Starting /dee2/code/volunteer_pipeline.sh SRR7472088 current disk space = 3088648212480 free memory = 1456480848 SRR7472088 SRAfilesize b6316da2733939e7bdc923b3cc32c704 SRR7472088.sra SRR7472088.sra file validated SRR7472088 is paired end SRR7472088 is conventional basespace SRR7472088 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7472088_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.041 34.0 33.0 34.0 32.0 34.0 2 33.2685 34.0 33.0 34.0 32.0 34.0 3 33.385 34.0 34.0 34.0 32.0 34.0 4 33.481 34.0 34.0 34.0 33.0 34.0 5 33.4545 34.0 34.0 34.0 33.0 34.0 6 37.06075 38.0 37.0 38.0 36.0 38.0 7 37.41025 38.0 38.0 38.0 37.0 38.0 8 37.56975 38.0 38.0 38.0 38.0 38.0 9 37.59675 38.0 38.0 38.0 38.0 38.0 10-14 37.52479999999999 38.0 38.0 38.0 37.8 38.0 15-19 37.5336 38.0 38.0 38.0 37.8 38.0 20-24 37.5598 38.0 38.0 38.0 38.0 38.0 25-29 37.51975 38.0 38.0 38.0 37.8 38.0 30-34 37.48235 38.0 38.0 38.0 38.0 38.0 35-39 37.4465 38.0 38.0 38.0 37.4 38.0 40-44 37.36255 38.0 38.0 38.0 37.0 38.0 45-49 37.32940000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.32955 38.0 38.0 38.0 37.0 38.0 55-59 37.237849999999995 38.0 38.0 38.0 36.8 38.0 60-64 37.168150000000004 38.0 38.0 38.0 36.2 38.0 65-69 37.1425 38.0 38.0 38.0 36.0 38.0 70-74 37.0777 38.0 38.0 38.0 36.0 38.0 75-79 37.03855 38.0 38.0 38.0 36.0 38.0 80-84 37.094350000000006 38.0 38.0 38.0 36.0 38.0 85-89 36.9711 38.0 38.0 38.0 36.0 38.0 90-94 36.796749999999996 38.0 38.0 38.0 35.4 38.0 95-99 36.57185 38.0 38.0 38.0 34.8 38.0 100-104 36.4731 38.0 38.0 38.0 34.0 38.0 105-109 36.494899999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.4517 38.0 38.0 38.0 34.4 38.0 115-119 36.45725 38.0 38.0 38.0 34.0 38.0 120-124 36.399 38.0 38.0 38.0 34.0 38.0 125-129 36.1455 38.0 38.0 38.0 33.8 38.0 130-134 35.98675000000001 38.0 37.6 38.0 33.2 38.0 135-139 35.858149999999995 38.0 37.4 38.0 33.2 38.0 140-144 35.56400000000001 38.0 36.0 38.0 31.4 38.0 145-149 35.3202 38.0 36.0 38.0 31.8 38.0 150 29.8685 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 2.0 18 2.0 19 5.0 20 7.0 21 2.0 22 4.0 23 6.0 24 9.0 25 8.0 26 11.0 27 21.0 28 19.0 29 23.0 30 36.0 31 34.0 32 55.0 33 64.0 34 122.0 35 205.0 36 412.0 37 2948.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.88016745159602 18.969126111983257 12.06174777603349 30.088958660387235 2 21.175 23.95 36.5 18.375 3 16.7 32.6 27.85 22.85 4 19.679919979995 37.78444611152788 23.455863965991497 19.079769942485623 5 19.744744744744743 37.512512512512515 24.74974974974975 17.992992992992992 6 15.825 35.099999999999994 26.450000000000003 22.625 7 11.95 19.425 48.449999999999996 20.175 8 17.45 22.1 29.4 31.05 9 19.0 21.325 31.075000000000003 28.599999999999998 10-14 19.78 30.665 26.619999999999997 22.935 15-19 19.905 28.96 27.655 23.48 20-24 20.115 29.265 28.005000000000003 22.615 25-29 20.47 29.110000000000003 27.334999999999997 23.085 30-34 20.25 29.28 27.295 23.175 35-39 20.57 29.044999999999998 27.24 23.145 40-44 20.13 28.955 27.965 22.95 45-49 20.24 29.085 27.41 23.265 50-54 20.21 28.660000000000004 27.694999999999997 23.435 55-59 20.22 29.28 28.105000000000004 22.395 60-64 19.830000000000002 28.875 27.800000000000004 23.494999999999997 65-69 21.175 29.17 27.045 22.61 70-74 20.78 29.03 27.42 22.770000000000003 75-79 20.23 28.58 27.694999999999997 23.494999999999997 80-84 21.04 28.199999999999996 27.465 23.294999999999998 85-89 21.075 28.465 27.525 22.935 90-94 20.565 28.494999999999997 27.939999999999998 23.0 95-99 20.515 28.355000000000004 27.92 23.21 100-104 20.580000000000002 28.235 27.74 23.445 105-109 21.195 28.410000000000004 27.22 23.175 110-114 20.365 29.17 27.445000000000004 23.02 115-119 21.23 28.645 27.315 22.81 120-124 21.535 28.645 27.315 22.505 125-129 21.265 28.53 26.650000000000002 23.555 130-134 21.5 28.59 27.015 22.895 135-139 21.21 29.04 26.950000000000003 22.8 140-144 21.88 28.605000000000004 26.505000000000003 23.01 145-149 21.515 28.715000000000003 25.955000000000002 23.815 150 21.715145436308926 28.711133400200602 25.426278836509532 24.147442326980944 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 0.5 22 0.5 23 3.0 24 3.0 25 3.0 26 6.0 27 6.0 28 8.5 29 17.5 30 29.5 31 42.0 32 49.5 33 69.5 34 92.5 35 120.5 36 134.0 37 141.5 38 170.0 39 185.0 40 195.5 41 189.5 42 197.5 43 217.5 44 219.5 45 232.0 46 225.5 47 208.5 48 202.5 49 184.5 50 165.5 51 138.0 52 110.5 53 85.5 54 71.0 55 69.0 56 52.0 57 34.0 58 29.0 59 24.5 60 14.5 61 11.0 62 9.0 63 5.5 64 7.0 65 6.0 66 2.0 67 2.5 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.45 2 0.0 3 0.0 4 0.025 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.41985926505082 93.45 2 1.7982799061767005 3.45 3 0.49517852488923636 1.425 4 0.13031013812874642 0.5 5 0.026062027625749284 0.125 6 0.0 0.0 7 0.026062027625749284 0.17500000000000002 8 0.05212405525149857 0.4 9 0.026062027625749284 0.22499999999999998 >10 0.026062027625749284 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTG 10 0.25 No Hit GCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAA 9 0.22499999999999998 No Hit TGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATA 8 0.2 No Hit GGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCT 8 0.2 No Hit AAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAA 7 0.17500000000000002 No Hit GATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.2999999999999998 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 3.1 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 3.9625 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.6875 0.0 0.0 0.0 0.0 130-131 5.125 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 6.0625 0.0 0.0 0.0 0.0 136-137 6.975 0.0 0.0 0.0 0.0 138 7.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCCAA 10 0.0069827023 143.9375 5 >>END_MODULE SRR7472088 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7472088_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65425 33.0 33.0 34.0 32.0 34.0 2 32.924 33.0 33.0 34.0 32.0 34.0 3 33.03375 34.0 33.0 34.0 32.0 34.0 4 32.97875 34.0 33.0 34.0 32.0 34.0 5 32.96125 34.0 33.0 34.0 32.0 34.0 6 37.16675 38.0 38.0 38.0 37.0 38.0 7 37.223 38.0 38.0 38.0 37.0 38.0 8 37.255 38.0 38.0 38.0 37.0 38.0 9 37.244 38.0 38.0 38.0 37.0 38.0 10-14 37.187650000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.23475 38.0 38.0 38.0 37.0 38.0 20-24 37.17205 38.0 38.0 38.0 37.0 38.0 25-29 37.098299999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.1606 38.0 38.0 38.0 37.0 38.0 35-39 37.15455 38.0 38.0 38.0 37.0 38.0 40-44 37.08205 38.0 38.0 38.0 36.8 38.0 45-49 37.097150000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.0631 38.0 38.0 38.0 37.0 38.0 55-59 37.04554999999999 38.0 38.0 38.0 36.8 38.0 60-64 37.0428 38.0 38.0 38.0 36.6 38.0 65-69 36.97115000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.966699999999996 38.0 38.0 38.0 36.2 38.0 75-79 36.90535 38.0 38.0 38.0 36.0 38.0 80-84 36.8458 38.0 38.0 38.0 36.0 38.0 85-89 36.825450000000004 38.0 38.0 38.0 36.0 38.0 90-94 36.73595 38.0 38.0 38.0 35.6 38.0 95-99 36.68325 38.0 38.0 38.0 35.4 38.0 100-104 36.621100000000006 38.0 38.0 38.0 35.0 38.0 105-109 36.554550000000006 38.0 38.0 38.0 34.8 38.0 110-114 36.5223 38.0 38.0 38.0 34.6 38.0 115-119 36.336949999999995 38.0 38.0 38.0 34.0 38.0 120-124 36.222699999999996 38.0 38.0 38.0 34.0 38.0 125-129 35.97449999999999 38.0 38.0 38.0 33.4 38.0 130-134 35.75825 38.0 38.0 38.0 32.6 38.0 135-139 35.40105 38.0 36.8 38.0 31.4 38.0 140-144 35.2162 38.0 36.4 38.0 31.0 38.0 145-149 34.466699999999996 38.0 36.0 38.0 29.2 38.0 150 28.585 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 0.0 5 2.0 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 5.0 12 2.0 13 2.0 14 0.0 15 2.0 16 1.0 17 7.0 18 4.0 19 7.0 20 3.0 21 6.0 22 10.0 23 3.0 24 11.0 25 15.0 26 13.0 27 16.0 28 28.0 29 34.0 30 35.0 31 37.0 32 63.0 33 81.0 34 114.0 35 153.0 36 372.0 37 2966.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.15269086357947 15.66958698372966 13.717146433041302 28.46057571964956 2 23.730932733183295 23.88097024256064 34.25856464116029 18.12953238309577 3 20.635317658829415 25.287643821910955 32.89144572286143 21.1855927963982 4 23.78689344672336 35.09254627313656 20.810405202601302 20.31015507753877 5 23.011505752876438 36.59329664832416 21.635817908954476 18.75937968984492 6 17.325 38.125 24.425 20.125 7 16.825000000000003 15.8 44.800000000000004 22.575 8 19.875 22.425 28.050000000000004 29.65 9 21.525 24.95 26.974999999999998 26.55 10-14 22.835 28.860000000000003 26.565 21.740000000000002 15-19 23.75 27.11 27.76 21.38 20-24 23.799999999999997 27.93 27.415 20.855 25-29 23.62 27.48 27.725 21.175 30-34 23.0 27.650000000000002 28.01 21.34 35-39 23.14 27.855 27.595 21.41 40-44 23.195 27.900000000000002 27.365000000000002 21.54 45-49 22.650000000000002 27.115000000000002 28.535 21.7 50-54 22.545 27.725 28.410000000000004 21.32 55-59 22.770000000000003 27.615000000000002 28.15 21.465 60-64 22.405 28.17 28.215 21.21 65-69 22.56 27.775 28.249999999999996 21.415 70-74 23.215 27.58 28.225 20.979999999999997 75-79 22.384999999999998 28.175 27.860000000000003 21.58 80-84 22.68 28.084999999999997 27.965 21.27 85-89 23.05 28.360000000000003 27.975 20.615 90-94 22.770000000000003 28.294999999999998 27.865000000000002 21.07 95-99 22.845 27.975 28.035 21.145 100-104 23.375 28.425 27.67 20.53 105-109 23.169999999999998 28.185 28.015 20.630000000000003 110-114 23.494999999999997 28.305000000000003 27.725 20.474999999999998 115-119 23.73 27.92 28.025 20.325 120-124 23.5 28.095 27.794999999999998 20.61 125-129 23.895 28.335 27.32 20.45 130-134 24.235 28.03 27.79 19.945 135-139 23.89 28.515 27.445000000000004 20.150000000000002 140-144 24.605 28.355000000000004 27.595 19.445 145-149 25.83 27.889999999999997 26.895000000000003 19.384999999999998 150 24.84984984984985 27.57757757757758 27.87787787787788 19.694694694694697 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.5 22 1.5 23 1.5 24 1.5 25 2.5 26 3.5 27 4.5 28 5.0 29 9.5 30 21.0 31 29.0 32 31.5 33 44.5 34 57.5 35 79.5 36 103.5 37 121.5 38 149.5 39 174.0 40 189.0 41 197.5 42 210.0 43 219.5 44 243.0 45 254.5 46 245.0 47 237.5 48 225.0 49 195.5 50 161.5 51 134.5 52 118.0 53 104.0 54 90.5 55 85.0 56 66.5 57 46.5 58 36.0 59 31.5 60 20.0 61 10.0 62 9.5 63 9.0 64 6.0 65 3.5 66 2.0 67 1.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.025 3 0.05 4 0.05 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.7 #Duplication Level Percentage of deduplicated Percentage of total 1 97.33542319749216 93.15 2 1.9070010449320793 3.65 3 0.41797283176593525 1.2 4 0.10449320794148381 0.4 5 0.07836990595611285 0.375 6 0.026123301985370953 0.15 7 0.07836990595611285 0.525 8 0.0 0.0 9 0.026123301985370953 0.22499999999999998 >10 0.026123301985370953 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 13 0.325 No Hit GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 9 0.22499999999999998 No Hit CCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGG 7 0.17500000000000002 No Hit CCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGT 7 0.17500000000000002 No Hit GGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTTTTCAAAACAATCAC 7 0.17500000000000002 No Hit TGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTC 6 0.15 No Hit AAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCT 5 0.125 No Hit CAATTATCCATAAAACTGTAACTAAGTGAGGCTCTCTCATTGGTTTATAC 5 0.125 No Hit GTTTCCTCCTATGGTTTTCAAAACAATCACCATCATGCTATTAATGATAT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.9750000000000001 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.3250000000000002 0.0 0.0 0.0 0.0 108-109 1.45 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.8 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 4.0375 0.0 0.0 0.0 0.0 126-127 4.2625 0.0 0.0 0.0 0.0 128-129 4.7625 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 6.137499999999999 0.0 0.0 0.0 0.0 136-137 7.0 0.0 0.0 0.0 0.0 138 7.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCACTA 10 0.006973645 144.0 7 >>END_MODULE Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070343 spots for SRR7472088.sra Written 1070343 spots for SRR7472088.sra Read 1070354 spots for SRR7472088.sra Written 1070354 spots for SRR7472088.sra SRR ids: ['SRR7472088.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bja614e6 SRR7472088.sra spots: 21406871 blocks: [[1, 1070343], [1070344, 2140686], [2140687, 3211029], [3211030, 4281372], [4281373, 5351715], [5351716, 6422058], [6422059, 7492401], [7492402, 8562744], [8562745, 9633087], [9633088, 10703430], [10703431, 11773773], [11773774, 12844116], [12844117, 13914459], [13914460, 14984802], [14984803, 16055145], [16055146, 17125488], [17125489, 18195831], [18195832, 19266174], [19266175, 20336517], [20336518, 21406871]] SRR7472088 file size 7190575 SRR7472088 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7472088 SRR7472088_1.fastq SRR7472088_2.fastq Input file: SRR7472088_1.fastq Paired file: SRR7472088_2.fastq trimmed: SRR7472088-trimmed-pair1.fastq, SRR7472088-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:42:38 2025 >> started Thu Feb 13 17:43:01 2025 >> done (22.735s) 21406871 read pairs processed; of these: 21407 ( 0.10%) short read pairs filtered out after trimming by size control 46038 ( 0.22%) empty read pairs filtered out after trimming by size control 21339426 (99.68%) read pairs available; of these: 7406003 (34.71%) trimmed read pairs available after processing 13933423 (65.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 1 0.00% 21 9 0.00% 22 7 0.00% 23 7 0.00% 24 14 0.00% 25 9 0.00% 26 8 0.00% 27 10 0.00% 28 9 0.00% 29 16 0.00% 30 6 0.00% 31 10 0.00% 32 13 0.00% 33 10 0.00% 34 11 0.00% 35 51 0.00% 36 18 0.00% 37 33 0.00% 38 26 0.00% 39 25 0.00% 40 27 0.00% 41 16 0.00% 42 35 0.00% 43 43 0.00% 44 37 0.00% 45 55 0.00% 46 53 0.00% 47 65 0.00% 48 78 0.00% 49 89 0.00% 50 82 0.00% 51 120 0.00% 52 140 0.00% 53 116 0.00% 54 147 0.00% 55 162 0.00% 56 186 0.00% 57 182 0.00% 58 194 0.00% 59 258 0.00% 60 324 0.00% 61 297 0.00% 62 309 0.00% 63 388 0.00% 64 441 0.00% 65 509 0.00% 66 612 0.00% 67 818 0.00% 68 1374 0.01% 69 6226 0.03% 70 5991 0.03% 71 2085 0.01% 72 1537 0.01% 73 1377 0.01% 74 1490 0.01% 75 1575 0.01% 76 1714 0.01% 77 1834 0.01% 78 2182 0.01% 79 2434 0.01% 80 2702 0.01% 81 3132 0.01% 82 3495 0.02% 83 4082 0.02% 84 5535 0.03% 85 5812 0.03% 86 6347 0.03% 87 7297 0.03% 88 7901 0.04% 89 8367 0.04% 90 9065 0.04% 91 9499 0.04% 92 10675 0.05% 93 11370 0.05% 94 12375 0.06% 95 13047 0.06% 96 13938 0.07% 97 14503 0.07% 98 15509 0.07% 99 16689 0.08% 100 17760 0.08% 101 19028 0.09% 102 20267 0.09% 103 21878 0.10% 104 22970 0.11% 105 24466 0.11% 106 25849 0.12% 107 26592 0.12% 108 28271 0.13% 109 28935 0.14% 110 30192 0.14% 111 31940 0.15% 112 34133 0.16% 113 38075 0.18% 114 37606 0.18% 115 39726 0.19% 116 40578 0.19% 117 41762 0.20% 118 43471 0.20% 119 44029 0.21% 120 46157 0.22% 121 48957 0.23% 122 50284 0.24% 123 53623 0.25% 124 54283 0.25% 125 57680 0.27% 126 58956 0.28% 127 60109 0.28% 128 61354 0.29% 129 65183 0.31% 130 66324 0.31% 131 68331 0.32% 132 72746 0.34% 133 76099 0.36% 134 79612 0.37% 135 81291 0.38% 136 85514 0.40% 137 87647 0.41% 138 91857 0.43% 139 95906 0.45% 140 100154 0.47% 141 106163 0.50% 142 114720 0.54% 143 122240 0.57% 144 137229 0.64% 145 156591 0.73% 146 193939 0.91% 147 267665 1.25% 148 496905 2.33% 149 3513711 16.47% 150 13933423 65.29% 21339426 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=6.65 fanout-score-rank=15 prefix-density=0.32 prefix-fanout=3.7 sequence=TTGCAGCCATTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=51.30 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.7 sequence=TTTTTTTTCTCGTTCTTTGGTCGCAATCCTGCGTAATCAACGCCGCAACTTTACGTCGGATTAGCTCTTCTTTGATTAGCATGAAACTCCAAGGTCCGGGGGGGTCACTTATCCTGGGCTTCATCCAATGGTGGGTGCTAACTCTTTAATAGCCTTCAGTGACTGTGAGATGCCGTCTACGAGTGGCACGAATCGCACGGATGTTTGGTTAAAGAACAGTCGCAGTTTTCCTCAAATCCCGCCACGAAACTAAGCGATTGAACTCTTGCCTGGTTACTGTATGCCCCTGTGTTATTGCAGCGTCTCGATTAGGGGGAAACCTTGTCACCGTCAGCTTATTCCCGAGGCATATGGCCCTACTTAACTGATCTGAAGTATTACGGTAACCGCGACGATAATAACCCGGACCAAATATAGCCTGATATGAGCGTGCCCGTCCATAGTCCCAGAGACGGGCGGAGGCTC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=25 prefix-density=0.29 prefix-fanout=3.1 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=22.70 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.7 sequence=TCAACAATAACGTCTCTTTCAGAAGGCATTGGTATCTTTTCCCCACTTCCAAGCATTTTTTCAACTAATCTTATGTTATTAACCATTTCCTTAAATTCTTCTGGGTCTGCTGACAAAGCATGATCAGGACCTTCCATATTTTTATCTAAGGTAAAGTGCTTCTCAATAACATCCGCTCCTAAGGCAACAGAAACTACTGGGGCGAGTATTCCCAATGTATGGTCAGAATATCCCACAGGGATATTGAATATACTTTTCAAGGTTTTAATAGCGTTTAAATTGACATCTTCATAAGGGGTTGGGTAAGATGAAATACAATGCAATAAAATAATATCCCTGCATCCATTATTTTCTAAAACTTT SRR7472088 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:43:56 Started mapping on | Feb 13 17:43:57 Finished on | Feb 13 17:52:11 Mapping speed, Million of reads per hour | 155.51 Number of input reads | 21339426 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17566610 Uniquely mapped reads % | 82.32% Average mapped length | 292.77 Number of splices: Total | 16039737 Number of splices: Annotated (sjdb) | 15767047 Number of splices: GT/AG | 15738176 Number of splices: GC/AG | 259970 Number of splices: AT/AC | 11476 Number of splices: Non-canonical | 30115 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.13 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 395103 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 36731 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.61% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3391851 3391851 3391851 N_multimapping 395103 395103 395103 N_noFeature 555163 17287553 635093 N_ambiguous 298547 1017 98932 UnstrandedReadsAssigned:16712900 PositiveStrandReadsAssigned:278040 NegativeStrandReadsAssigned:16832585 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR7472088 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7472088-trimmed-pair1.fastq SRR7472088-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,339,426 reads, 16,981,645 reads pseudoaligned [quant] estimated average fragment length: 228.995 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52401 SRR7472088.ke.tsv 34699 SRR7472088.se.tsv 87100 total ==> SRR7472088.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790 641 18.347 Potri.005G024800.1.v4.1 1035 807.005 414 26.2836 Potri.004G059700.1.v4.1 961 733.027 6 0.419365 Potri.007G009000.2.v4.1 1416 1188 0 0 Potri.003G141000.2.v4.1 2943 2715 771.321 14.5555 Potri.016G087400.1.v4.1 270 84.2367 727 442.175 Potri.015G069301.1.v4.1 564 339.638 0 0 Potri.010G195200.1.v4.1 1773 1545 63.8693 2.11799 Potri.012G127500.1.v4.1 977 749.016 1282 87.6916 ==> SRR7472088.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 322 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 120 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7472088 completed mapping pipeline successfully