Starting /dee2/code/volunteer_pipeline.sh SRR7472087 current disk space = 3088388706304 free memory = 1484810264 SRR7472087 SRAfilesize bebef90e47c61663da68aa731657e384 SRR7472087.sra SRR7472087.sra file validated SRR7472087 is paired end SRR7472087 is conventional basespace SRR7472087 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7472087_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3925 34.0 33.0 34.0 32.0 34.0 2 33.283 34.0 33.0 34.0 33.0 34.0 3 33.342 34.0 33.0 34.0 33.0 34.0 4 33.473 34.0 34.0 34.0 33.0 34.0 5 33.47725 34.0 34.0 34.0 33.0 34.0 6 37.01925 38.0 37.0 38.0 36.0 38.0 7 37.285 38.0 38.0 38.0 37.0 38.0 8 37.4065 38.0 38.0 38.0 37.0 38.0 9 37.4495 38.0 38.0 38.0 37.0 38.0 10-14 37.38915000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.3964 38.0 38.0 38.0 37.0 38.0 20-24 37.28985 38.0 38.0 38.0 37.0 38.0 25-29 37.28545 38.0 38.0 38.0 37.0 38.0 30-34 37.24725 38.0 38.0 38.0 37.0 38.0 35-39 37.1894 38.0 38.0 38.0 36.8 38.0 40-44 37.07805 38.0 38.0 38.0 36.0 38.0 45-49 37.036950000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.95265 38.0 38.0 38.0 36.0 38.0 55-59 36.90215 38.0 38.0 38.0 35.6 38.0 60-64 36.82965 38.0 38.0 38.0 35.2 38.0 65-69 36.80635 38.0 38.0 38.0 35.0 38.0 70-74 36.72375 38.0 38.0 38.0 35.0 38.0 75-79 36.61275 38.0 38.0 38.0 34.6 38.0 80-84 36.63414999999999 38.0 38.0 38.0 34.6 38.0 85-89 36.44135 38.0 38.0 38.0 34.0 38.0 90-94 36.346900000000005 38.0 38.0 38.0 34.0 38.0 95-99 35.958299999999994 38.0 37.4 38.0 32.4 38.0 100-104 35.96635 38.0 37.2 38.0 32.4 38.0 105-109 35.89045 38.0 37.0 38.0 32.2 38.0 110-114 35.88675 38.0 37.0 38.0 32.8 38.0 115-119 35.90814999999999 38.0 37.2 38.0 32.8 38.0 120-124 35.68645 38.0 37.0 38.0 31.6 38.0 125-129 35.6202 38.0 37.0 38.0 31.6 38.0 130-134 35.298199999999994 38.0 36.2 38.0 30.2 38.0 135-139 35.099450000000004 38.0 36.0 38.0 29.4 38.0 140-144 34.8166 38.0 36.0 38.0 28.0 38.0 145-149 34.228699999999996 38.0 35.4 38.0 25.8 38.0 150 28.79675 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 2.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 2.0 13 2.0 14 2.0 15 5.0 16 1.0 17 2.0 18 5.0 19 7.0 20 5.0 21 6.0 22 12.0 23 7.0 24 8.0 25 16.0 26 18.0 27 23.0 28 27.0 29 37.0 30 42.0 31 61.0 32 58.0 33 93.0 34 150.0 35 267.0 36 549.0 37 2589.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.108695652173914 18.65942028985507 10.9472049689441 25.284679089026913 2 21.175 23.5 36.675000000000004 18.65 3 16.575 30.775000000000002 29.975 22.675 4 21.15 35.275 25.224999999999998 18.35 5 19.85 36.9 24.9 18.35 6 16.55413853463366 34.63365841460365 27.38184546136534 21.43035758939735 7 14.374999999999998 20.65 44.95 20.025000000000002 8 17.325 20.474999999999998 29.549999999999997 32.65 9 17.2 23.175 30.65 28.975 10-14 19.7 30.070000000000004 26.595000000000002 23.635 15-19 20.599999999999998 28.565 27.685 23.150000000000002 20-24 19.925 29.675 27.05 23.35 25-29 20.145 28.360000000000003 28.03 23.465 30-34 20.845 27.860000000000003 27.675 23.62 35-39 20.669999999999998 28.585 27.395000000000003 23.35 40-44 20.91 28.449999999999996 27.744999999999997 22.895 45-49 20.549999999999997 28.65 27.765 23.035 50-54 20.28 29.125 27.060000000000002 23.535 55-59 19.63 29.549999999999997 26.99 23.830000000000002 60-64 20.23 28.13 27.905 23.735 65-69 20.349999999999998 28.435 27.3 23.915 70-74 20.355 28.599999999999998 28.03 23.015 75-79 20.276013800690034 28.511425571278565 27.366368318415923 23.84619230961548 80-84 19.950000000000003 28.175 27.675 24.2 85-89 20.76 28.549999999999997 27.694999999999997 22.994999999999997 90-94 21.035 28.455000000000002 27.465 23.044999999999998 95-99 20.244999999999997 28.115000000000002 27.77 23.87 100-104 20.605 28.965000000000003 27.005000000000003 23.425 105-109 20.810000000000002 27.515 28.21 23.465 110-114 21.125 27.805000000000003 27.79 23.28 115-119 20.815 28.325 27.155 23.705000000000002 120-124 20.521026051302567 28.046402320116005 27.44137206860343 23.991199559978 125-129 20.935000000000002 28.01 27.08 23.974999999999998 130-134 21.33 27.639999999999997 27.200000000000003 23.830000000000002 135-139 21.305 27.939999999999998 27.22 23.535 140-144 21.11 28.015 27.485 23.39 145-149 21.91 28.24 26.575 23.275000000000002 150 21.325 27.700000000000003 27.1 23.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 1.0 5 1.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 2.5 20 1.5 21 2.0 22 5.0 23 5.5 24 5.5 25 6.5 26 6.5 27 7.0 28 14.0 29 19.0 30 28.5 31 45.5 32 50.0 33 56.5 34 68.0 35 89.0 36 107.5 37 113.5 38 125.5 39 139.5 40 159.0 41 187.5 42 220.0 43 224.5 44 230.5 45 244.5 46 247.5 47 249.5 48 238.0 49 224.0 50 181.0 51 140.0 52 123.0 53 93.0 54 69.0 55 64.0 56 54.5 57 41.5 58 30.0 59 23.5 60 18.5 61 10.0 62 6.5 63 4.0 64 3.0 65 1.5 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62630373950648 96.925 2 1.1193080641058255 2.1999999999999997 3 0.17807173747138133 0.525 4 0.05087763927753752 0.2 5 0.0 0.0 6 0.02543881963876876 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1625 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.5125 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.2999999999999998 0.0 0.0 0.0 0.0 124-125 1.45 0.0 0.0 0.0 0.0 126-127 1.6625 0.0 0.0 0.0 0.0 128-129 1.8375 0.0 0.0 0.0 0.0 130-131 2.075 0.0 0.0 0.0 0.0 132-133 2.35 0.0 0.0 0.0 0.0 134-135 2.5999999999999996 0.0 0.0 0.0 0.0 136-137 2.9125 0.0 0.0 0.0 0.0 138 3.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGCTT 10 0.0069808904 143.95 9 TCAACCT 10 0.0069808904 143.95 7 AACTCAA 15 1.1746606E-4 143.95 5 AAACTCA 20 3.6929685E-4 107.9625 4 >>END_MODULE SRR7472087 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7472087_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.733 33.0 33.0 34.0 32.0 34.0 2 32.84375 33.0 33.0 34.0 32.0 34.0 3 32.88925 33.0 33.0 34.0 32.0 34.0 4 32.84425 34.0 33.0 34.0 32.0 34.0 5 32.86125 34.0 33.0 34.0 32.0 34.0 6 36.93925 38.0 38.0 38.0 36.0 38.0 7 37.0445 38.0 38.0 38.0 37.0 38.0 8 36.85825 38.0 38.0 38.0 36.0 38.0 9 36.8865 38.0 38.0 38.0 37.0 38.0 10-14 36.886700000000005 38.0 38.0 38.0 36.4 38.0 15-19 36.848 38.0 38.0 38.0 36.0 38.0 20-24 36.75945 38.0 38.0 38.0 36.0 38.0 25-29 36.795500000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.83385 38.0 38.0 38.0 36.2 38.0 35-39 36.8198 38.0 38.0 38.0 36.0 38.0 40-44 36.7517 38.0 38.0 38.0 36.0 38.0 45-49 36.6772 38.0 38.0 38.0 36.0 38.0 50-54 36.7684 38.0 38.0 38.0 36.0 38.0 55-59 36.6965 38.0 38.0 38.0 36.0 38.0 60-64 36.69535 38.0 38.0 38.0 36.0 38.0 65-69 36.60485 38.0 38.0 38.0 35.6 38.0 70-74 36.524950000000004 38.0 38.0 38.0 35.2 38.0 75-79 36.50894999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.3476 38.0 38.0 38.0 34.6 38.0 85-89 36.27545 38.0 38.0 38.0 34.2 38.0 90-94 36.2336 38.0 38.0 38.0 34.0 38.0 95-99 36.295500000000004 38.0 38.0 38.0 34.6 38.0 100-104 36.163349999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.12714999999999 38.0 38.0 38.0 34.0 38.0 110-114 35.995050000000006 38.0 38.0 38.0 33.6 38.0 115-119 35.777849999999994 38.0 38.0 38.0 32.8 38.0 120-124 35.7188 38.0 37.8 38.0 33.0 38.0 125-129 35.5889 38.0 37.2 38.0 31.6 38.0 130-134 35.2979 38.0 36.6 38.0 31.0 38.0 135-139 35.12065 38.0 36.2 38.0 30.4 38.0 140-144 34.6412 38.0 35.8 38.0 27.8 38.0 145-149 33.89375 38.0 35.2 38.0 22.8 38.0 150 27.9425 35.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 13.0 4 2.0 5 2.0 6 2.0 7 2.0 8 2.0 9 0.0 10 2.0 11 2.0 12 2.0 13 1.0 14 5.0 15 6.0 16 2.0 17 4.0 18 6.0 19 4.0 20 4.0 21 10.0 22 10.0 23 15.0 24 11.0 25 13.0 26 14.0 27 24.0 28 14.0 29 36.0 30 36.0 31 47.0 32 49.0 33 78.0 34 108.0 35 233.0 36 476.0 37 2749.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.975 18.825 10.5 22.7 2 23.95 24.375 33.25 18.425 3 20.075000000000003 26.900000000000002 31.924999999999997 21.099999999999998 4 23.875 36.525 20.875 18.725 5 22.125 39.375 20.7 17.8 6 18.36632422951641 37.05838135805563 24.7557003257329 19.819594086695062 7 17.01327987972939 17.514407416687547 43.823603106990724 21.648709596592333 8 19.919819594086697 22.575795539964922 27.36156351791531 30.14282134803307 9 22.019038076152306 23.39679358717435 27.680360721442888 26.903807615230463 10-14 22.80402866162249 28.922182692789498 26.57714085283359 21.696647792754423 15-19 23.254998246229395 28.315879140151324 27.38888610512602 21.04023650849326 20-24 23.903025445802445 27.514526147064718 27.589661390502908 20.992787016629936 25-29 22.71315499448953 28.34385332131049 27.65754934375313 21.28544234044685 30-34 22.473317632910756 27.844866462895222 27.879941875031317 21.8018740291627 35-39 23.25231771485843 27.787521924329745 27.51691305437234 21.44324730643949 40-44 23.215717722534084 27.7415797914996 27.866880513231756 21.175821972734564 45-49 22.73342354533153 27.8454367764246 27.589836114869943 21.83130356337393 50-54 22.678088367899008 27.221721270413784 28.02825368199579 22.071936679691415 55-59 23.735096683699027 27.036369101292458 27.417092475703836 21.81144173930468 60-64 22.89235084907078 27.385663477433255 27.596052697490357 22.12593297600561 65-69 22.95517155021287 27.468069120961687 27.292762334084646 22.283996994740797 70-74 23.46043994588365 27.183444405471764 27.43899383674901 21.917121811895576 75-79 23.487847657228762 27.712352793786017 27.060886995740418 21.738912553244802 80-84 22.93118139441632 28.10886672347251 27.702872036489403 21.257079845621774 85-89 23.42888643880926 27.13240453041997 27.65861481407237 21.780094216698405 90-94 23.605128718821998 27.486727436642294 27.306420915556444 21.601722928979264 95-99 22.992536191955118 27.801432650403246 27.76636778039373 21.439663377247907 100-104 23.13470205307962 28.02704056084126 27.626439659489233 21.211817726589885 105-109 23.340010015022532 28.16725087631447 27.025538307461193 21.467200801201802 110-114 23.044566850275412 28.082123184777164 27.67150726089134 21.20180270405608 115-119 23.293434166374517 28.361796964992237 27.320078128912705 21.02469073972054 120-124 23.319306682697125 27.687606452259296 27.77276825969342 21.220318605350165 125-129 23.490504584857444 27.59933857794258 27.910006514005108 21.00015032319487 130-134 24.334753194688048 28.06815334502631 26.82535705337008 20.77173640691556 135-139 23.769670241555577 27.608499548962612 27.778891450335774 20.842938759146033 140-144 23.961933383420984 27.643375907838717 27.32281492612071 21.071875782619585 145-149 24.589096011224694 28.161956303868514 27.685908999799558 19.563038685107237 150 24.65 27.825 27.500000000000004 20.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 2.5 4 2.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.5 21 0.5 22 1.0 23 2.0 24 1.5 25 1.0 26 4.0 27 9.5 28 9.5 29 10.5 30 16.0 31 17.5 32 25.0 33 39.0 34 49.5 35 56.0 36 63.5 37 80.5 38 126.0 39 157.0 40 172.0 41 203.5 42 219.0 43 240.0 44 261.0 45 251.5 46 252.5 47 264.5 48 241.5 49 216.5 50 194.0 51 155.5 52 134.5 53 116.5 54 93.0 55 77.5 56 61.0 57 41.5 58 32.5 59 29.0 60 19.5 61 15.0 62 10.5 63 5.0 64 3.0 65 2.0 66 1.5 67 1.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.22499999999999998 7 0.22499999999999998 8 0.22499999999999998 9 0.2 10-14 0.215 15-19 0.215 20-24 0.18 25-29 0.19 30-34 0.215 35-39 0.22499999999999998 40-44 0.24 45-49 0.23500000000000001 50-54 0.19 55-59 0.19 60-64 0.185 65-69 0.17500000000000002 70-74 0.215 75-79 0.22499999999999998 80-84 0.245 85-89 0.22999999999999998 90-94 0.16999999999999998 95-99 0.185 100-104 0.15 105-109 0.15 110-114 0.15 115-119 0.165 120-124 0.19 125-129 0.215 130-134 0.22499999999999998 135-139 0.22999999999999998 140-144 0.17500000000000002 145-149 0.22 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.62525458248473 96.85000000000001 2 1.120162932790224 2.1999999999999997 3 0.15274949083503053 0.44999999999999996 4 0.05091649694501018 0.2 5 0.0 0.0 6 0.05091649694501018 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 6 0.15 No Hit GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.8375 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.1500000000000004 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.6375 0.0 0.0 0.0 0.0 136-137 2.925 0.0 0.0 0.0 0.0 138 3.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACTGC 10 0.006973645 144.0 3 CACTGCT 10 0.006973645 144.0 4 GCCGCTA 10 0.006973645 144.0 4 GGAAAAA 10 0.006973645 144.0 7 >>END_MODULE Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970274 spots for SRR7472087.sra Written 970274 spots for SRR7472087.sra Read 970293 spots for SRR7472087.sra Written 970293 spots for SRR7472087.sra SRR ids: ['SRR7472087.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gt7lmkv4 SRR7472087.sra spots: 19405499 blocks: [[1, 970274], [970275, 1940548], [1940549, 2910822], [2910823, 3881096], [3881097, 4851370], [4851371, 5821644], [5821645, 6791918], [6791919, 7762192], [7762193, 8732466], [8732467, 9702740], [9702741, 10673014], [10673015, 11643288], [11643289, 12613562], [12613563, 13583836], [13583837, 14554110], [14554111, 15524384], [15524385, 16494658], [16494659, 17464932], [17464933, 18435206], [18435207, 19405499]] SRR7472087 file size 6516285 SRR7472087 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7472087 SRR7472087_1.fastq SRR7472087_2.fastq Input file: SRR7472087_1.fastq Paired file: SRR7472087_2.fastq trimmed: SRR7472087-trimmed-pair1.fastq, SRR7472087-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:14:18 2025 >> started Thu Feb 13 18:14:41 2025 >> done (23.361s) 19405499 read pairs processed; of these: 49417 ( 0.25%) short read pairs filtered out after trimming by size control 41449 ( 0.21%) empty read pairs filtered out after trimming by size control 19314633 (99.53%) read pairs available; of these: 6312485 (32.68%) trimmed read pairs available after processing 13002148 (67.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 4 0.00% 20 9 0.00% 21 15 0.00% 22 11 0.00% 23 21 0.00% 24 19 0.00% 25 18 0.00% 26 24 0.00% 27 27 0.00% 28 24 0.00% 29 25 0.00% 30 25 0.00% 31 22 0.00% 32 24 0.00% 33 35 0.00% 34 23 0.00% 35 34 0.00% 36 27 0.00% 37 32 0.00% 38 33 0.00% 39 32 0.00% 40 37 0.00% 41 44 0.00% 42 42 0.00% 43 45 0.00% 44 40 0.00% 45 51 0.00% 46 54 0.00% 47 58 0.00% 48 79 0.00% 49 80 0.00% 50 84 0.00% 51 100 0.00% 52 121 0.00% 53 106 0.00% 54 128 0.00% 55 119 0.00% 56 160 0.00% 57 144 0.00% 58 177 0.00% 59 158 0.00% 60 164 0.00% 61 183 0.00% 62 208 0.00% 63 214 0.00% 64 246 0.00% 65 319 0.00% 66 331 0.00% 67 444 0.00% 68 744 0.00% 69 3029 0.02% 70 2670 0.01% 71 827 0.00% 72 677 0.00% 73 616 0.00% 74 648 0.00% 75 675 0.00% 76 823 0.00% 77 901 0.00% 78 949 0.00% 79 1063 0.01% 80 1196 0.01% 81 1290 0.01% 82 1535 0.01% 83 1989 0.01% 84 4186 0.02% 85 4538 0.02% 86 5295 0.03% 87 5829 0.03% 88 6065 0.03% 89 5922 0.03% 90 6156 0.03% 91 6112 0.03% 92 6071 0.03% 93 6382 0.03% 94 6554 0.03% 95 7054 0.04% 96 7273 0.04% 97 7607 0.04% 98 8105 0.04% 99 8761 0.05% 100 9135 0.05% 101 9931 0.05% 102 10570 0.05% 103 11373 0.06% 104 11989 0.06% 105 12510 0.06% 106 12987 0.07% 107 13562 0.07% 108 14194 0.07% 109 14969 0.08% 110 15629 0.08% 111 16666 0.09% 112 17777 0.09% 113 18871 0.10% 114 19517 0.10% 115 20406 0.11% 116 21359 0.11% 117 22164 0.11% 118 22938 0.12% 119 23667 0.12% 120 24855 0.13% 121 26178 0.14% 122 27200 0.14% 123 29309 0.15% 124 30178 0.16% 125 31479 0.16% 126 33312 0.17% 127 34570 0.18% 128 35875 0.19% 129 38579 0.20% 130 39639 0.21% 131 41473 0.21% 132 45071 0.23% 133 47743 0.25% 134 50899 0.26% 135 53284 0.28% 136 56725 0.29% 137 60507 0.31% 138 64054 0.33% 139 68372 0.35% 140 72894 0.38% 141 79986 0.41% 142 88894 0.46% 143 100279 0.52% 144 116099 0.60% 145 139787 0.72% 146 180695 0.94% 147 261893 1.36% 148 510497 2.64% 149 3475973 18.00% 150 13002148 67.32% 19314633 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=32 prefix-density=0.59 prefix-fanout=2.4 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCTGTGCAGGGGTGCGGTTAACTGTGGCAACGGCCGCCGATGAAATCACAGAGGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=58.82 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.6 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=30 prefix-density=0.48 prefix-fanout=2.2 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=75.49 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=1.1 sequence=TTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGA SRR7472087 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:15:31 Started mapping on | Feb 13 18:15:31 Finished on | Feb 13 18:19:27 Mapping speed, Million of reads per hour | 294.63 Number of input reads | 19314633 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17864708 Uniquely mapped reads % | 92.49% Average mapped length | 295.02 Number of splices: Total | 16629123 Number of splices: Annotated (sjdb) | 16371195 Number of splices: GT/AG | 16305792 Number of splices: GC/AG | 282842 Number of splices: AT/AC | 11854 Number of splices: Non-canonical | 28635 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.28 Insertion rate per base | 0.01% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405775 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 31299 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.21% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1082689 1082689 1082689 N_multimapping 405775 405775 405775 N_noFeature 494813 17617786 562221 N_ambiguous 284761 946 104787 UnstrandedReadsAssigned:17085134 PositiveStrandReadsAssigned:245976 NegativeStrandReadsAssigned:17197700 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR7472087 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7472087-trimmed-pair1.fastq SRR7472087-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,314,633 reads, 17,340,778 reads pseudoaligned [quant] estimated average fragment length: 261.566 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52401 SRR7472087.ke.tsv 34699 SRR7472087.se.tsv 87100 total ==> SRR7472087.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.43 387 10.1913 Potri.005G024800.1.v4.1 1035 774.434 305 18.2269 Potri.004G059700.1.v4.1 961 700.524 28 1.84983 Potri.007G009000.2.v4.1 1416 1155.43 1 0.0400545 Potri.003G141000.2.v4.1 2943 2682.43 542.862 9.36607 Potri.016G087400.1.v4.1 270 72.4616 864.522 552.16 Potri.015G069301.1.v4.1 564 312.146 0 0 Potri.010G195200.1.v4.1 1773 1512.43 28 0.856798 Potri.012G127500.1.v4.1 977 716.484 1730 111.747 ==> SRR7472087.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 347 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 365 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 98 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7472087 completed mapping pipeline successfully