Starting /dee2/code/volunteer_pipeline.sh SRR7472089 current disk space = 3088770670592 free memory = 1419251564 SRR7472089 SRAfilesize a7d0385744ffb004d3bf3fff16554284 SRR7472089.sra SRR7472089.sra file validated SRR7472089 is paired end SRR7472089 is conventional basespace SRR7472089 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7472089_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99325 34.0 33.0 34.0 33.0 34.0 2 33.337 34.0 33.0 34.0 33.0 34.0 3 33.32925 34.0 33.0 34.0 33.0 34.0 4 33.409 34.0 34.0 34.0 33.0 34.0 5 33.3905 34.0 34.0 34.0 33.0 34.0 6 37.07925 38.0 37.0 38.0 36.0 38.0 7 37.34075 38.0 38.0 38.0 37.0 38.0 8 37.419 38.0 38.0 38.0 37.0 38.0 9 37.4835 38.0 38.0 38.0 38.0 38.0 10-14 37.5304 38.0 38.0 38.0 37.8 38.0 15-19 37.4914 38.0 38.0 38.0 37.8 38.0 20-24 37.45945 38.0 38.0 38.0 37.6 38.0 25-29 37.404250000000005 38.0 38.0 38.0 37.6 38.0 30-34 37.39014999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.364050000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.25195 38.0 38.0 38.0 37.0 38.0 45-49 37.22935 38.0 38.0 38.0 37.0 38.0 50-54 37.19305000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.0967 38.0 38.0 38.0 36.2 38.0 60-64 36.98755 38.0 38.0 38.0 36.0 38.0 65-69 37.03605 38.0 38.0 38.0 36.2 38.0 70-74 36.96065 38.0 38.0 38.0 36.0 38.0 75-79 36.95605 38.0 38.0 38.0 36.0 38.0 80-84 36.8927 38.0 38.0 38.0 36.0 38.0 85-89 36.7658 38.0 38.0 38.0 35.6 38.0 90-94 36.542699999999996 38.0 38.0 38.0 35.0 38.0 95-99 36.475550000000005 38.0 38.0 38.0 34.4 38.0 100-104 36.4506 38.0 38.0 38.0 34.4 38.0 105-109 36.45585 38.0 38.0 38.0 34.4 38.0 110-114 36.443799999999996 38.0 38.0 38.0 34.2 38.0 115-119 36.31125 38.0 38.0 38.0 34.0 38.0 120-124 36.191 38.0 38.0 38.0 33.8 38.0 125-129 36.025800000000004 38.0 38.0 38.0 33.8 38.0 130-134 35.8061 38.0 38.0 38.0 32.6 38.0 135-139 35.689750000000004 38.0 37.8 38.0 33.0 38.0 140-144 35.55915 38.0 37.4 38.0 32.6 38.0 145-149 35.065 38.0 36.0 38.0 31.2 38.0 150 30.4365 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 0.0 9 2.0 10 2.0 11 1.0 12 1.0 13 4.0 14 1.0 15 3.0 16 3.0 17 1.0 18 2.0 19 5.0 20 6.0 21 3.0 22 6.0 23 8.0 24 5.0 25 9.0 26 14.0 27 13.0 28 30.0 29 42.0 30 36.0 31 46.0 32 56.0 33 85.0 34 116.0 35 159.0 36 336.0 37 3003.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.10351809668438 19.665907365223994 11.667932169071122 27.5626423690205 2 21.425 22.875 35.949999999999996 19.75 3 17.075000000000003 31.25 30.225 21.45 4 19.575 36.1 25.374999999999996 18.95 5 20.305076269067268 36.90922730682671 24.33108277069267 18.454613653413354 6 16.650000000000002 36.65 25.8 20.9 7 13.775 19.8 45.800000000000004 20.625 8 16.85 23.200000000000003 30.475 29.475 9 17.95 22.15 31.424999999999997 28.475 10-14 19.61 30.714999999999996 26.87 22.805 15-19 19.545 29.330000000000002 27.779999999999998 23.345 20-24 19.955000000000002 29.315 27.400000000000002 23.330000000000002 25-29 19.29 29.465000000000003 28.255000000000003 22.99 30-34 19.965 29.34 27.875 22.82 35-39 20.64 29.544999999999998 27.055 22.759999999999998 40-44 19.48 29.645 27.52 23.355 45-49 19.655 29.244999999999997 27.855 23.244999999999997 50-54 19.830000000000002 29.09 27.57 23.51 55-59 19.715 29.435 27.67 23.18 60-64 19.545 29.38 27.775 23.3 65-69 19.805 29.12 27.58 23.494999999999997 70-74 19.96 29.23 27.584999999999997 23.225 75-79 20.345 28.804999999999996 28.07 22.78 80-84 19.96 29.34 27.26 23.44 85-89 20.215 28.799999999999997 27.794999999999998 23.189999999999998 90-94 20.3 29.080000000000002 28.060000000000002 22.56 95-99 19.325966298314913 28.88144407220361 27.956397819890995 23.836191809590478 100-104 20.031001550077505 28.586429321466074 27.66638331916596 23.71618580929046 105-109 19.61 28.994999999999997 27.694999999999997 23.7 110-114 20.345 28.939999999999998 27.07 23.645 115-119 20.549999999999997 29.075 27.065 23.31 120-124 20.4 29.195 27.27 23.135 125-129 20.39 28.7 27.295 23.615 130-134 20.72 29.37 26.735 23.175 135-139 20.64 28.395 27.51 23.455000000000002 140-144 20.455000000000002 28.955 26.91 23.68 145-149 20.865000000000002 28.525 27.18 23.43 150 21.6 27.375 26.3 24.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.5 3 1.0 4 1.0 5 1.5 6 1.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 1.5 19 2.0 20 2.0 21 2.0 22 3.0 23 4.5 24 4.0 25 5.0 26 7.0 27 8.0 28 11.0 29 19.5 30 27.0 31 36.5 32 54.0 33 67.0 34 76.5 35 89.0 36 97.0 37 134.5 38 171.0 39 176.5 40 211.0 41 222.5 42 221.5 43 244.0 44 255.0 45 265.5 46 255.5 47 220.0 48 198.0 49 180.5 50 150.0 51 127.5 52 107.0 53 80.0 54 62.0 55 51.5 56 35.5 57 25.5 58 19.0 59 15.0 60 13.0 61 8.5 62 8.0 63 5.0 64 2.0 65 3.0 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1670873296315 98.225 2 0.7571933366986371 1.5 3 0.025239777889954566 0.075 4 0.05047955577990913 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.7999999999999998 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.5125 0.0 0.0 0.0 0.0 118-119 2.8 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.325 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.45 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.275 0.0 0.0 0.0 0.0 134-135 5.824999999999999 0.0 0.0 0.0 0.0 136-137 6.237500000000001 0.0 0.0 0.0 0.0 138 6.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGACTC 10 0.0069790767 143.96251 3 >>END_MODULE SRR7472089 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7472089_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1865 33.0 33.0 34.0 31.0 34.0 2 32.308 33.0 33.0 34.0 31.0 34.0 3 32.4085 33.0 33.0 34.0 31.0 34.0 4 32.29525 33.0 33.0 34.0 31.0 34.0 5 32.23725 33.0 33.0 34.0 31.0 34.0 6 36.47425 38.0 38.0 38.0 34.0 38.0 7 36.303 38.0 38.0 38.0 34.0 38.0 8 36.35425 38.0 38.0 38.0 34.0 38.0 9 36.48775 38.0 38.0 38.0 34.0 38.0 10-14 36.3703 38.0 38.0 38.0 34.0 38.0 15-19 36.195949999999996 38.0 37.8 38.0 33.0 38.0 20-24 36.2438 38.0 38.0 38.0 33.4 38.0 25-29 36.20895 38.0 37.8 38.0 33.2 38.0 30-34 36.0862 38.0 37.2 38.0 32.8 38.0 35-39 35.9148 38.0 37.0 38.0 32.2 38.0 40-44 35.792449999999995 38.0 37.0 38.0 30.8 38.0 45-49 35.65605 38.0 37.0 38.0 29.8 38.0 50-54 35.4692 38.0 36.8 38.0 29.0 38.0 55-59 35.4222 38.0 36.4 38.0 29.4 38.0 60-64 35.22725 38.0 36.2 38.0 28.4 38.0 65-69 35.12425 38.0 36.0 38.0 28.0 38.0 70-74 34.764300000000006 38.0 35.6 38.0 26.6 38.0 75-79 34.6189 38.0 35.2 38.0 26.2 38.0 80-84 34.4112 38.0 35.0 38.0 25.4 38.0 85-89 34.017999999999994 38.0 34.0 38.0 22.4 38.0 90-94 33.611450000000005 38.0 34.0 38.0 15.0 38.0 95-99 33.190999999999995 38.0 33.4 38.0 15.0 38.0 100-104 33.008750000000006 37.4 33.0 38.0 15.0 38.0 105-109 32.49065 37.0 31.6 38.0 15.0 38.0 110-114 31.921550000000003 37.0 30.2 38.0 15.0 38.0 115-119 31.414799999999996 36.6 28.4 38.0 15.0 38.0 120-124 30.573649999999997 35.8 26.8 38.0 14.6 38.0 125-129 29.6235 35.0 24.2 38.0 13.4 38.0 130-134 28.87405 34.8 22.6 38.0 8.6 38.0 135-139 27.858449999999998 34.4 18.6 38.0 2.0 38.0 140-144 26.3538 34.0 14.0 38.0 2.0 38.0 145-149 23.593 31.8 6.4 37.6 2.0 38.0 150 17.04975 2.0 2.0 34.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 2.0 4 3.0 5 1.0 6 5.0 7 6.0 8 2.0 9 3.0 10 2.0 11 5.0 12 6.0 13 8.0 14 8.0 15 8.0 16 8.0 17 28.0 18 27.0 19 16.0 20 25.0 21 29.0 22 29.0 23 39.0 24 39.0 25 46.0 26 61.0 27 84.0 28 82.0 29 123.0 30 148.0 31 160.0 32 222.0 33 308.0 34 418.0 35 625.0 36 847.0 37 566.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.625 19.175 13.25 21.95 2 25.7 23.125 32.300000000000004 18.875 3 21.5 25.3 33.525 19.675 4 24.15 34.9 21.575 19.375 5 23.525 37.45 21.25 17.775 6 18.6 37.4 23.0 21.0 7 16.55 16.85 43.775 22.825 8 20.7 21.85 26.700000000000003 30.75 9 22.425 23.425 27.950000000000003 26.200000000000003 10-14 22.31 28.985 26.919999999999998 21.785 15-19 22.84 28.605000000000004 27.865000000000002 20.69 20-24 23.669999999999998 27.675 28.000000000000004 20.655 25-29 22.975 28.43 27.694999999999997 20.9 30-34 23.115 27.71 28.255000000000003 20.919999999999998 35-39 23.1911595579779 28.63643182159108 27.461373068653433 20.71103555177759 40-44 23.09 27.865000000000002 28.494999999999997 20.549999999999997 45-49 22.82 28.425 27.99 20.765 50-54 23.150000000000002 27.76 28.62 20.47 55-59 23.085 27.85 28.9 20.165 60-64 22.795 28.4 28.095 20.71 65-69 22.5 28.560000000000002 27.639999999999997 21.3 70-74 22.895 28.744999999999997 28.310000000000002 20.05 75-79 23.82 28.294999999999998 27.91 19.975 80-84 23.305 28.645 27.439999999999998 20.61 85-89 23.825 28.549999999999997 27.42 20.205000000000002 90-94 23.31 28.89 27.68 20.119999999999997 95-99 23.48 28.365000000000002 27.839999999999996 20.315 100-104 23.625 27.800000000000004 27.97 20.605 105-109 23.79 27.935 28.075 20.200000000000003 110-114 23.775 28.815 27.060000000000002 20.349999999999998 115-119 23.799999999999997 28.499999999999996 27.705000000000002 19.994999999999997 120-124 23.66 27.939999999999998 28.13 20.27 125-129 23.875 28.000000000000004 28.015 20.11 130-134 23.965 27.88 27.71 20.445 135-139 24.46 28.465 27.35 19.725 140-144 24.075 28.82 27.26 19.845 145-149 24.195 28.715000000000003 27.33 19.759999999999998 150 24.25 28.725 26.924999999999997 20.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.0 25 1.0 26 2.5 27 6.5 28 9.0 29 11.5 30 15.0 31 24.5 32 30.5 33 36.0 34 47.5 35 62.0 36 91.5 37 113.0 38 147.0 39 186.0 40 211.0 41 217.5 42 234.0 43 277.5 44 282.5 45 273.0 46 274.5 47 256.5 48 232.0 49 203.5 50 164.0 51 130.0 52 103.0 53 91.0 54 76.0 55 48.5 56 36.0 57 31.0 58 19.5 59 14.0 60 10.5 61 7.5 62 6.0 63 5.5 64 3.5 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14011127971675 98.0 2 0.6828528072837633 1.35 3 0.10116337885685382 0.3 4 0.05058168942842691 0.2 5 0.0 0.0 6 0.025290844714213456 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.225 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.7875 0.0 0.0 0.0 0.0 132-133 4.05 0.0 0.0 0.0 0.0 134-135 4.4375 0.0 0.0 0.0 0.0 136-137 4.775 0.0 0.0 0.0 0.0 138 4.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264510 spots for SRR7472089.sra Written 1264510 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra Read 1264494 spots for SRR7472089.sra Written 1264494 spots for SRR7472089.sra SRR ids: ['SRR7472089.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x5x7wys1 SRR7472089.sra spots: 25289896 blocks: [[1, 1264494], [1264495, 2528988], [2528989, 3793482], [3793483, 5057976], [5057977, 6322470], [6322471, 7586964], [7586965, 8851458], [8851459, 10115952], [10115953, 11380446], [11380447, 12644940], [12644941, 13909434], [13909435, 15173928], [15173929, 16438422], [16438423, 17702916], [17702917, 18967410], [18967411, 20231904], [20231905, 21496398], [21496399, 22760892], [22760893, 24025386], [24025387, 25289896]] SRR7472089 file size 8498821 SRR7472089 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7472089 SRR7472089_1.fastq SRR7472089_2.fastq Input file: SRR7472089_1.fastq Paired file: SRR7472089_2.fastq trimmed: SRR7472089-trimmed-pair1.fastq, SRR7472089-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:02:17 2025 >> started Thu Feb 13 18:02:47 2025 >> done (30.166s) 25289896 read pairs processed; of these: 33209 ( 0.13%) short read pairs filtered out after trimming by size control 64678 ( 0.26%) empty read pairs filtered out after trimming by size control 25192009 (99.61%) read pairs available; of these: 9982840 (39.63%) trimmed read pairs available after processing 15209169 (60.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 12 0.00% 20 11 0.00% 21 15 0.00% 22 17 0.00% 23 24 0.00% 24 29 0.00% 25 31 0.00% 26 28 0.00% 27 26 0.00% 28 28 0.00% 29 25 0.00% 30 32 0.00% 31 24 0.00% 32 27 0.00% 33 40 0.00% 34 46 0.00% 35 35 0.00% 36 36 0.00% 37 70 0.00% 38 30 0.00% 39 62 0.00% 40 51 0.00% 41 51 0.00% 42 61 0.00% 43 63 0.00% 44 98 0.00% 45 75 0.00% 46 94 0.00% 47 118 0.00% 48 123 0.00% 49 135 0.00% 50 150 0.00% 51 152 0.00% 52 210 0.00% 53 194 0.00% 54 211 0.00% 55 227 0.00% 56 269 0.00% 57 247 0.00% 58 285 0.00% 59 400 0.00% 60 378 0.00% 61 453 0.00% 62 414 0.00% 63 533 0.00% 64 614 0.00% 65 906 0.00% 66 885 0.00% 67 1002 0.00% 68 1442 0.01% 69 4417 0.02% 70 3793 0.02% 71 1803 0.01% 72 1607 0.01% 73 1718 0.01% 74 1901 0.01% 75 2146 0.01% 76 2322 0.01% 77 2540 0.01% 78 2946 0.01% 79 3088 0.01% 80 3538 0.01% 81 4179 0.02% 82 4690 0.02% 83 5603 0.02% 84 8032 0.03% 85 9058 0.04% 86 10526 0.04% 87 11983 0.05% 88 12424 0.05% 89 13128 0.05% 90 13904 0.06% 91 14550 0.06% 92 15381 0.06% 93 15794 0.06% 94 16238 0.06% 95 17391 0.07% 96 18183 0.07% 97 18656 0.07% 98 19714 0.08% 99 20662 0.08% 100 21909 0.09% 101 23464 0.09% 102 25161 0.10% 103 26764 0.11% 104 28043 0.11% 105 29650 0.12% 106 31055 0.12% 107 31101 0.12% 108 32241 0.13% 109 33411 0.13% 110 35333 0.14% 111 37758 0.15% 112 39452 0.16% 113 42090 0.17% 114 43680 0.17% 115 45396 0.18% 116 46546 0.18% 117 47987 0.19% 118 48567 0.19% 119 50313 0.20% 120 52328 0.21% 121 54923 0.22% 122 56235 0.22% 123 60425 0.24% 124 63211 0.25% 125 65424 0.26% 126 67405 0.27% 127 69692 0.28% 128 71797 0.28% 129 74796 0.30% 130 77299 0.31% 131 81170 0.32% 132 86417 0.34% 133 90674 0.36% 134 96206 0.38% 135 101211 0.40% 136 105410 0.42% 137 111619 0.44% 138 118520 0.47% 139 124329 0.49% 140 133217 0.53% 141 147767 0.59% 142 160146 0.64% 143 179818 0.71% 144 209701 0.83% 145 248476 0.99% 146 321518 1.28% 147 459788 1.83% 148 841072 3.34% 149 4639904 18.42% 150 15209169 60.37% 25192009 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=28 prefix-density=0.46 prefix-fanout=2.1 sequence=CGACACCATCAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=42.56 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=12.3 sequence=CCTTCCTTGTCCTGGATCTT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=4.36 fanout-score-rank=16 prefix-density=0.64 prefix-fanout=2.8 sequence=ATGATGGTGTCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=28.41 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.4 sequence=GAAGGATCTGTTTAATTTGAGACAGAAAACATGAAATCCTCCTACACTTTCTTCATTCTTTTCTCACTCTTTTCGTTTGCTAACGTGATCGGTGCTAGAAAAGACACTGGAGAGTATTGGAGAGCTGTCATGAAAGATCAGCCCATGCCAGAAGCAATACATGGCC SRR7472089 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:03:31 Started mapping on | Feb 13 18:03:32 Finished on | Feb 13 18:07:31 Mapping speed, Million of reads per hour | 379.46 Number of input reads | 25192009 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 23222635 Uniquely mapped reads % | 92.18% Average mapped length | 292.27 Number of splices: Total | 20296725 Number of splices: Annotated (sjdb) | 19905719 Number of splices: GT/AG | 19991953 Number of splices: GC/AG | 246385 Number of splices: AT/AC | 18052 Number of splices: Non-canonical | 40335 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 539006 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 99169 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.19% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1481224 1481224 1481224 N_multimapping 539006 539006 539006 N_noFeature 745804 22945813 866155 N_ambiguous 297142 2080 139330 UnstrandedReadsAssigned:22179689 PositiveStrandReadsAssigned:274742 NegativeStrandReadsAssigned:22217150 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR7472089 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7472089-trimmed-pair1.fastq SRR7472089-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,192,009 reads, 22,336,380 reads pseudoaligned [quant] estimated average fragment length: 241.77 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR7472089.ke.tsv 34699 SRR7472089.se.tsv 87100 total ==> SRR7472089.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.23 1794 33.705 Potri.005G024800.1.v4.1 1035 794.23 1822 76.598 Potri.004G059700.1.v4.1 961 720.263 33 1.52981 Potri.007G009000.2.v4.1 1416 1175.23 0 0 Potri.003G141000.2.v4.1 2943 2702.23 585 7.22851 Potri.016G087400.1.v4.1 270 80.5616 1544 639.934 Potri.015G069301.1.v4.1 564 327.412 0 0 Potri.010G195200.1.v4.1 1773 1532.23 394 8.58593 Potri.012G127500.1.v4.1 977 736.24 29373 1332.12 ==> SRR7472089.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 282 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1020 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 247 SRR7472089 completed mapping pipeline successfully