Starting /dee2/code/volunteer_pipeline.sh SRR7495378 current disk space = 3057893953536 free memory = 1484259372 SRR7495378 SRAfilesize 66718f262dbc45a7eb86f49e3c3663e7 SRR7495378.sra SRR7495378.sra file validated SRR7495378 is paired end SRR7495378 is conventional basespace SRR7495378 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495378_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.78725 28.0 18.0 32.0 18.0 33.0 2 23.152 18.0 18.0 28.0 18.0 33.0 3 24.63675 27.0 18.0 29.0 18.0 31.0 4 27.42375 30.0 25.0 32.0 15.0 33.0 5 31.93625 32.0 32.0 33.0 32.0 33.0 6 35.3055 37.0 34.0 38.0 31.0 38.0 7 36.8245 38.0 37.0 38.0 35.0 38.0 8 36.83425 38.0 37.0 38.0 34.0 38.0 9 37.30725 38.0 38.0 38.0 36.0 38.0 10-14 37.5165 38.0 38.0 38.0 36.8 38.0 15-19 37.577000000000005 38.0 38.0 38.0 37.4 38.0 20-24 37.63635000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.650099999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.59930000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.60335 38.0 38.0 38.0 38.0 38.0 40-44 37.5789 38.0 38.0 38.0 38.0 38.0 45-49 37.5231 38.0 38.0 38.0 38.0 38.0 50-54 37.45825000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.43675 38.0 38.0 38.0 37.0 38.0 60-64 37.4087 38.0 38.0 38.0 37.0 38.0 65-69 37.313 38.0 38.0 38.0 37.0 38.0 70-74 37.31415 38.0 38.0 38.0 36.6 38.0 75-79 37.2395 38.0 38.0 38.0 36.4 38.0 80-84 37.21665 38.0 38.0 38.0 36.2 38.0 85-89 37.097249999999995 38.0 38.0 38.0 36.0 38.0 90-94 37.0504 38.0 38.0 38.0 36.0 38.0 95-99 36.9841 38.0 38.0 38.0 35.8 38.0 100-104 36.926449999999996 38.0 38.0 38.0 35.4 38.0 105-109 36.84695000000001 38.0 38.0 38.0 35.4 38.0 110-114 36.8149 38.0 38.0 38.0 35.0 38.0 115-119 36.6731 38.0 38.0 38.0 34.6 38.0 120-124 36.57595 38.0 38.0 38.0 34.2 38.0 125-129 36.3836 38.0 38.0 38.0 34.0 38.0 130-134 36.2195 38.0 37.4 38.0 33.6 38.0 135-139 36.09505 38.0 36.8 38.0 33.0 38.0 140-144 35.8941 38.0 36.0 38.0 33.0 38.0 145-149 35.553549999999994 38.0 36.0 38.0 32.0 38.0 150-151 32.719875 36.5 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 2.0 17 1.0 18 1.0 19 2.0 20 1.0 21 3.0 22 2.0 23 4.0 24 7.0 25 4.0 26 6.0 27 8.0 28 9.0 29 14.0 30 27.0 31 23.0 32 45.0 33 53.0 34 117.0 35 254.0 36 899.0 37 2515.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 57.28947368421052 11.973684210526315 6.447368421052632 24.289473684210527 2 25.324999999999996 11.075 33.575 30.025000000000002 3 18.7 17.5 27.325 36.475 4 22.7 22.775000000000002 25.025 29.5 5 23.325000000000003 28.1 23.65 24.925 6 22.075 32.574999999999996 25.424999999999997 19.925 7 16.575 28.449999999999996 38.324999999999996 16.650000000000002 8 17.825 28.375 30.45 23.35 9 17.25 26.724999999999998 33.324999999999996 22.7 10-14 20.09 30.695 26.939999999999998 22.275 15-19 20.25 29.24 26.82 23.69 20-24 19.855 28.994999999999997 27.55 23.599999999999998 25-29 20.34 28.74 27.779999999999998 23.14 30-34 19.74 29.395 27.3 23.565 35-39 19.33 29.020000000000003 27.245 24.404999999999998 40-44 20.085 28.925 27.060000000000002 23.93 45-49 19.939999999999998 28.7 26.93 24.43 50-54 20.155 28.744999999999997 27.395000000000003 23.705000000000002 55-59 20.044999999999998 28.83 27.765 23.36 60-64 20.330000000000002 28.9 27.279999999999998 23.49 65-69 19.785 28.89 27.345000000000002 23.98 70-74 20.41 28.04 27.22 24.33 75-79 19.735 28.449999999999996 27.515 24.3 80-84 19.91 28.720000000000002 27.355 24.015 85-89 19.68 28.560000000000002 27.644999999999996 24.115000000000002 90-94 20.925 28.439999999999998 27.29 23.345 95-99 20.565 27.76 28.125 23.549999999999997 100-104 20.53 28.38 27.345000000000002 23.745 105-109 20.474999999999998 27.950000000000003 27.99 23.585 110-114 20.205000000000002 28.23 27.42 24.145 115-119 21.365000000000002 27.395000000000003 27.07 24.169999999999998 120-124 20.885 28.235 26.855 24.025 125-129 20.560000000000002 27.67 27.189999999999998 24.58 130-134 21.255 28.199999999999996 27.125 23.419999999999998 135-139 20.665 27.55 27.334999999999997 24.45 140-144 20.995 27.35 27.375 24.279999999999998 145-149 20.755000000000003 27.955000000000002 27.689999999999998 23.599999999999998 150-151 21.05 28.1375 26.337500000000002 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 2.0 23 3.0 24 3.5 25 3.0 26 5.5 27 8.5 28 11.0 29 15.0 30 17.5 31 25.5 32 36.5 33 41.5 34 54.0 35 77.0 36 92.5 37 101.5 38 112.5 39 141.5 40 165.5 41 181.5 42 216.5 43 251.0 44 281.0 45 275.5 46 251.5 47 260.0 48 256.0 49 217.5 50 182.5 51 156.0 52 132.5 53 104.0 54 74.5 55 62.0 56 45.5 57 35.0 58 34.0 59 21.5 60 13.0 61 11.0 62 6.0 63 2.0 64 1.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21894683799447 98.45 2 0.781053162005543 1.55 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.0875 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.175 0.0 0.0 0.0 0.0 126-127 0.1875 0.0 0.0 0.0 0.0 128-129 0.21250000000000002 0.0 0.0 0.0 0.0 130-131 0.2375 0.0 0.0 0.0 0.0 132-133 0.2625 0.0 0.0 0.0 0.0 134-135 0.3 0.0 0.0 0.0 0.0 136-137 0.3 0.0 0.0 0.0 0.0 138-139 0.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7495378 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495378_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2295 34.0 33.0 34.0 33.0 34.0 2 33.307 34.0 33.0 34.0 33.0 34.0 3 33.3515 34.0 33.0 34.0 33.0 34.0 4 33.28925 34.0 33.0 34.0 33.0 34.0 5 33.3155 34.0 33.0 34.0 33.0 34.0 6 37.59375 38.0 38.0 38.0 38.0 38.0 7 37.54275 38.0 38.0 38.0 38.0 38.0 8 37.538 38.0 38.0 38.0 38.0 38.0 9 37.47 38.0 38.0 38.0 38.0 38.0 10-14 37.5378 38.0 38.0 38.0 38.0 38.0 15-19 37.48565 38.0 38.0 38.0 38.0 38.0 20-24 37.46225 38.0 38.0 38.0 38.0 38.0 25-29 37.44435 38.0 38.0 38.0 38.0 38.0 30-34 37.42094999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.431850000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.39665 38.0 38.0 38.0 38.0 38.0 45-49 37.383500000000005 38.0 38.0 38.0 37.8 38.0 50-54 37.40005 38.0 38.0 38.0 37.4 38.0 55-59 37.3492 38.0 38.0 38.0 37.0 38.0 60-64 37.292049999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.29425 38.0 38.0 38.0 37.0 38.0 70-74 37.306799999999996 38.0 38.0 38.0 37.0 38.0 75-79 37.269450000000006 38.0 38.0 38.0 37.0 38.0 80-84 37.1786 38.0 38.0 38.0 36.6 38.0 85-89 37.16675 38.0 38.0 38.0 37.0 38.0 90-94 37.067350000000005 38.0 38.0 38.0 36.2 38.0 95-99 37.02915 38.0 38.0 38.0 36.0 38.0 100-104 36.955799999999996 38.0 38.0 38.0 36.0 38.0 105-109 36.90069999999999 38.0 38.0 38.0 36.0 38.0 110-114 36.7994 38.0 38.0 38.0 35.6 38.0 115-119 36.733050000000006 38.0 38.0 38.0 35.2 38.0 120-124 36.603750000000005 38.0 38.0 38.0 35.0 38.0 125-129 36.578199999999995 38.0 38.0 38.0 34.8 38.0 130-134 36.4714 38.0 38.0 38.0 34.4 38.0 135-139 36.292049999999996 38.0 38.0 38.0 34.0 38.0 140-144 36.106 38.0 38.0 38.0 33.6 38.0 145-149 35.7358 38.0 37.8 38.0 33.0 38.0 150-151 33.032 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 3.0 17 1.0 18 2.0 19 3.0 20 3.0 21 2.0 22 3.0 23 5.0 24 6.0 25 8.0 26 9.0 27 15.0 28 13.0 29 12.0 30 21.0 31 32.0 32 35.0 33 55.0 34 81.0 35 149.0 36 362.0 37 3168.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.41060265066267 25.256314078519633 10.577644411102776 21.75543885971493 2 25.331332833208304 28.232058014503625 28.482120530132534 17.95448862215554 3 20.330082520630157 29.00725181295324 30.882720680170046 19.779944986246562 4 23.305826456614152 33.833458364591145 22.13053263315829 20.730182545636406 5 23.78094523630908 36.734183545886474 21.355338834708675 18.12953238309577 6 22.405601400350086 38.33458364591148 21.580395098774694 17.67941985496374 7 19.02975743935984 24.256064016004 37.2093023255814 19.504876219054765 8 22.705676419104776 25.70642660665166 28.157039259814955 23.43085771442861 9 22.155538884721178 25.10627656914228 28.732183045761438 24.006001500375092 10-14 22.980745186296573 30.092523130782695 25.886471617904476 21.040260065016252 15-19 22.96574143535884 28.132033008252062 27.27181795448862 21.630407601900476 20-24 23.42585646411603 27.81695423855964 27.571892973243312 21.185296324081023 25-29 23.0207551887972 28.457114278569644 27.401850462615652 21.120280070017504 30-34 23.380845211302827 28.382095523880967 26.60165041260315 21.635408852213054 35-39 23.095773943485874 27.671917979494875 27.33183295823956 21.900475118779696 40-44 22.749549909981997 27.985597119423883 26.955391078215644 22.309461892378476 45-49 22.72068017004251 28.13703425856464 27.316829207301822 21.82545636409102 50-54 23.368505275791367 28.034205130769614 26.864029604440663 21.73325998899835 55-59 23.389677935587116 27.515503100620126 27.220444088817764 21.874374874974993 60-64 22.86457291458292 27.735547109421884 27.335467093418686 22.064412882576516 65-69 23.009601920384075 27.19543908781756 27.535507101420286 22.259451890378077 70-74 23.8997799559912 27.820564112822566 26.735347069413884 21.544308861772354 75-79 23.533530029504426 27.499124868730306 27.689153373005954 21.278191728759314 80-84 23.695923980995246 27.731932983245812 27.021755438859714 21.550387596899228 85-89 22.959591918383676 27.795559111822364 27.815563112622527 21.429285857171436 90-94 23.817381738173818 27.49274927492749 27.07270727072707 21.61716171617162 95-99 23.203480522078312 27.229084362654397 28.01420213031955 21.553232984947744 100-104 23.865966491622906 26.981745436359088 27.49187296824206 21.660415103775943 105-109 23.295823955988997 27.671917979494875 27.22180545136284 21.810452613153288 110-114 23.295823955988997 27.82195548887222 27.191797949487373 21.690422605651413 115-119 23.935983995999 27.596899224806204 27.03675918979745 21.43035758939735 120-124 23.385846461615404 28.11702925731433 26.76169042260565 21.735433858464617 125-129 23.735933983495876 27.721930482620653 27.236809202300577 21.305326331582897 130-134 24.281070267566893 27.591897974493623 27.14678669667417 20.980245061265315 135-139 24.18104526131533 27.481870467616904 27.45686421605401 20.880220055013755 140-144 23.495873968492123 27.68192048012003 27.22680670167542 21.595398849712428 145-149 24.356089022255563 27.631907976994246 27.026756689172295 20.985246311577892 150-151 23.56544568071009 27.928491061382672 27.55344418052256 20.952619077384675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 0.0 22 0.0 23 1.0 24 4.0 25 3.5 26 2.5 27 4.0 28 4.0 29 5.0 30 8.5 31 11.5 32 15.0 33 22.0 34 30.5 35 44.5 36 63.0 37 83.5 38 115.5 39 155.0 40 186.0 41 219.5 42 242.0 43 265.5 44 284.5 45 292.0 46 286.0 47 258.0 48 248.0 49 226.5 50 196.5 51 165.5 52 121.0 53 93.5 54 80.5 55 69.5 56 54.5 57 35.0 58 27.0 59 23.5 60 19.0 61 14.5 62 6.5 63 3.5 64 2.0 65 1.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.025 25-29 0.025 30-34 0.025 35-39 0.025 40-44 0.02 45-49 0.025 50-54 0.015 55-59 0.02 60-64 0.02 65-69 0.02 70-74 0.02 75-79 0.015 80-84 0.025 85-89 0.02 90-94 0.01 95-99 0.015 100-104 0.025 105-109 0.025 110-114 0.025 115-119 0.025 120-124 0.025 125-129 0.025 130-134 0.025 135-139 0.025 140-144 0.025 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14184755174155 98.2 2 0.7571933366986371 1.5 3 0.10095911155981827 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0125 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.025 0.0 0.0 0.025 0.0 92-93 0.025 0.0 0.0 0.025 0.0 94-95 0.025 0.0 0.0 0.025 0.0 96-97 0.025 0.0 0.0 0.025 0.0 98-99 0.025 0.0 0.0 0.025 0.0 100-101 0.025 0.0 0.0 0.025 0.0 102-103 0.025 0.0 0.0 0.025 0.0 104-105 0.025 0.0 0.0 0.025 0.0 106-107 0.025 0.0 0.0 0.025 0.0 108-109 0.025 0.0 0.0 0.025 0.0 110-111 0.025 0.0 0.0 0.025 0.0 112-113 0.025 0.0 0.0 0.025 0.0 114-115 0.025 0.0 0.0 0.025 0.0 116-117 0.05 0.0 0.0 0.025 0.0 118-119 0.0875 0.0 0.0 0.025 0.0 120-121 0.1 0.0 0.0 0.025 0.0 122-123 0.15 0.0 0.0 0.025 0.0 124-125 0.175 0.0 0.0 0.025 0.0 126-127 0.1875 0.0 0.0 0.025 0.0 128-129 0.21250000000000002 0.0 0.0 0.025 0.0 130-131 0.2375 0.0 0.0 0.025 0.0 132-133 0.275 0.0 0.0 0.025 0.0 134-135 0.3 0.0 0.0 0.025 0.0 136-137 0.3 0.0 0.0 0.025 0.0 138-139 0.3125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711552 spots for SRR7495378.sra Written 711552 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra Read 711550 spots for SRR7495378.sra Written 711550 spots for SRR7495378.sra SRR ids: ['SRR7495378.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rric40qb SRR7495378.sra spots: 14231002 blocks: [[1, 711550], [711551, 1423100], [1423101, 2134650], [2134651, 2846200], [2846201, 3557750], [3557751, 4269300], [4269301, 4980850], [4980851, 5692400], [5692401, 6403950], [6403951, 7115500], [7115501, 7827050], [7827051, 8538600], [8538601, 9250150], [9250151, 9961700], [9961701, 10673250], [10673251, 11384800], [11384801, 12096350], [12096351, 12807900], [12807901, 13519450], [13519451, 14231002]] SRR7495378 file size 4800719 SRR7495378 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7495378 SRR7495378_1.fastq SRR7495378_2.fastq Input file: SRR7495378_1.fastq Paired file: SRR7495378_2.fastq trimmed: SRR7495378-trimmed-pair1.fastq, SRR7495378-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:55:00 2025 >> started Mon Feb 10 17:55:15 2025 >> done (15.302s) 14231002 read pairs processed; of these: 10589 ( 0.07%) short read pairs filtered out after trimming by size control 19734 ( 0.14%) empty read pairs filtered out after trimming by size control 14200679 (99.79%) read pairs available; of these: 6042779 (42.55%) trimmed read pairs available after processing 8157900 (57.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 5 0.00% 23 3 0.00% 24 0 0.00% 25 3 0.00% 26 2 0.00% 27 6 0.00% 28 8 0.00% 29 3 0.00% 30 7 0.00% 31 3 0.00% 32 7 0.00% 33 6 0.00% 34 4 0.00% 35 5 0.00% 36 3 0.00% 37 7 0.00% 38 2 0.00% 39 7 0.00% 40 13 0.00% 41 7 0.00% 42 13 0.00% 43 11 0.00% 44 15 0.00% 45 13 0.00% 46 12 0.00% 47 15 0.00% 48 22 0.00% 49 17 0.00% 50 14 0.00% 51 20 0.00% 52 25 0.00% 53 28 0.00% 54 43 0.00% 55 55 0.00% 56 73 0.00% 57 105 0.00% 58 90 0.00% 59 95 0.00% 60 106 0.00% 61 89 0.00% 62 120 0.00% 63 104 0.00% 64 101 0.00% 65 100 0.00% 66 91 0.00% 67 107 0.00% 68 140 0.00% 69 134 0.00% 70 142 0.00% 71 137 0.00% 72 149 0.00% 73 207 0.00% 74 235 0.00% 75 231 0.00% 76 262 0.00% 77 270 0.00% 78 286 0.00% 79 339 0.00% 80 336 0.00% 81 368 0.00% 82 434 0.00% 83 492 0.00% 84 989 0.01% 85 1333 0.01% 86 1413 0.01% 87 1709 0.01% 88 1701 0.01% 89 1775 0.01% 90 1838 0.01% 91 1803 0.01% 92 1888 0.01% 93 1899 0.01% 94 2024 0.01% 95 2139 0.02% 96 2162 0.02% 97 2287 0.02% 98 2466 0.02% 99 2566 0.02% 100 2911 0.02% 101 3199 0.02% 102 3538 0.02% 103 3853 0.03% 104 4368 0.03% 105 5199 0.04% 106 6427 0.05% 107 6545 0.05% 108 4633 0.03% 109 4798 0.03% 110 5584 0.04% 111 8328 0.06% 112 5889 0.04% 113 6880 0.05% 114 8046 0.06% 115 10987 0.08% 116 11719 0.08% 117 17504 0.12% 118 34824 0.25% 119 179507 1.26% 120 690286 4.86% 121 69893 0.49% 122 937600 6.60% 123 52897 0.37% 124 67563 0.48% 125 148897 1.05% 126 38574 0.27% 127 32236 0.23% 128 23261 0.16% 129 25895 0.18% 130 23498 0.17% 131 15247 0.11% 132 16108 0.11% 133 17344 0.12% 134 18602 0.13% 135 18006 0.13% 136 14518 0.10% 137 18422 0.13% 138 17846 0.13% 139 19735 0.14% 140 22050 0.16% 141 24910 0.18% 142 26135 0.18% 143 33900 0.24% 144 38727 0.27% 145 46992 0.33% 146 64559 0.45% 147 95657 0.67% 148 161132 1.13% 149 375778 2.65% 150 2516026 17.72% 151 8157900 57.45% 14200679 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=20 prefix-density=0.73 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=18.52 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.9 sequence=AAAAAAATTGAAACGATATATCAAGTTCGGGACAAGTAGTACATCATGTGGAGATCGAGTTTATGCGAAGGTTCGAAATAGATAAATACAAGTTCCTAATCAAAAAGCCCTACTATTTTCATGCATCAACTATCTCTCCAGCCTCAGCAGCAGCAAGCACAAGCTCTGGCTGTAGACTGAATGTTCCATCTAGGGCATTTGGTTGCCCCAAAGCCTTCAAAGCCAAGTGTGCAGCCTTCTGCCCTGAGATCATCATTGCCCCAAATGTTGGACCCATTCTTGGTGCTCCATCAATTTCTGCAACTTCCATGCCTGTAACAATCATGCCAGGCACAATCTCTCTTGTAAGCCTAACAATTGCATCTTCGGCCGCGTTCATGTCAAGTGCTTTCATTCCTGGAACACTATCAATCATGCCAATACTCTTCAATCTCTTCACTCCAGTAGCACCAAAAGGCCCATCGTGTCCACAAGAACTAACCACAATCTTAGCCTCCATGACATTAGGGTC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.52 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=39.38 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACA SRR7495378 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:56:01 Started mapping on | Feb 10 17:56:01 Finished on | Feb 10 17:57:06 Mapping speed, Million of reads per hour | 786.50 Number of input reads | 14200679 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 13268781 Uniquely mapped reads % | 93.44% Average mapped length | 289.31 Number of splices: Total | 12222229 Number of splices: Annotated (sjdb) | 12056563 Number of splices: GT/AG | 12013973 Number of splices: GC/AG | 185884 Number of splices: AT/AC | 6286 Number of splices: Non-canonical | 16086 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289059 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 12771 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.42% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 656669 656669 656669 N_multimapping 289059 289059 289059 N_noFeature 241703 13083269 283311 N_ambiguous 218759 722 74652 UnstrandedReadsAssigned:12808319 PositiveStrandReadsAssigned:184790 NegativeStrandReadsAssigned:12910818 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7495378 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7495378-trimmed-pair1.fastq SRR7495378-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,200,679 reads, 12,998,106 reads pseudoaligned [quant] estimated average fragment length: 339.25 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7495378.ke.tsv 34699 SRR7495378.se.tsv 87100 total ==> SRR7495378.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1679.75 260 9.21095 Potri.005G024800.1.v4.1 1035 696.75 170 14.5194 Potri.004G059700.1.v4.1 961 622.779 25 2.38881 Potri.007G009000.2.v4.1 1416 1077.75 0 0 Potri.003G141000.2.v4.1 2943 2604.75 559 12.7709 Potri.016G087400.1.v4.1 270 50.2891 529 625.976 Potri.015G069301.1.v4.1 564 234.548 0 0 Potri.010G195200.1.v4.1 1773 1434.75 16 0.66362 Potri.012G127500.1.v4.1 977 638.756 404 37.6376 ==> SRR7495378.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 478 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 212 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 52 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7495378 completed mapping pipeline successfully