Starting /dee2/code/volunteer_pipeline.sh SRR7495379 current disk space = 3057935503360 free memory = 985857420 SRR7495379 SRAfilesize 5a10bc11a74580e572bb5197ae8f3b9e SRR7495379.sra SRR7495379.sra file validated SRR7495379 is paired end SRR7495379 is conventional basespace SRR7495379 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495379_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.483 30.0 18.0 33.0 18.0 34.0 2 31.59 33.0 30.0 33.0 27.0 34.0 3 31.28575 33.0 31.0 33.0 28.0 33.0 4 31.7805 33.0 32.0 33.0 30.0 33.0 5 32.68825 33.0 33.0 33.0 32.0 34.0 6 36.845 38.0 37.0 38.0 35.0 38.0 7 37.4055 38.0 38.0 38.0 37.0 38.0 8 37.47975 38.0 38.0 38.0 37.0 38.0 9 37.53325 38.0 38.0 38.0 37.0 38.0 10-14 37.62165 38.0 38.0 38.0 38.0 38.0 15-19 37.60754999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.621900000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.6082 38.0 38.0 38.0 38.0 38.0 30-34 37.56615 38.0 38.0 38.0 38.0 38.0 35-39 37.573299999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.512950000000004 38.0 38.0 38.0 37.6 38.0 45-49 37.4822 38.0 38.0 38.0 37.6 38.0 50-54 37.525 38.0 38.0 38.0 37.4 38.0 55-59 37.4413 38.0 38.0 38.0 37.0 38.0 60-64 37.40915 38.0 38.0 38.0 37.0 38.0 65-69 37.3969 38.0 38.0 38.0 37.0 38.0 70-74 37.33045 38.0 38.0 38.0 37.0 38.0 75-79 37.26950000000001 38.0 38.0 38.0 36.6 38.0 80-84 37.243950000000005 38.0 38.0 38.0 36.8 38.0 85-89 37.13629999999999 38.0 38.0 38.0 36.0 38.0 90-94 37.1443 38.0 38.0 38.0 36.0 38.0 95-99 37.05885 38.0 38.0 38.0 36.0 38.0 100-104 37.004599999999996 38.0 38.0 38.0 36.0 38.0 105-109 36.87705 38.0 38.0 38.0 35.4 38.0 110-114 36.8631 38.0 38.0 38.0 35.0 38.0 115-119 36.76785 38.0 38.0 38.0 34.8 38.0 120-124 36.694849999999995 38.0 38.0 38.0 34.8 38.0 125-129 36.471 38.0 38.0 38.0 34.0 38.0 130-134 36.33305 38.0 38.0 38.0 34.0 38.0 135-139 36.2006 38.0 37.6 38.0 33.8 38.0 140-144 36.04565 38.0 37.6 38.0 33.2 38.0 145-149 35.7288 38.0 36.2 38.0 33.0 38.0 150-151 33.44725 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 2.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.0 21 2.0 22 1.0 23 3.0 24 1.0 25 4.0 26 8.0 27 12.0 28 11.0 29 15.0 30 30.0 31 29.0 32 65.0 33 58.0 34 93.0 35 147.0 36 564.0 37 2949.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.51015685266135 15.093854461301106 9.616868089483157 30.77912059655438 2 23.13078269567392 13.50337584396099 31.15778944736184 32.208052013003254 3 18.425 17.775 27.375 36.425000000000004 4 20.65 23.525 25.25 30.575000000000003 5 22.375 28.499999999999996 26.974999999999998 22.15 6 21.325 31.225 25.75 21.7 7 16.3 26.400000000000002 39.725 17.575 8 17.675 27.325 31.225 23.775 9 17.599999999999998 25.275 33.525 23.599999999999998 10-14 19.625 29.875 28.155 22.345000000000002 15-19 20.05 29.445 27.61 22.895 20-24 19.325 28.71 28.46 23.505000000000003 25-29 20.51 28.410000000000004 27.534999999999997 23.544999999999998 30-34 19.939999999999998 28.970000000000002 27.810000000000002 23.28 35-39 19.55 28.560000000000002 28.025 23.865 40-44 19.785 28.854999999999997 27.62 23.74 45-49 20.36 28.54 27.794999999999998 23.305 50-54 19.57 29.185 27.534999999999997 23.71 55-59 19.925 28.050000000000004 27.99 24.035 60-64 19.6 28.549999999999997 28.050000000000004 23.799999999999997 65-69 20.645 28.395 27.200000000000003 23.76 70-74 20.41 28.785 27.555000000000003 23.25 75-79 20.225 28.63 27.38 23.765 80-84 20.095 28.9 27.12 23.885 85-89 20.044999999999998 28.435 27.26 24.26 90-94 20.45 28.405 27.255000000000003 23.89 95-99 19.53 28.189999999999998 28.505000000000003 23.775 100-104 19.93 28.705000000000002 27.800000000000004 23.565 105-109 20.455000000000002 28.03 27.529999999999998 23.985 110-114 20.685000000000002 27.944999999999997 27.62 23.75 115-119 20.974999999999998 27.6 27.725 23.7 120-124 20.505000000000003 28.125 27.295 24.075 125-129 19.895 27.765 27.87 24.47 130-134 20.875 28.134999999999998 26.85 24.14 135-139 20.474999999999998 28.199999999999996 27.889999999999997 23.435 140-144 21.015 27.355 27.915 23.715 145-149 20.825 28.01 27.415 23.75 150-151 20.1375 27.8875 27.8125 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.5 20 1.5 21 2.5 22 3.5 23 2.5 24 1.5 25 2.0 26 4.5 27 8.0 28 9.0 29 11.5 30 19.5 31 29.0 32 36.5 33 43.5 34 51.5 35 66.0 36 84.5 37 100.0 38 130.5 39 164.0 40 186.5 41 207.5 42 214.0 43 236.5 44 275.5 45 287.0 46 275.5 47 255.5 48 246.0 49 232.0 50 196.5 51 155.0 52 115.0 53 86.5 54 67.0 55 50.0 56 39.5 57 34.5 58 23.5 59 12.5 60 6.5 61 4.0 62 5.0 63 4.5 64 3.0 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.775 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.0625 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1375 0.0 0.0 0.0 0.0 122-123 0.16249999999999998 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.21250000000000002 0.0 0.0 0.0 0.0 128-129 0.2375 0.0 0.0 0.0 0.0 130-131 0.25 0.0 0.0 0.0 0.0 132-133 0.2875 0.0 0.0 0.0 0.0 134-135 0.3 0.0 0.0 0.0 0.0 136-137 0.32499999999999996 0.0 0.0 0.0 0.0 138-139 0.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.0035419178 20.70893 8 >>END_MODULE SRR7495379 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495379_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0705 33.0 33.0 34.0 32.0 34.0 2 33.157 34.0 33.0 34.0 33.0 34.0 3 33.18575 34.0 33.0 34.0 33.0 34.0 4 33.0815 34.0 33.0 34.0 33.0 34.0 5 33.22625 34.0 33.0 34.0 33.0 34.0 6 37.35025 38.0 38.0 38.0 37.0 38.0 7 37.38225 38.0 38.0 38.0 38.0 38.0 8 37.40875 38.0 38.0 38.0 38.0 38.0 9 37.3925 38.0 38.0 38.0 37.0 38.0 10-14 37.3318 38.0 38.0 38.0 37.4 38.0 15-19 37.33935 38.0 38.0 38.0 37.4 38.0 20-24 37.316599999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.29565 38.0 38.0 38.0 37.0 38.0 30-34 37.30155 38.0 38.0 38.0 37.0 38.0 35-39 37.322500000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.30565 38.0 38.0 38.0 37.0 38.0 45-49 37.2799 38.0 38.0 38.0 37.0 38.0 50-54 37.2448 38.0 38.0 38.0 37.0 38.0 55-59 37.214099999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.1387 38.0 38.0 38.0 37.0 38.0 65-69 37.1182 38.0 38.0 38.0 36.8 38.0 70-74 37.1108 38.0 38.0 38.0 36.6 38.0 75-79 37.1239 38.0 38.0 38.0 36.8 38.0 80-84 37.06205 38.0 38.0 38.0 36.2 38.0 85-89 36.99425 38.0 38.0 38.0 36.0 38.0 90-94 36.9689 38.0 38.0 38.0 36.0 38.0 95-99 36.900000000000006 38.0 38.0 38.0 36.0 38.0 100-104 36.79730000000001 38.0 38.0 38.0 35.8 38.0 105-109 36.75699999999999 38.0 38.0 38.0 35.2 38.0 110-114 36.7204 38.0 38.0 38.0 35.0 38.0 115-119 36.54755 38.0 38.0 38.0 34.4 38.0 120-124 36.45615 38.0 38.0 38.0 34.0 38.0 125-129 36.40275 38.0 38.0 38.0 34.0 38.0 130-134 36.212900000000005 38.0 38.0 38.0 33.8 38.0 135-139 36.084399999999995 38.0 38.0 38.0 33.8 38.0 140-144 35.89835 38.0 38.0 38.0 33.2 38.0 145-149 35.4952 38.0 36.4 38.0 33.0 38.0 150-151 32.803 37.0 33.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 2.0 13 1.0 14 0.0 15 3.0 16 3.0 17 2.0 18 0.0 19 1.0 20 7.0 21 4.0 22 5.0 23 4.0 24 13.0 25 9.0 26 10.0 27 16.0 28 15.0 29 24.0 30 22.0 31 42.0 32 40.0 33 62.0 34 101.0 35 158.0 36 372.0 37 3075.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.03703703703704 25.8008008008008 12.912912912912914 24.24924924924925 2 24.94365138993238 29.351364888554972 28.900576008014024 16.804407713498623 3 20.010017530678688 28.4748309541698 31.83070373153018 19.684447783621337 4 23.872745490981963 34.1933867735471 22.720440881763526 19.213426853707418 5 24.473947895791586 36.322645290581164 21.668336673346694 17.535070140280563 6 21.135567783891947 39.04452226113057 21.91095547773887 17.90895447723862 7 20.36018009004502 23.58679339669835 36.36818409204602 19.684842421210604 8 20.860430215107552 26.96348174087044 27.33866933466733 24.83741870935468 9 22.18609304652326 25.76288144072036 28.8144072036018 23.23661830915458 10-14 23.283970382229338 29.92795677406444 25.43526115669402 21.352811687012206 15-19 22.726363181590795 28.224112056028016 27.41870935467734 21.630815407703853 20-24 22.50625312656328 29.34467233616808 27.03351675837919 21.115557778889446 25-29 23.171585792896447 28.354177088544276 27.358679339669834 21.115557778889446 30-34 23.111555777888945 28.284142071035518 26.943471735867934 21.660830415207606 35-39 22.311155577788895 28.339169584792394 27.61880940470235 21.73086543271636 40-44 22.866433216608304 27.908954477238616 27.793896948474238 21.43071535767884 45-49 22.651325662831415 28.409204602301152 27.793896948474238 21.145572786393195 50-54 22.87143571785893 28.3991995997999 27.19859929964982 21.530765382691346 55-59 23.216608304152075 28.08904452226113 27.24862431215608 21.445722861430717 60-64 23.306653326663334 28.134067033516757 27.04352176088044 21.51575787893947 65-69 23.067687227975387 27.244984741607887 27.390064535494524 22.297263494922205 70-74 23.646823411705853 27.793896948474238 26.89344672336168 21.665832916458232 75-79 23.28664332166083 27.658829414707352 27.41370685342671 21.6408204102051 80-84 23.14657328664332 27.893946973486745 27.103551775887947 21.85592796398199 85-89 22.936468234117058 28.299149574787393 27.318659329664836 21.445722861430717 90-94 22.96648324162081 27.673836918459227 27.478739369684842 21.880940470235117 95-99 23.446723361680842 27.94897448724362 26.848424212106053 21.755877938969483 100-104 23.33166583291646 27.32366183091546 27.433716858429214 21.91095547773887 105-109 23.556778389194598 27.878939469734863 27.163581790895446 21.400700350175086 110-114 22.961480740370185 28.29414707353677 27.40370185092546 21.340670335167584 115-119 23.791895947973988 28.204102051025515 27.01350675337669 20.990495247623812 120-124 23.512932112661964 27.565160838461157 27.37005352944119 21.55185351943569 125-129 23.733053179248586 27.895342438341086 26.60963529941468 21.76196908299565 130-134 24.03822102156186 27.890339686827755 27.1699434689079 20.901495822702486 135-139 23.846923461730864 27.66383191595798 27.65382691345673 20.83541770885443 140-144 23.78689344672336 27.32866433216608 27.348674337168582 21.53576788394197 145-149 23.83191595797899 27.483741870935468 27.763881940970485 20.920460230115058 150-151 23.158684506690008 27.810428910841566 28.398149305989744 20.63273727647868 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.5 21 1.0 22 0.5 23 1.0 24 2.5 25 3.0 26 4.0 27 5.5 28 6.5 29 7.0 30 9.5 31 12.5 32 18.5 33 24.5 34 33.5 35 52.5 36 71.5 37 87.5 38 118.5 39 155.5 40 185.5 41 218.5 42 250.5 43 278.0 44 291.5 45 297.5 46 281.0 47 261.0 48 245.5 49 212.5 50 195.5 51 157.0 52 115.5 53 99.5 54 84.5 55 62.5 56 40.0 57 30.0 58 17.5 59 15.5 60 14.0 61 9.0 62 8.0 63 5.0 64 2.5 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.17500000000000002 3 0.17500000000000002 4 0.2 5 0.2 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.06 15-19 0.05 20-24 0.05 25-29 0.05 30-34 0.05 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.055 70-74 0.05 75-79 0.05 80-84 0.05 85-89 0.05 90-94 0.05 95-99 0.05 100-104 0.05 105-109 0.05 110-114 0.05 115-119 0.05 120-124 0.055 125-129 0.055 130-134 0.055 135-139 0.05 140-144 0.05 145-149 0.05 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34426229508196 98.475 2 0.45397225725094575 0.8999999999999999 3 0.17654476670870115 0.525 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.0625 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1375 0.0 0.0 0.0 0.0 122-123 0.16249999999999998 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.21250000000000002 0.0 0.0 0.0 0.0 128-129 0.2375 0.0 0.0 0.0 0.0 130-131 0.25 0.0 0.0 0.0 0.0 132-133 0.2875 0.0 0.0 0.0 0.0 134-135 0.3 0.0 0.0 0.0 0.0 136-137 0.32499999999999996 0.0 0.0 0.0 0.0 138-139 0.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGCAAC 10 0.006830828 145.0 2 CATCAGA 10 0.006830828 145.0 145 >>END_MODULE Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463248 spots for SRR7495379.sra Written 463248 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra Read 463241 spots for SRR7495379.sra Written 463241 spots for SRR7495379.sra SRR ids: ['SRR7495379.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1_w54uku SRR7495379.sra spots: 9264827 blocks: [[1, 463241], [463242, 926482], [926483, 1389723], [1389724, 1852964], [1852965, 2316205], [2316206, 2779446], [2779447, 3242687], [3242688, 3705928], [3705929, 4169169], [4169170, 4632410], [4632411, 5095651], [5095652, 5558892], [5558893, 6022133], [6022134, 6485374], [6485375, 6948615], [6948616, 7411856], [7411857, 7875097], [7875098, 8338338], [8338339, 8801579], [8801580, 9264827]] SRR7495379 file size 3119281 SRR7495379 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7495379 SRR7495379_1.fastq SRR7495379_2.fastq Input file: SRR7495379_1.fastq Paired file: SRR7495379_2.fastq trimmed: SRR7495379-trimmed-pair1.fastq, SRR7495379-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 17:47:38 2025 >> started Mon Feb 10 17:47:49 2025 >> done (10.466s) 9264827 read pairs processed; of these: 5199 ( 0.06%) short read pairs filtered out after trimming by size control 11368 ( 0.12%) empty read pairs filtered out after trimming by size control 9248260 (99.82%) read pairs available; of these: 2911795 (31.48%) trimmed read pairs available after processing 6336465 (68.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 2 0.00% 23 1 0.00% 24 3 0.00% 25 1 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 2 0.00% 32 0 0.00% 33 2 0.00% 34 2 0.00% 35 1 0.00% 36 1 0.00% 37 2 0.00% 38 2 0.00% 39 2 0.00% 40 2 0.00% 41 6 0.00% 42 0 0.00% 43 2 0.00% 44 3 0.00% 45 5 0.00% 46 3 0.00% 47 3 0.00% 48 8 0.00% 49 3 0.00% 50 5 0.00% 51 4 0.00% 52 7 0.00% 53 3 0.00% 54 6 0.00% 55 3 0.00% 56 6 0.00% 57 5 0.00% 58 13 0.00% 59 7 0.00% 60 13 0.00% 61 7 0.00% 62 11 0.00% 63 10 0.00% 64 7 0.00% 65 25 0.00% 66 14 0.00% 67 19 0.00% 68 18 0.00% 69 21 0.00% 70 35 0.00% 71 24 0.00% 72 28 0.00% 73 25 0.00% 74 50 0.00% 75 45 0.00% 76 80 0.00% 77 79 0.00% 78 67 0.00% 79 90 0.00% 80 87 0.00% 81 118 0.00% 82 114 0.00% 83 139 0.00% 84 414 0.00% 85 555 0.01% 86 629 0.01% 87 683 0.01% 88 789 0.01% 89 767 0.01% 90 849 0.01% 91 852 0.01% 92 810 0.01% 93 802 0.01% 94 808 0.01% 95 860 0.01% 96 923 0.01% 97 927 0.01% 98 1012 0.01% 99 1037 0.01% 100 1126 0.01% 101 1232 0.01% 102 1253 0.01% 103 1298 0.01% 104 1405 0.02% 105 1515 0.02% 106 1582 0.02% 107 1789 0.02% 108 1804 0.02% 109 1939 0.02% 110 2002 0.02% 111 2203 0.02% 112 2333 0.03% 113 2557 0.03% 114 2737 0.03% 115 2937 0.03% 116 2995 0.03% 117 3067 0.03% 118 3331 0.04% 119 3368 0.04% 120 3650 0.04% 121 3762 0.04% 122 3891 0.04% 123 4158 0.04% 124 4343 0.05% 125 4647 0.05% 126 4837 0.05% 127 5223 0.06% 128 5742 0.06% 129 5966 0.06% 130 6446 0.07% 131 6827 0.07% 132 7244 0.08% 133 7908 0.09% 134 8658 0.09% 135 9297 0.10% 136 10424 0.11% 137 11142 0.12% 138 12369 0.13% 139 13882 0.15% 140 15978 0.17% 141 17746 0.19% 142 20510 0.22% 143 24117 0.26% 144 30032 0.32% 145 38426 0.42% 146 51309 0.55% 147 76415 0.83% 148 128728 1.39% 149 295395 3.19% 150 2016282 21.80% 151 6336465 68.52% 9248260 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=20 prefix-density=0.53 prefix-fanout=1.9 sequence=ACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.16 sequence-density-rank=29 fanout-score=22.60 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=9.0 sequence=TTCTTTCCAATGCT criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=32 prefix-density=0.44 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=23.75 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=8.5 sequence=CAAGGAAAATCCTTCCAGTGTGAACT SRR7495379 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 17:48:32 Started mapping on | Feb 10 17:48:32 Finished on | Feb 10 17:49:24 Mapping speed, Million of reads per hour | 640.26 Number of input reads | 9248260 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 8701572 Uniquely mapped reads % | 94.09% Average mapped length | 299.45 Number of splices: Total | 8787491 Number of splices: Annotated (sjdb) | 8679459 Number of splices: GT/AG | 8634520 Number of splices: GC/AG | 136570 Number of splices: AT/AC | 5339 Number of splices: Non-canonical | 11062 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 162532 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 14344 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.97% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 390694 390694 390694 N_multimapping 162532 162532 162532 N_noFeature 169171 8575294 195763 N_ambiguous 153377 391 53500 UnstrandedReadsAssigned:8379024 PositiveStrandReadsAssigned:125887 NegativeStrandReadsAssigned:8452309 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7495379 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7495379-trimmed-pair1.fastq SRR7495379-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,248,260 reads, 8,491,922 reads pseudoaligned [quant] estimated average fragment length: 377.065 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR7495379.ke.tsv 34699 SRR7495379.se.tsv 87100 total ==> SRR7495379.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1641.93 268 15.9562 Potri.005G024800.1.v4.1 1035 658.935 72 10.6817 Potri.004G059700.1.v4.1 961 584.987 21 3.50933 Potri.007G009000.2.v4.1 1416 1039.93 0 0 Potri.003G141000.2.v4.1 2943 2566.93 319 12.1486 Potri.016G087400.1.v4.1 270 53.7924 361 656.05 Potri.015G069301.1.v4.1 564 206.913 0 0 Potri.010G195200.1.v4.1 1773 1396.93 29 2.02942 Potri.012G127500.1.v4.1 977 600.964 193 31.3949 ==> SRR7495379.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 427 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 3 SRR7495379 completed mapping pipeline successfully