 27.481488893336003 23.609165499299582 110-114 20.849999999999998 28.544999999999998 27.725 22.88 115-119 20.43334336442973 28.62874912227906 27.164209048048953 23.77369846524225 120-124 20.72239525771124 28.25781171506079 26.841153421079074 24.1786396061489 125-129 20.405 28.54 27.205000000000002 23.849999999999998 130-134 20.595 29.03 27.169999999999998 23.205000000000002 135-139 21.025 28.060000000000002 27.365000000000002 23.549999999999997 140-144 21.02 28.52 27.215 23.244999999999997 145-149 20.755094887587 28.65655200040058 26.94406889990486 23.644284212107554 150-151 20.7375 29.037499999999998 26.3625 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 2.0 22 2.0 23 2.5 24 3.5 25 4.5 26 6.0 27 8.0 28 13.0 29 22.5 30 29.0 31 35.5 32 47.0 33 63.5 34 75.5 35 91.0 36 120.0 37 137.0 38 153.5 39 179.0 40 207.0 41 238.0 42 234.5 43 238.5 44 263.5 45 262.0 46 243.0 47 215.5 48 208.5 49 185.5 50 148.5 51 123.0 52 107.0 53 83.5 54 59.0 55 47.0 56 32.5 57 29.5 58 26.5 59 18.0 60 11.5 61 7.5 62 2.5 63 2.5 64 2.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.13 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.025 65-69 0.0 70-74 14.605 75-79 10.9 80-84 4.165 85-89 1.1900000000000002 90-94 0.25 95-99 0.125 100-104 0.20500000000000002 105-109 0.06 110-114 0.0 115-119 0.31 120-124 0.47000000000000003 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.145 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.6042296072507553 1.2 3 0.0 0.0 4 0.0 0.0 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGCAGTTGCTCCCTCGGATCCCCATCTTCTTCATCTATAGATTTCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.1375000000000002 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.9749999999999999 0.0 0.0 0.0 0.0 118-119 2.2750000000000004 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.3 0.0 0.0 0.0 0.0 126-127 3.625 0.0 0.0 0.0 0.0 128-129 4.0625 0.0 0.0 0.0 0.0 130-131 4.5625 0.0 0.0 0.0 0.0 132-133 5.075 0.0 0.0 0.0 0.0 134-135 5.5375 0.0 0.0 0.0 0.0 136-137 5.95 0.0 0.0 0.0 0.0 138-139 6.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7230828 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7230828_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43725 33.0 33.0 34.0 32.0 34.0 2 32.936 34.0 33.0 34.0 32.0 34.0 3 33.03675 34.0 33.0 34.0 32.0 34.0 4 33.024 34.0 33.0 34.0 32.0 34.0 5 33.0285 34.0 33.0 34.0 32.0 34.0 6 37.15375 38.0 38.0 38.0 37.0 38.0 7 37.06525 38.0 38.0 38.0 37.0 38.0 8 37.02425 38.0 38.0 38.0 37.0 38.0 9 36.96375 38.0 38.0 38.0 37.0 38.0 10-14 36.800200000000004 38.0 38.0 38.0 35.6 38.0 15-19 37.0679 38.0 38.0 38.0 36.8 38.0 20-24 36.96055 38.0 38.0 38.0 37.0 38.0 25-29 36.92345 38.0 38.0 38.0 36.6 38.0 30-34 36.92845 38.0 38.0 38.0 36.8 38.0 35-39 36.6745 38.0 38.0 38.0 35.6 38.0 40-44 36.4248 38.0 38.0 38.0 34.2 38.0 45-49 36.68125 38.0 38.0 38.0 35.6 38.0 50-54 36.670950000000005 38.0 38.0 38.0 35.2 38.0 55-59 36.667449999999995 38.0 38.0 38.0 35.6 38.0 60-64 36.73085 38.0 38.0 38.0 35.8 38.0 65-69 36.686 38.0 38.0 38.0 35.8 38.0 70-74 36.696850000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.6271 38.0 38.0 38.0 35.8 38.0 80-84 36.6345 38.0 38.0 38.0 35.6 38.0 85-89 36.5149 38.0 38.0 38.0 35.0 38.0 90-94 36.399649999999994 38.0 38.0 38.0 34.6 38.0 95-99 36.3113 38.0 38.0 38.0 34.0 38.0 100-104 35.6452 38.0 37.4 38.0 30.4 38.0 105-109 35.9497 38.0 38.0 38.0 32.8 38.0 110-114 36.00834999999999 38.0 38.0 38.0 33.6 38.0 115-119 35.922200000000004 38.0 38.0 38.0 33.2 38.0 120-124 35.569599999999994 38.0 37.2 38.0 31.4 38.0 125-129 35.127750000000006 38.0 36.6 38.0 29.6 38.0 130-134 35.052350000000004 38.0 36.2 38.0 29.4 38.0 135-139 34.69345 38.0 36.0 38.0 27.2 38.0 140-144 34.295249999999996 38.0 35.8 38.0 24.8 38.0 145-149 33.8019 38.0 35.0 38.0 23.2 38.0 150-151 29.45975 35.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 5.0 4 5.0 5 1.0 6 1.0 7 1.0 8 0.0 9 2.0 10 1.0 11 1.0 12 3.0 13 2.0 14 6.0 15 4.0 16 4.0 17 2.0 18 10.0 19 6.0 20 12.0 21 14.0 22 15.0 23 16.0 24 13.0 25 16.0 26 26.0 27 25.0 28 29.0 29 44.0 30 42.0 31 61.0 32 60.0 33 97.0 34 142.0 35 178.0 36 457.0 37 2696.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.6272219400711 17.013712544438803 14.931437277805992 32.427628237684104 2 24.75 24.425 35.275 15.55 3 20.8 27.650000000000002 30.15 21.4 4 25.4 35.175 20.65 18.775 5 23.025000000000002 36.875 23.425 16.675 6 18.8 37.775 24.575 18.85 7 18.0 16.55 43.65 21.8 8 20.8 22.75 29.775000000000002 26.674999999999997 9 21.45 24.625 30.049999999999997 23.875 10-14 23.477303438266354 28.547119763775587 26.585255993193535 21.390320804764524 15-19 22.905 27.575 28.15 21.37 20-24 22.586293146573286 27.903951975987994 28.119059529764883 21.390695347673837 25-29 22.718407761164176 27.804170625593837 28.09921488223234 21.37820673100965 30-34 22.84827862289832 27.522017614091272 28.332666132906326 21.297037630104082 35-39 23.0880808282899 27.734707147501624 28.51498024308508 20.662231781123396 40-44 22.999949967478862 28.193325661680092 27.57292239955971 21.233801971281334 45-49 22.814221331998 27.86680020030045 28.33249874812218 20.986479719579368 50-54 22.938673341677095 28.370463078848562 27.969962453066334 20.72090112640801 55-59 22.990981963927855 27.90581162324649 27.84068136272545 21.2625250501002 60-64 22.50512730728828 27.84252913811215 27.787504376969636 21.864839177629932 65-69 22.62232683928482 27.645615265187562 28.431912655882208 21.300145239645417 70-74 22.951804214003303 27.255893098443522 28.77733847154797 21.014964216005204 75-79 22.84584188654684 27.692384719371148 27.917688879987985 21.544084514094028 80-84 23.43406043626176 27.606563938363017 27.481488893336003 21.477886732039224 85-89 23.150513398447284 27.67843726521412 28.199348860505886 20.97170047583271 90-94 22.948274998748186 27.955535526513444 28.53137048720645 20.564818987531922 95-99 23.640910227556887 27.751937984496124 28.33708427106777 20.27006751687922 100-104 23.66591647911978 28.207051762940733 27.711927981995498 20.415103775943987 105-109 23.5032261291452 27.794728154854198 28.164857700195068 20.537188015805533 110-114 23.385 28.13 28.4 20.085 115-119 24.37 27.985 27.084999999999997 20.560000000000002 120-124 24.12464985994398 27.871148459383754 27.67607042817127 20.328131252501 125-129 24.478254341624545 28.016615784995746 27.300935889094642 20.20419398428507 130-134 24.54 27.794999999999998 28.07 19.595000000000002 135-139 24.671167791947987 27.81695423855964 27.576894223555886 19.934983745936485 140-144 24.87484981978374 27.673207849419303 27.417901481778134 20.034040849018822 145-149 25.301325331332837 27.991997999499873 27.251812953238307 19.454863715928983 150-151 25.074999999999996 28.775000000000002 26.875 19.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 2.5 23 3.5 24 3.5 25 4.0 26 5.0 27 11.5 28 14.5 29 18.5 30 24.5 31 21.5 32 30.0 33 44.0 34 56.0 35 70.0 36 87.0 37 110.0 38 132.0 39 164.0 40 192.5 41 217.0 42 243.0 43 252.5 44 259.0 45 260.5 46 248.0 47 238.0 48 228.5 49 204.5 50 158.5 51 126.5 52 119.5 53 100.5 54 76.5 55 61.0 56 48.5 57 38.5 58 34.5 59 30.0 60 19.0 61 9.5 62 8.5 63 5.5 64 2.0 65 2.0 66 1.5 67 1.5 68 2.0 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 1.0 76 1.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.095 15-19 0.0 20-24 0.05 25-29 0.015 30-34 0.08 35-39 0.034999999999999996 40-44 0.065 45-49 0.15 50-54 0.125 55-59 0.2 60-64 0.045 65-69 0.165 70-74 0.095 75-79 0.135 80-84 0.06 85-89 0.17500000000000002 90-94 0.145 95-99 0.025 100-104 0.025 105-109 0.034999999999999996 110-114 0.0 115-119 0.0 120-124 0.04 125-129 0.095 130-134 0.0 135-139 0.025 140-144 0.12 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47169811320755 98.85000000000001 2 0.4528301886792453 0.8999999999999999 3 0.05031446540880503 0.15 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.875 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.4125 0.0 0.0 0.0 0.0 120-121 2.7249999999999996 0.0 0.0 0.0 0.0 122-123 3.1375 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.9000000000000004 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.824999999999999 0.0 0.0 0.0 0.0 132-133 5.325 0.0 0.0 0.0 0.0 134-135 5.775 0.0 0.0 0.0 0.0 136-137 6.175 0.0 0.0 0.0 0.0 138-139 6.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAACTT 10 0.006795571 145.22784 7 >>END_MODULE Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795948 spots for SRR7230828.sra Written 795948 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra Read 795934 spots for SRR7230828.sra Written 795934 spots for SRR7230828.sra SRR ids: ['SRR7230828.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ix9nvgb0 SRR7230828.sra spots: 15918694 blocks: [[1, 795934], [795935, 1591868], [1591869, 2387802], [2387803, 3183736], [3183737, 3979670], [3979671, 4775604], [4775605, 5571538], [5571539, 6367472], [6367473, 7163406], [7163407, 7959340], [7959341, 8755274], [8755275, 9551208], [9551209, 10347142], [10347143, 11143076], [11143077, 11939010], [11939011, 12734944], [12734945, 13530878], [13530879, 14326812], [14326813, 15122746], [15122747, 15918694]] SRR7230828 file size 5372622 SRR7230828 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7230828 SRR7230828_1.fastq SRR7230828_2.fastq Input file: SRR7230828_1.fastq Paired file: SRR7230828_2.fastq trimmed: SRR7230828-trimmed-pair1.fastq, SRR7230828-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 11:41:43 2025 >> started Tue Feb 11 11:42:09 2025 >> done (25.936s) 15918694 read pairs processed; of these: 12436 ( 0.08%) short read pairs filtered out after trimming by size control 10087 ( 0.06%) empty read pairs filtered out after trimming by size control 15896171 (99.86%) read pairs available; of these: 7239996 (45.55%) trimmed read pairs available after processing 8656175 (54.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 7 0.00% 21 1 0.00% 22 5 0.00% 23 1 0.00% 24 2 0.00% 25 5 0.00% 26 2 0.00% 27 5 0.00% 28 5 0.00% 29 6 0.00% 30 7 0.00% 31 9 0.00% 32 7 0.00% 33 3 0.00% 34 8 0.00% 35 8 0.00% 36 11 0.00% 37 11 0.00% 38 11 0.00% 39 9 0.00% 40 20 0.00% 41 27 0.00% 42 26 0.00% 43 35 0.00% 44 26 0.00% 45 40 0.00% 46 34 0.00% 47 53 0.00% 48 60 0.00% 49 67 0.00% 50 67 0.00% 51 89 0.00% 52 93 0.00% 53 96 0.00% 54 108 0.00% 55 123 0.00% 56 135 0.00% 57 141 0.00% 58 173 0.00% 59 174 0.00% 60 208 0.00% 61 250 0.00% 62 286 0.00% 63 331 0.00% 64 398 0.00% 65 394 0.00% 66 456 0.00% 67 498 0.00% 68 568 0.00% 69 714 0.00% 70 902 0.01% 71 894 0.01% 72 992 0.01% 73 1080 0.01% 74 1217 0.01% 75 1380 0.01% 76 1478 0.01% 77 1711 0.01% 78 1816 0.01% 79 2055 0.01% 80 2512 0.02% 81 2618 0.02% 82 3144 0.02% 83 3362 0.02% 84 4375 0.03% 85 5098 0.03% 86 5402 0.03% 87 5876 0.04% 88 6335 0.04% 89 6664 0.04% 90 7210 0.05% 91 7765 0.05% 92 8330 0.05% 93 8903 0.06% 94 9793 0.06% 95 10351 0.07% 96 11158 0.07% 97 11833 0.07% 98 12455 0.08% 99 13322 0.08% 100 13988 0.09% 101 14642 0.09% 102 15663 0.10% 103 16815 0.11% 104 17438 0.11% 105 18473 0.12% 106 19496 0.12% 107 20463 0.13% 108 21593 0.14% 109 22745 0.14% 110 23490 0.15% 111 24752 0.16% 112 25704 0.16% 113 26748 0.17% 114 27918 0.18% 115 29654 0.19% 116 30411 0.19% 117 31764 0.20% 118 33204 0.21% 119 34201 0.22% 120 35664 0.22% 121 37026 0.23% 122 38389 0.24% 123 40318 0.25% 124 41345 0.26% 125 43082 0.27% 126 44766 0.28% 127 46121 0.29% 128 48599 0.31% 129 49718 0.31% 130 51931 0.33% 131 53359 0.34% 132 56354 0.35% 133 59421 0.37% 134 61544 0.39% 135 64560 0.41% 136 67608 0.43% 137 71755 0.45% 138 75725 0.48% 139 80297 0.51% 140 83719 0.53% 141 89940 0.57% 142 97345 0.61% 143 108561 0.68% 144 123190 0.77% 145 143304 0.90% 146 179203 1.13% 147 225119 1.42% 148 348725 2.19% 149 653113 4.11% 150 3485182 21.92% 151 8656175 54.45% 15896171 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=12 prefix-density=0.47 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=19 fanout-score=16.78 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=7.1 sequence=TCCTCCTTGTTGTACATGCCGGGAAGTTGCACATTTGTTGGGTTGTCAGCAATGTTCATGAGGGTAGCATTAACCATCTGGTTGTTGAC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=21 prefix-density=0.49 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=10.61 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.0 sequence=CAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7230828 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 11:42:53 Started mapping on | Feb 11 11:42:53 Finished on | Feb 11 11:44:55 Mapping speed, Million of reads per hour | 469.07 Number of input reads | 15896171 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14828165 Uniquely mapped reads % | 93.28% Average mapped length | 293.38 Number of splices: Total | 14341521 Number of splices: Annotated (sjdb) | 14004159 Number of splices: GT/AG | 14057337 Number of splices: GC/AG | 231531 Number of splices: AT/AC | 7838 Number of splices: Non-canonical | 44815 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406103 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 137525 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.05% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 675576 675576 675576 N_multimapping 406103 406103 406103 N_noFeature 675521 14589720 784709 N_ambiguous 237070 1284 106920 UnstrandedReadsAssigned:13915574 PositiveStrandReadsAssigned:237161 NegativeStrandReadsAssigned:13936536 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7230828 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7230828-trimmed-pair1.fastq SRR7230828-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,896,171 reads, 14,005,623 reads pseudoaligned [quant] estimated average fragment length: 233.424 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR7230828.ke.tsv 34699 SRR7230828.se.tsv 87100 total ==> SRR7230828.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.58 548 21.6156 Potri.005G024800.1.v4.1 1035 802.576 152 13.339 Potri.004G059700.1.v4.1 961 728.633 3 0.289987 Potri.007G009000.2.v4.1 1416 1183.58 0 0 Potri.003G141000.2.v4.1 2943 2710.58 990.508 25.7373 Potri.016G087400.1.v4.1 270 83.7196 731 614.973 Potri.015G069301.1.v4.1 564 336.293 0 0 Potri.010G195200.1.v4.1 1773 1540.58 47.8688 2.18845 Potri.012G127500.1.v4.1 977 744.592 43 4.06739 ==> SRR7230828.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 701 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 223 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7230828 completed mapping pipeline successfully