Starting /dee2/code/volunteer_pipeline.sh SRR7472090 current disk space = 3088311418880 free memory = 1447755748 SRR7472090 SRAfilesize 22909f2de5585d3225672f4235622833 SRR7472090.sra SRR7472090.sra file validated SRR7472090 is paired end SRR7472090 is conventional basespace SRR7472090 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7472090_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.11875 34.0 34.0 34.0 33.0 34.0 2 33.491 34.0 34.0 34.0 33.0 34.0 3 33.5245 34.0 34.0 34.0 33.0 34.0 4 33.5645 34.0 34.0 34.0 33.0 34.0 5 33.58675 34.0 34.0 34.0 33.0 34.0 6 37.44325 38.0 38.0 38.0 37.0 38.0 7 37.56975 38.0 38.0 38.0 37.0 38.0 8 37.577 38.0 38.0 38.0 38.0 38.0 9 37.599 38.0 38.0 38.0 38.0 38.0 10-14 37.61435 38.0 38.0 38.0 38.0 38.0 15-19 37.6081 38.0 38.0 38.0 37.8 38.0 20-24 37.62305 38.0 38.0 38.0 38.0 38.0 25-29 37.636399999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.591 38.0 38.0 38.0 38.0 38.0 35-39 37.58535 38.0 38.0 38.0 38.0 38.0 40-44 37.538650000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.53075 38.0 38.0 38.0 38.0 38.0 50-54 37.53335 38.0 38.0 38.0 38.0 38.0 55-59 37.48895 38.0 38.0 38.0 38.0 38.0 60-64 37.460699999999996 38.0 38.0 38.0 38.0 38.0 65-69 37.45005 38.0 38.0 38.0 37.8 38.0 70-74 37.42815 38.0 38.0 38.0 37.8 38.0 75-79 37.310500000000005 38.0 38.0 38.0 37.2 38.0 80-84 37.342 38.0 38.0 38.0 37.2 38.0 85-89 37.2917 38.0 38.0 38.0 37.2 38.0 90-94 37.16795 38.0 38.0 38.0 36.8 38.0 95-99 36.944449999999996 38.0 38.0 38.0 36.2 38.0 100-104 37.03725000000001 38.0 38.0 38.0 36.4 38.0 105-109 37.072950000000006 38.0 38.0 38.0 36.4 38.0 110-114 37.0597 38.0 38.0 38.0 36.2 38.0 115-119 37.0063 38.0 38.0 38.0 36.0 38.0 120-124 36.945 38.0 38.0 38.0 36.0 38.0 125-129 36.922 38.0 38.0 38.0 35.8 38.0 130-134 36.73725 38.0 38.0 38.0 35.0 38.0 135-139 36.58389999999999 38.0 38.0 38.0 35.0 38.0 140-144 36.4741 38.0 38.0 38.0 34.8 38.0 145-149 36.2186 38.0 38.0 38.0 34.6 38.0 150 31.45275 36.0 31.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 1.0 18 1.0 19 8.0 20 2.0 21 2.0 22 2.0 23 4.0 24 5.0 25 6.0 26 7.0 27 11.0 28 19.0 29 21.0 30 21.0 31 29.0 32 24.0 33 51.0 34 73.0 35 87.0 36 269.0 37 3355.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.596500126807 20.035505959928987 11.818412376363176 31.54958153690084 2 20.05 27.1 37.15 15.7 3 16.179044761190298 33.58339584896224 27.45686421605401 22.780695173793447 4 20.525 37.375 22.775000000000002 19.325 5 20.424999999999997 37.7 23.125 18.75 6 15.35 36.65 24.5 23.5 7 14.05 19.6 45.875 20.474999999999998 8 17.224999999999998 21.525 28.65 32.6 9 17.875 20.275000000000002 32.324999999999996 29.525000000000002 10-14 19.115 30.654999999999998 26.674999999999997 23.555 15-19 20.474999999999998 28.310000000000002 28.410000000000004 22.805 20-24 20.150000000000002 29.125 27.810000000000002 22.915 25-29 20.73 29.21 26.974999999999998 23.085 30-34 20.105 29.815 27.485 22.595000000000002 35-39 20.150000000000002 29.825000000000003 27.41 22.615 40-44 20.47 29.69 27.189999999999998 22.650000000000002 45-49 20.86 29.115000000000002 27.49 22.535 50-54 20.535 28.835 27.48 23.150000000000002 55-59 20.155 29.2 27.495000000000005 23.150000000000002 60-64 20.09 28.51 28.155 23.244999999999997 65-69 20.215 28.9 27.565 23.32 70-74 20.39 28.935 27.439999999999998 23.235 75-79 20.095 28.99 27.860000000000003 23.055 80-84 20.015 28.63 27.845 23.51 85-89 20.810000000000002 28.535 28.02 22.634999999999998 90-94 20.76 28.415000000000003 28.34 22.485 95-99 20.825 28.925 27.415 22.835 100-104 21.37 28.144999999999996 27.665 22.82 105-109 21.215 28.83 26.91 23.044999999999998 110-114 21.125 28.660000000000004 27.900000000000002 22.314999999999998 115-119 21.215 28.38 27.11 23.294999999999998 120-124 21.67 28.904999999999998 26.61 22.814999999999998 125-129 21.115000000000002 28.835 26.39 23.66 130-134 21.875 29.075 25.7 23.35 135-139 21.665 28.754999999999995 25.825 23.755000000000003 140-144 21.475 28.9 26.33 23.294999999999998 145-149 22.16 28.32 25.419999999999998 24.099999999999998 150 21.0 29.799999999999997 25.025 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.5 20 0.5 21 1.5 22 3.5 23 2.5 24 2.0 25 2.5 26 8.0 27 11.5 28 11.5 29 19.0 30 36.5 31 46.5 32 55.0 33 70.0 34 89.5 35 126.0 36 134.0 37 137.0 38 160.0 39 163.0 40 182.0 41 202.5 42 198.0 43 216.0 44 221.0 45 223.5 46 238.0 47 222.0 48 208.5 49 193.5 50 158.0 51 135.0 52 119.5 53 90.5 54 77.5 55 61.5 56 40.5 57 33.5 58 27.0 59 20.5 60 14.0 61 11.0 62 8.0 63 4.5 64 3.0 65 2.0 66 1.0 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.1 #Duplication Level Percentage of deduplicated Percentage of total 1 97.88877445932029 95.05 2 1.596292481977343 3.1 3 0.30895983522142123 0.8999999999999999 4 0.12873326467559218 0.5 5 0.051493305870236865 0.25 6 0.0 0.0 7 0.0 0.0 8 0.025746652935118432 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTG 8 0.2 No Hit CTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATAT 5 0.125 No Hit GGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.7749999999999999 0.0 0.0 0.0 0.0 92-93 1.0 0.0 0.0 0.0 0.0 94-95 1.2 0.0 0.0 0.0 0.0 96-97 1.525 0.0 0.0 0.0 0.0 98-99 1.7625 0.0 0.0 0.0 0.0 100-101 2.075 0.0 0.0 0.0 0.0 102-103 2.5250000000000004 0.0 0.0 0.0 0.0 104-105 3.0125 0.0 0.0 0.0 0.0 106-107 3.4124999999999996 0.0 0.0 0.0 0.0 108-109 3.8375 0.0 0.0 0.0 0.0 110-111 4.25 0.0 0.0 0.0 0.0 112-113 4.9875 0.0 0.0 0.0 0.0 114-115 5.65 0.0 0.0 0.0 0.0 116-117 6.3625 0.0 0.0 0.0 0.0 118-119 7.025 0.0 0.0 0.0 0.0 120-121 7.7125 0.0 0.0 0.0 0.0 122-123 8.5375 0.0 0.0 0.0 0.0 124-125 9.350000000000001 0.0 0.0 0.0 0.0 126-127 10.2 0.0 0.0 0.0 0.0 128-129 11.125 0.0 0.0 0.0 0.0 130-131 12.0625 0.0 0.0 0.0 0.0 132-133 13.1125 0.0 0.0 0.0 0.0 134-135 14.3375 0.0 0.0 0.0 0.0 136-137 15.375 0.0 0.0 0.0 0.0 138 16.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGGAT 10 0.006973645 144.0 9 >>END_MODULE SRR7472090 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7472090_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.689 33.0 33.0 34.0 32.0 34.0 2 32.76175 33.0 33.0 34.0 32.0 34.0 3 32.79875 33.0 33.0 34.0 32.0 34.0 4 32.75525 34.0 33.0 34.0 32.0 34.0 5 32.67775 33.0 33.0 34.0 32.0 34.0 6 36.951 38.0 38.0 38.0 36.0 38.0 7 37.048 38.0 38.0 38.0 36.0 38.0 8 36.99 38.0 38.0 38.0 36.0 38.0 9 36.90475 38.0 38.0 38.0 36.0 38.0 10-14 36.93495 38.0 38.0 38.0 36.0 38.0 15-19 36.838150000000006 38.0 38.0 38.0 36.0 38.0 20-24 36.75150000000001 38.0 38.0 38.0 36.0 38.0 25-29 36.6993 38.0 38.0 38.0 36.0 38.0 30-34 36.66405 38.0 38.0 38.0 35.6 38.0 35-39 36.5906 38.0 38.0 38.0 35.0 38.0 40-44 36.50315 38.0 38.0 38.0 34.4 38.0 45-49 36.45805 38.0 38.0 38.0 34.2 38.0 50-54 36.226299999999995 38.0 38.0 38.0 34.0 38.0 55-59 36.21065 38.0 38.0 38.0 33.8 38.0 60-64 36.024150000000006 38.0 37.6 38.0 33.0 38.0 65-69 35.87565 38.0 37.0 38.0 32.4 38.0 70-74 35.736000000000004 38.0 37.0 38.0 31.2 38.0 75-79 35.50404999999999 38.0 37.0 38.0 29.8 38.0 80-84 35.1995 38.0 36.6 38.0 29.0 38.0 85-89 34.9388 38.0 35.8 38.0 27.6 38.0 90-94 34.68235 38.0 35.8 38.0 26.4 38.0 95-99 34.33425 38.0 35.0 38.0 25.0 38.0 100-104 33.8883 38.0 34.2 38.0 19.8 38.0 105-109 33.50965 38.0 34.0 38.0 15.0 38.0 110-114 32.91180000000001 38.0 33.2 38.0 15.0 38.0 115-119 32.21285 37.0 31.6 38.0 15.0 38.0 120-124 31.553449999999998 36.8 30.0 38.0 14.6 38.0 125-129 30.185450000000003 35.6 26.6 38.0 13.0 38.0 130-134 29.486700000000003 35.2 23.8 38.0 6.4 38.0 135-139 28.03675 34.4 20.2 38.0 2.0 38.0 140-144 26.097999999999995 33.8 14.0 38.0 2.0 38.0 145-149 23.686100000000003 31.6 6.4 38.0 2.0 38.0 150 17.30275 15.0 2.0 33.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 4.0 4 3.0 5 1.0 6 1.0 7 3.0 8 2.0 9 3.0 10 1.0 11 6.0 12 5.0 13 7.0 14 5.0 15 6.0 16 14.0 17 10.0 18 13.0 19 21.0 20 20.0 21 23.0 22 18.0 23 25.0 24 30.0 25 37.0 26 51.0 27 58.0 28 58.0 29 80.0 30 110.0 31 137.0 32 184.0 33 284.0 34 396.0 35 614.0 36 990.0 37 761.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.0 16.25 12.875 31.874999999999996 2 22.62113984433844 23.022847100175746 35.97790610092895 18.378106954556866 3 19.72361809045226 24.49748743718593 33.31658291457286 22.462311557788944 4 23.492462311557787 35.27638190954774 21.4321608040201 19.798994974874372 5 22.939698492462313 37.41206030150754 21.758793969849247 17.889447236180906 6 17.775546070800903 37.05749435099172 23.801154908360534 21.36580466984685 7 16.89681144865679 15.767009791614361 46.19633442129049 21.139844338438362 8 20.08536279186543 22.119005774541804 27.592267135325134 30.203364298267637 9 20.68792367562139 24.629676123524984 27.44162691438614 27.240773286467483 10-14 22.75121657552802 28.75633371795515 26.52385491396177 21.96859479255506 15-19 22.90673757086239 27.487081723774644 28.179400993327647 21.42677971203532 20-24 22.961179656936505 27.89647908516401 27.58551509680008 21.55682616109941 25-29 22.99237100983738 28.372816703473198 27.53965067255571 21.09516161413371 30-34 22.909766134698383 28.063836193917496 28.279634648198332 20.74676302318579 35-39 23.068427129876 27.255384306441087 28.450223404789398 21.22596515889352 40-44 23.088117221999198 27.644520272982735 28.56784423926134 20.699518265756726 45-49 22.619346418352492 27.22252898950856 28.74855679935746 21.409567792781488 50-54 22.77242624924744 27.955047160345174 28.27613887216536 20.996387718242023 55-59 22.955753988160932 28.398715762014646 27.82682853416274 20.818701715661682 60-64 22.686881871579896 28.309654099101362 28.515487725287414 20.487976304031328 65-69 22.96998895914885 27.878149151861887 28.14915186188899 21.00271002710027 70-74 22.410593369112703 28.003210111852333 28.233936901238906 21.352259617796058 75-79 22.746888799678842 28.14632677639502 28.51766358892011 20.58912083500602 80-84 23.239365971107546 28.53631621187801 27.568218298555376 20.65609951845907 85-89 22.98273785628262 28.21156162183862 28.35206744279406 20.453633079084703 90-94 23.53856189472628 27.979326609463595 28.11480756686236 20.367303928947763 95-99 23.30389401846648 27.679646728221595 28.35206744279406 20.664391810517866 100-104 23.381836427496236 28.058203712995482 27.94279979929754 20.617160060210736 105-109 23.561863684236922 28.150860123376297 28.56712974572446 19.72014644666232 110-114 23.443848121582985 28.775643276320412 27.767467522696492 20.01304107940011 115-119 23.97552289712595 28.499774289010382 27.4665195365401 20.058183277323568 120-124 24.592466268746552 28.625169283242215 26.899734162612226 19.882630285399006 125-129 24.548192771084338 28.56425702811245 26.947791164658636 19.93975903614458 130-134 24.78426650612081 28.321292394140073 27.643989564519366 19.25045153521975 135-139 25.19688989214949 29.280160521695507 26.230248306997744 19.292701279157264 140-144 26.318430428019468 29.369260876110193 25.726328466054493 18.585980229815846 145-149 26.548628178763106 28.660279881627126 25.96177960575814 18.829312333851632 150 27.35707121364092 29.438314944834502 24.473420260782348 18.73119358074223 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 6.0 2 5.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 1.5 19 1.0 20 1.0 21 1.0 22 1.0 23 1.5 24 2.5 25 2.5 26 3.5 27 7.5 28 10.5 29 13.0 30 21.5 31 35.5 32 41.0 33 51.5 34 72.5 35 78.0 36 88.0 37 126.5 38 164.0 39 186.0 40 197.5 41 203.0 42 203.5 43 211.5 44 232.0 45 240.0 46 237.0 47 229.5 48 214.5 49 196.5 50 177.5 51 149.5 52 113.0 53 102.0 54 94.5 55 60.5 56 44.0 57 41.5 58 34.0 59 28.5 60 18.0 61 11.0 62 10.0 63 6.5 64 5.0 65 4.0 66 2.5 67 2.5 68 1.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.5 4 0.5 5 0.5 6 0.42500000000000004 7 0.42500000000000004 8 0.42500000000000004 9 0.42500000000000004 10-14 0.335 15-19 0.335 20-24 0.31 25-29 0.38 30-34 0.37 35-39 0.40499999999999997 40-44 0.36 45-49 0.395 50-54 0.33999999999999997 55-59 0.33 60-64 0.40499999999999997 65-69 0.37 70-74 0.315 75-79 0.36 80-84 0.32 85-89 0.36 90-94 0.35500000000000004 95-99 0.36 100-104 0.35000000000000003 105-109 0.305 110-114 0.315 115-119 0.315 120-124 0.315 125-129 0.4 130-134 0.33999999999999997 135-139 0.325 140-144 0.35500000000000004 145-149 0.315 150 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.30028328611898 95.42500000000001 2 1.1846510430079835 2.3 3 0.3090394025238218 0.8999999999999999 4 0.02575328354365182 0.1 5 0.0 0.0 6 0.05150656708730364 0.3 7 0.05150656708730364 0.35000000000000003 8 0.05150656708730364 0.4 9 0.02575328354365182 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTCCTCCTATGGTTTTCAAAACAATCACCATCATGCTATTAATGATAT 9 0.22499999999999998 No Hit GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit CTCTCATTGGTTTATACTTCAATATAAGCCTTGGTAGGGATAGATAGCCA 8 0.2 No Hit CTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCT 7 0.17500000000000002 No Hit GGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTTTTCAAAACAATCAC 7 0.17500000000000002 No Hit CCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGT 6 0.15 No Hit GTTGGTTTATGCTCATCCCTACTCATAACCCCAGCACTTAGATATTTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.5375 0.0 0.0 0.0 0.0 100-101 1.8 0.0 0.0 0.0 0.0 102-103 2.1500000000000004 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 2.925 0.0 0.0 0.0 0.0 108-109 3.2625 0.0 0.0 0.0 0.0 110-111 3.6125 0.0 0.0 0.0 0.0 112-113 4.300000000000001 0.0 0.0 0.0 0.0 114-115 4.9 0.0 0.0 0.0 0.0 116-117 5.5625 0.0 0.0 0.0 0.0 118-119 6.050000000000001 0.0 0.0 0.0 0.0 120-121 6.550000000000001 0.0 0.0 0.0 0.0 122-123 7.225 0.0 0.0 0.0 0.0 124-125 7.925 0.0 0.0 0.0 0.0 126-127 8.6375 0.0 0.0 0.0 0.0 128-129 9.45 0.0 0.0 0.0 0.0 130-131 10.1625 0.0 0.0 0.0 0.0 132-133 10.9875 0.0 0.0 0.0 0.0 134-135 12.0125 0.0 0.0 0.0 0.0 136-137 12.850000000000001 0.0 0.0 0.0 0.0 138 13.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769433 spots for SRR7472090.sra Written 769433 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra Read 769422 spots for SRR7472090.sra Written 769422 spots for SRR7472090.sra SRR ids: ['SRR7472090.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ohfh8nlg SRR7472090.sra spots: 15388451 blocks: [[1, 769422], [769423, 1538844], [1538845, 2308266], [2308267, 3077688], [3077689, 3847110], [3847111, 4616532], [4616533, 5385954], [5385955, 6155376], [6155377, 6924798], [6924799, 7694220], [7694221, 8463642], [8463643, 9233064], [9233065, 10002486], [10002487, 10771908], [10771909, 11541330], [11541331, 12310752], [12310753, 13080174], [13080175, 13849596], [13849597, 14619018], [14619019, 15388451]] SRR7472090 file size 5162885 SRR7472090 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7472090 SRR7472090_1.fastq SRR7472090_2.fastq Input file: SRR7472090_1.fastq Paired file: SRR7472090_2.fastq trimmed: SRR7472090-trimmed-pair1.fastq, SRR7472090-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:16:06 2025 >> started Thu Feb 13 18:16:25 2025 >> done (18.839s) 15388451 read pairs processed; of these: 10287 ( 0.07%) short read pairs filtered out after trimming by size control 64407 ( 0.42%) empty read pairs filtered out after trimming by size control 15313757 (99.51%) read pairs available; of these: 7131908 (46.57%) trimmed read pairs available after processing 8181849 (53.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 4 0.00% 21 3 0.00% 22 7 0.00% 23 4 0.00% 24 7 0.00% 25 10 0.00% 26 11 0.00% 27 9 0.00% 28 10 0.00% 29 6 0.00% 30 10 0.00% 31 15 0.00% 32 13 0.00% 33 17 0.00% 34 16 0.00% 35 9 0.00% 36 16 0.00% 37 22 0.00% 38 27 0.00% 39 37 0.00% 40 41 0.00% 41 44 0.00% 42 41 0.00% 43 41 0.00% 44 65 0.00% 45 57 0.00% 46 73 0.00% 47 89 0.00% 48 119 0.00% 49 130 0.00% 50 119 0.00% 51 159 0.00% 52 168 0.00% 53 177 0.00% 54 198 0.00% 55 198 0.00% 56 252 0.00% 57 278 0.00% 58 329 0.00% 59 347 0.00% 60 449 0.00% 61 518 0.00% 62 562 0.00% 63 680 0.00% 64 708 0.00% 65 835 0.01% 66 965 0.01% 67 1082 0.01% 68 1516 0.01% 69 4140 0.03% 70 4082 0.03% 71 2226 0.01% 72 2329 0.02% 73 2323 0.02% 74 2535 0.02% 75 2995 0.02% 76 3146 0.02% 77 3581 0.02% 78 3965 0.03% 79 4480 0.03% 80 5044 0.03% 81 5783 0.04% 82 6839 0.04% 83 7351 0.05% 84 8888 0.06% 85 9684 0.06% 86 10566 0.07% 87 11674 0.08% 88 12392 0.08% 89 13398 0.09% 90 14544 0.09% 91 15806 0.10% 92 17705 0.12% 93 18940 0.12% 94 20686 0.14% 95 21908 0.14% 96 23402 0.15% 97 24568 0.16% 98 26502 0.17% 99 27799 0.18% 100 29590 0.19% 101 31235 0.20% 102 33437 0.22% 103 35277 0.23% 104 37209 0.24% 105 39897 0.26% 106 42084 0.27% 107 43637 0.28% 108 45672 0.30% 109 46436 0.30% 110 47526 0.31% 111 50680 0.33% 112 53308 0.35% 113 57367 0.37% 114 56811 0.37% 115 60508 0.40% 116 62478 0.41% 117 63451 0.41% 118 66039 0.43% 119 66590 0.43% 120 68856 0.45% 121 71868 0.47% 122 74425 0.49% 123 77436 0.51% 124 78811 0.51% 125 81889 0.53% 126 84613 0.55% 127 84551 0.55% 128 86059 0.56% 129 90228 0.59% 130 92562 0.60% 131 94167 0.61% 132 97279 0.64% 133 100625 0.66% 134 103111 0.67% 135 103523 0.68% 136 108070 0.71% 137 109912 0.72% 138 114951 0.75% 139 118133 0.77% 140 121476 0.79% 141 126570 0.83% 142 134080 0.88% 143 139253 0.91% 144 152652 1.00% 145 167815 1.10% 146 195614 1.28% 147 251894 1.64% 148 413664 2.70% 149 2268805 14.82% 150 8181849 53.43% 15313757 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=44 prefix-density=0.17 prefix-fanout=2.0 sequence=AACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCTGTGCAGGGGTGCGGTTAACT criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=24.51 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=9.0 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.17 sequence-density-rank=2 fanout-score=9.73 fanout-score-rank=7 prefix-density=0.48 prefix-fanout=3.5 sequence=AACAACAACGCCTGGGCATATGCCACAAACTTCGTTCCCGGAAAGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=39.09 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=1.2 sequence=TTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGA SRR7472090 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:17:18 Started mapping on | Feb 13 18:17:18 Finished on | Feb 13 18:22:29 Mapping speed, Million of reads per hour | 177.27 Number of input reads | 15313757 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 12791099 Uniquely mapped reads % | 83.53% Average mapped length | 285.99 Number of splices: Total | 10836867 Number of splices: Annotated (sjdb) | 10660442 Number of splices: GT/AG | 10614724 Number of splices: GC/AG | 185035 Number of splices: AT/AC | 8430 Number of splices: Non-canonical | 28678 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.04 Insertion rate per base | 0.02% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306902 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 34203 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.19% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2222428 2222428 2222428 N_multimapping 306902 306902 306902 N_noFeature 412788 12613945 488655 N_ambiguous 172173 619 70507 UnstrandedReadsAssigned:12206138 PositiveStrandReadsAssigned:176535 NegativeStrandReadsAssigned:12231937 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR7472090 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7472090-trimmed-pair1.fastq SRR7472090-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,313,757 reads, 12,416,247 reads pseudoaligned [quant] estimated average fragment length: 182.91 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,065 rounds 52401 SRR7472090.ke.tsv 34699 SRR7472090.se.tsv 87100 total ==> SRR7472090.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1836.09 359 15.835 Potri.005G024800.1.v4.1 1035 853.09 241 22.8791 Potri.004G059700.1.v4.1 961 779.096 5 0.519752 Potri.007G009000.2.v4.1 1416 1234.09 1 0.065625 Potri.003G141000.2.v4.1 2943 2761.09 320 9.38611 Potri.016G087400.1.v4.1 270 99.6863 546 443.582 Potri.015G069301.1.v4.1 564 382.257 0 0 Potri.010G195200.1.v4.1 1773 1591.09 10 0.509004 Potri.012G127500.1.v4.1 977 795.09 2046 208.404 ==> SRR7472090.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 147 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 233 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 202 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 4 SRR7472090 completed mapping pipeline successfully