Starting /dee2/code/volunteer_pipeline.sh SRR7495380 current disk space = 3057675608064 free memory = 1101415608 SRR7495380 SRAfilesize a0c3f2b57094b3f681afe99dbb04da10 SRR7495380.sra SRR7495380.sra file validated SRR7495380 is paired end SRR7495380 is conventional basespace SRR7495380 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495380_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.9435 32.0 28.0 33.0 18.0 34.0 2 32.112 33.0 31.0 34.0 29.0 34.0 3 31.24525 32.0 31.0 33.0 28.0 34.0 4 32.98825 33.0 33.0 33.0 32.0 34.0 5 33.32 33.0 33.0 34.0 33.0 34.0 6 37.2415 38.0 38.0 38.0 36.0 38.0 7 37.68225 38.0 38.0 38.0 37.0 38.0 8 37.73675 38.0 38.0 38.0 38.0 38.0 9 37.871 38.0 38.0 38.0 38.0 38.0 10-14 37.86445 38.0 38.0 38.0 38.0 38.0 15-19 37.873949999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.86515 38.0 38.0 38.0 38.0 38.0 25-29 37.86625 38.0 38.0 38.0 38.0 38.0 30-34 37.85385 38.0 38.0 38.0 38.0 38.0 35-39 37.8479 38.0 38.0 38.0 38.0 38.0 40-44 37.834900000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.82345 38.0 38.0 38.0 38.0 38.0 50-54 37.78985 38.0 38.0 38.0 38.0 38.0 55-59 37.75435 38.0 38.0 38.0 38.0 38.0 60-64 37.743050000000004 38.0 38.0 38.0 38.0 38.0 65-69 37.72705 38.0 38.0 38.0 38.0 38.0 70-74 37.73025 38.0 38.0 38.0 38.0 38.0 75-79 37.7046 38.0 38.0 38.0 38.0 38.0 80-84 37.69315 38.0 38.0 38.0 38.0 38.0 85-89 37.660399999999996 38.0 38.0 38.0 38.0 38.0 90-94 37.608549999999994 38.0 38.0 38.0 38.0 38.0 95-99 37.5989 38.0 38.0 38.0 38.0 38.0 100-104 37.532349999999994 38.0 38.0 38.0 38.0 38.0 105-109 37.514300000000006 38.0 38.0 38.0 38.0 38.0 110-114 37.468 38.0 38.0 38.0 38.0 38.0 115-119 37.42015 38.0 38.0 38.0 37.6 38.0 120-124 37.378699999999995 38.0 38.0 38.0 37.2 38.0 125-129 37.31165 38.0 38.0 38.0 37.0 38.0 130-134 37.2141 38.0 38.0 38.0 36.6 38.0 135-139 37.21235 38.0 38.0 38.0 36.0 38.0 140-144 37.08045 38.0 38.0 38.0 36.0 38.0 145-149 36.9211 38.0 38.0 38.0 35.8 38.0 150-151 34.931124999999994 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 3.0 19 1.0 20 1.0 21 2.0 22 1.0 23 2.0 24 4.0 25 1.0 26 2.0 27 5.0 28 3.0 29 2.0 30 9.0 31 9.0 32 20.0 33 24.0 34 29.0 35 59.0 36 198.0 37 3623.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.764219493861184 14.40741668754698 6.639939864695565 28.18842395389627 2 23.9 12.275 32.225 31.6 3 18.775 19.075 27.875 34.275 4 22.175 23.0 25.825 28.999999999999996 5 21.732598898347522 29.26890335503255 25.7386079118678 23.25988983475213 6 22.102628285356694 33.06633291614518 23.9549436795995 20.876095118898625 7 16.55 28.325 38.775 16.35 8 18.25 27.625 29.849999999999998 24.275 9 17.75 26.55 33.074999999999996 22.625 10-14 19.89 30.009999999999998 27.955000000000002 22.145 15-19 20.544999999999998 28.895 27.500000000000004 23.06 20-24 20.34 28.860000000000003 27.705000000000002 23.095 25-29 20.169999999999998 29.24 27.455000000000002 23.135 30-34 20.32 29.409999999999997 27.075 23.195 35-39 20.585 29.599999999999998 26.375 23.44 40-44 20.23 29.01 27.595 23.165 45-49 19.99 28.799999999999997 27.18 24.03 50-54 20.45 29.220000000000002 26.935 23.395 55-59 20.375 28.345 26.965 24.315 60-64 20.275000000000002 28.1 27.815 23.810000000000002 65-69 20.560000000000002 28.425 27.125 23.89 70-74 20.91 28.37 27.255000000000003 23.465 75-79 20.375 28.515 27.67 23.44 80-84 20.26 27.27 27.834999999999997 24.635 85-89 20.495 28.77 26.625 24.11 90-94 20.990000000000002 27.685 27.405 23.919999999999998 95-99 20.9 27.785 27.284999999999997 24.03 100-104 21.265 28.155 27.175 23.405 105-109 21.29 27.584999999999997 27.644999999999996 23.48 110-114 20.74 27.500000000000004 27.37 24.39 115-119 20.685000000000002 28.09 26.884999999999998 24.34 120-124 20.745 27.845 27.02 24.39 125-129 20.85208520852085 27.607760776077605 27.40774077407741 24.132413241324134 130-134 21.015 26.935 27.650000000000002 24.4 135-139 21.195 27.41 27.250000000000004 24.145 140-144 20.94209420942094 27.77777777777778 27.21272127212721 24.067406740674066 145-149 20.825 27.265 27.32 24.59 150-151 20.697878749843102 27.57625203966361 27.5637002635873 24.162168946905986 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 2.5 25 2.5 26 3.5 27 6.5 28 11.0 29 11.5 30 13.0 31 25.0 32 36.5 33 41.5 34 58.5 35 84.0 36 97.0 37 117.0 38 141.0 39 146.5 40 163.5 41 193.5 42 223.5 43 231.5 44 244.0 45 252.5 46 243.0 47 254.5 48 237.5 49 202.0 50 178.5 51 149.5 52 126.5 53 112.5 54 93.5 55 68.5 56 53.0 57 46.0 58 36.5 59 27.0 60 17.0 61 14.0 62 10.0 63 3.5 64 2.0 65 2.0 66 1.5 67 1.0 68 2.5 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.15 6 0.125 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.41250000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.0875 0.0 0.0 0.0 0.0 120-121 0.1125 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.175 0.0 0.0 0.0 0.0 126-127 0.2 0.0 0.0 0.0 0.0 128-129 0.2375 0.0 0.0 0.0 0.0 130-131 0.275 0.0 0.0 0.0 0.0 132-133 0.325 0.0 0.0 0.0 0.0 134-135 0.42500000000000004 0.0 0.0 0.0 0.0 136-137 0.5125 0.0 0.0 0.0 0.0 138-139 0.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7495380 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495380_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.451 34.0 33.0 34.0 33.0 34.0 2 33.54975 34.0 33.0 34.0 33.0 34.0 3 33.41325 34.0 33.0 34.0 33.0 34.0 4 33.44525 34.0 33.0 34.0 33.0 34.0 5 33.48225 34.0 33.0 34.0 33.0 34.0 6 37.55275 38.0 38.0 38.0 38.0 38.0 7 37.4865 38.0 38.0 38.0 38.0 38.0 8 37.4995 38.0 38.0 38.0 38.0 38.0 9 37.53375 38.0 38.0 38.0 38.0 38.0 10-14 37.48895 38.0 38.0 38.0 38.0 38.0 15-19 37.41345 38.0 38.0 38.0 38.0 38.0 20-24 37.3898 38.0 38.0 38.0 38.0 38.0 25-29 37.422900000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.5158 38.0 38.0 38.0 38.0 38.0 35-39 37.58915 38.0 38.0 38.0 38.0 38.0 40-44 37.595 38.0 38.0 38.0 38.0 38.0 45-49 37.53655 38.0 38.0 38.0 38.0 38.0 50-54 37.483850000000004 38.0 38.0 38.0 38.0 38.0 55-59 37.373599999999996 38.0 38.0 38.0 38.0 38.0 60-64 37.42999999999999 38.0 38.0 38.0 38.0 38.0 65-69 37.39625 38.0 38.0 38.0 38.0 38.0 70-74 37.3038 38.0 38.0 38.0 38.0 38.0 75-79 37.363800000000005 38.0 38.0 38.0 38.0 38.0 80-84 37.42895 38.0 38.0 38.0 38.0 38.0 85-89 37.409000000000006 38.0 38.0 38.0 38.0 38.0 90-94 37.34715 38.0 38.0 38.0 38.0 38.0 95-99 37.356 38.0 38.0 38.0 38.0 38.0 100-104 37.1592 38.0 38.0 38.0 38.0 38.0 105-109 37.049699999999994 38.0 38.0 38.0 38.0 38.0 110-114 36.954750000000004 38.0 38.0 38.0 38.0 38.0 115-119 36.90650000000001 38.0 38.0 38.0 38.0 38.0 120-124 36.88945 38.0 38.0 38.0 38.0 38.0 125-129 37.0332 38.0 38.0 38.0 38.0 38.0 130-134 36.96775 38.0 38.0 38.0 37.6 38.0 135-139 36.95935 38.0 38.0 38.0 36.8 38.0 140-144 36.8741 38.0 38.0 38.0 36.0 38.0 145-149 36.8053 38.0 38.0 38.0 36.2 38.0 150-151 34.996875 38.0 36.0 38.0 30.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 2.0 5 3.0 6 1.0 7 1.0 8 2.0 9 0.0 10 1.0 11 3.0 12 4.0 13 3.0 14 3.0 15 3.0 16 7.0 17 6.0 18 5.0 19 7.0 20 4.0 21 4.0 22 4.0 23 3.0 24 5.0 25 5.0 26 5.0 27 5.0 28 3.0 29 12.0 30 15.0 31 12.0 32 16.0 33 21.0 34 21.0 35 36.0 36 110.0 37 3665.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.025 24.85 9.875 21.25 2 24.575 30.2 27.800000000000004 17.424999999999997 3 21.184738955823292 28.815261044176705 31.350401606425706 18.649598393574294 4 25.319949811794228 32.52195734002509 22.55959849435383 19.59849435382685 5 25.206715108995237 35.75544976196442 21.322976697569533 17.71485843147081 6 21.421396283274735 37.51883475640382 22.65193370165746 18.407835258663987 7 21.01030409650666 23.096255340537823 35.86328223171651 20.030158331239004 8 20.954773869346734 25.27638190954774 27.311557788944725 26.457286432160803 9 21.73694779116466 26.48092369477912 28.363453815261042 23.41867469879518 10-14 23.86672027339431 28.60086440848326 25.856870037189665 21.675545280932756 15-19 23.27781411965984 27.826699542092285 27.026619030845872 21.868867307402002 20-24 23.698519786527037 28.592286778773534 26.69922465008559 21.009968784613836 25-29 22.932689890916404 28.38184285929724 26.96928567837933 21.716181571407027 30-34 22.914683633084515 28.004608987525675 27.508641851610644 21.57206552777917 35-39 23.462346234623464 27.30773077307731 26.927692769276927 22.302230223022303 40-44 23.196959087726317 27.70331099329799 27.07812343703111 22.021606481944584 45-49 23.450552748736932 27.727477364814167 27.177229753389025 21.644740133059877 50-54 23.303450693644514 27.430259928882656 27.500375619772626 21.765913757700204 55-59 23.613065326633166 27.56281407035176 26.979899497487438 21.844221105527637 60-64 23.683023407348003 27.86326499924816 26.680366898902307 21.773344694501528 65-69 23.4425982631394 27.59901611364891 27.3731238391647 21.585261784046985 70-74 23.929990444097974 27.505909570990294 26.58552532314037 21.978574661771365 75-79 23.20569366479551 27.29550922213312 27.360665597433844 22.13813151563753 80-84 23.993196257941868 28.02541397768773 26.829756366001302 21.151633398369103 85-89 23.911955977988995 27.253626813406704 27.473736868434216 21.360680340170084 90-94 23.931965982991496 27.523761880940473 27.373686843421712 21.170585292646322 95-99 23.796898449224614 27.408704352176088 27.283641820910454 21.510755377688845 100-104 23.766703506480457 27.574600622927758 27.202853411031853 21.455842459559932 105-109 23.40618390573069 27.812468526538424 27.545573572363786 21.235773995367108 110-114 23.19600625283647 27.830164893348798 27.073773385104126 21.900055468710605 115-119 23.76337573187967 27.35715727841712 27.38239450837876 21.49707248132445 120-124 23.764919172080376 27.41098856826308 27.20451226267815 21.619579996978395 125-129 23.830533968413135 27.686136876410128 27.475557783905742 21.007771371270994 130-134 24.551917492740564 27.600881145489137 26.789826774807253 21.05737458696305 135-139 23.584150490294174 27.936762057234343 26.91614968981389 21.562937762657594 140-144 23.38253690267701 27.380535401551164 27.960970728046036 21.275956967725797 145-149 23.88171720204143 27.199039327529274 27.84449114380066 21.07475232662864 150-151 23.393283863664948 27.141240095585463 27.744937743680044 21.72053829706955 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 2.0 18 2.0 19 1.5 20 2.0 21 1.5 22 3.0 23 3.0 24 4.0 25 5.0 26 2.5 27 4.5 28 7.0 29 8.5 30 10.5 31 17.5 32 28.0 33 26.5 34 34.5 35 45.0 36 53.5 37 79.5 38 108.0 39 122.5 40 153.0 41 201.0 42 241.0 43 257.0 44 266.0 45 273.5 46 268.0 47 264.0 48 248.0 49 231.5 50 203.5 51 175.0 52 145.5 53 111.0 54 94.0 55 75.5 56 57.0 57 42.0 58 33.5 59 31.0 60 23.0 61 12.5 62 4.5 63 5.0 64 5.0 65 1.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.4 4 0.375 5 0.22499999999999998 6 0.44999999999999996 7 0.525 8 0.5 9 0.4 10-14 0.51 15-19 0.635 20-24 0.69 25-29 0.5349999999999999 30-34 0.19499999999999998 35-39 0.01 40-44 0.03 45-49 0.045 50-54 0.165 55-59 0.5 60-64 0.245 65-69 0.395 70-74 0.585 75-79 0.24 80-84 0.055 85-89 0.05 90-94 0.05 95-99 0.05 100-104 0.47000000000000003 105-109 0.7100000000000001 110-114 0.845 115-119 0.9400000000000001 120-124 0.715 125-129 0.27499999999999997 130-134 0.13 135-139 0.06 140-144 0.075 145-149 0.06999999999999999 150-151 0.6125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19314170448816 98.35000000000001 2 0.7816439737771054 1.55 3 0.0 0.0 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.0875 0.0 0.0 0.0 0.0 120-121 0.1125 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.175 0.0 0.0 0.0 0.0 126-127 0.2 0.0 0.0 0.0 0.0 128-129 0.2375 0.0 0.0 0.0 0.0 130-131 0.275 0.0 0.0 0.0 0.0 132-133 0.325 0.0 0.0 0.0 0.0 134-135 0.42500000000000004 0.0 0.0 0.0 0.0 136-137 0.5125 0.0 0.0 0.0 0.0 138-139 0.5874999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458641 spots for SRR7495380.sra Written 458641 spots for SRR7495380.sra Read 458654 spots for SRR7495380.sra Written 458654 spots for SRR7495380.sra SRR ids: ['SRR7495380.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w06j5lys SRR7495380.sra spots: 9172833 blocks: [[1, 458641], [458642, 917282], [917283, 1375923], [1375924, 1834564], [1834565, 2293205], [2293206, 2751846], [2751847, 3210487], [3210488, 3669128], [3669129, 4127769], [4127770, 4586410], [4586411, 5045051], [5045052, 5503692], [5503693, 5962333], [5962334, 6420974], [6420975, 6879615], [6879616, 7338256], [7338257, 7796897], [7796898, 8255538], [8255539, 8714179], [8714180, 9172833]] SRR7495380 file size 3088287 SRR7495380 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7495380 SRR7495380_1.fastq SRR7495380_2.fastq Input file: SRR7495380_1.fastq Paired file: SRR7495380_2.fastq trimmed: SRR7495380-trimmed-pair1.fastq, SRR7495380-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:15:01 2025 >> started Mon Feb 10 18:15:11 2025 >> done (10.293s) 9172833 read pairs processed; of these: 8094 ( 0.09%) short read pairs filtered out after trimming by size control 6550 ( 0.07%) empty read pairs filtered out after trimming by size control 9158189 (99.84%) read pairs available; of these: 1570713 (17.15%) trimmed read pairs available after processing 7587476 (82.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 6 0.00% 20 3 0.00% 21 3 0.00% 22 0 0.00% 23 2 0.00% 24 2 0.00% 25 3 0.00% 26 4 0.00% 27 3 0.00% 28 4 0.00% 29 5 0.00% 30 5 0.00% 31 2 0.00% 32 3 0.00% 33 3 0.00% 34 4 0.00% 35 4 0.00% 36 2 0.00% 37 8 0.00% 38 4 0.00% 39 0 0.00% 40 4 0.00% 41 3 0.00% 42 4 0.00% 43 3 0.00% 44 1 0.00% 45 4 0.00% 46 7 0.00% 47 7 0.00% 48 4 0.00% 49 5 0.00% 50 4 0.00% 51 1 0.00% 52 11 0.00% 53 15 0.00% 54 8 0.00% 55 8 0.00% 56 15 0.00% 57 17 0.00% 58 21 0.00% 59 16 0.00% 60 11 0.00% 61 20 0.00% 62 23 0.00% 63 24 0.00% 64 26 0.00% 65 17 0.00% 66 31 0.00% 67 30 0.00% 68 29 0.00% 69 40 0.00% 70 44 0.00% 71 41 0.00% 72 52 0.00% 73 59 0.00% 74 56 0.00% 75 83 0.00% 76 86 0.00% 77 122 0.00% 78 115 0.00% 79 108 0.00% 80 107 0.00% 81 132 0.00% 82 156 0.00% 83 182 0.00% 84 572 0.01% 85 846 0.01% 86 907 0.01% 87 928 0.01% 88 988 0.01% 89 991 0.01% 90 1021 0.01% 91 1043 0.01% 92 971 0.01% 93 1006 0.01% 94 987 0.01% 95 1054 0.01% 96 1090 0.01% 97 1099 0.01% 98 1130 0.01% 99 1159 0.01% 100 1206 0.01% 101 1329 0.01% 102 1388 0.02% 103 1525 0.02% 104 1537 0.02% 105 1671 0.02% 106 1710 0.02% 107 1749 0.02% 108 1968 0.02% 109 1998 0.02% 110 2038 0.02% 111 2251 0.02% 112 2370 0.03% 113 2588 0.03% 114 2556 0.03% 115 2677 0.03% 116 3015 0.03% 117 3155 0.03% 118 3211 0.04% 119 3416 0.04% 120 3590 0.04% 121 3907 0.04% 122 3914 0.04% 123 4271 0.05% 124 4230 0.05% 125 4517 0.05% 126 4701 0.05% 127 4802 0.05% 128 4954 0.05% 129 5059 0.06% 130 5445 0.06% 131 5556 0.06% 132 5836 0.06% 133 6191 0.07% 134 6522 0.07% 135 6686 0.07% 136 7187 0.08% 137 7682 0.08% 138 8271 0.09% 139 9004 0.10% 140 10212 0.11% 141 10624 0.12% 142 11538 0.13% 143 15540 0.17% 144 17678 0.19% 145 26836 0.29% 146 23285 0.25% 147 40173 0.44% 148 52378 0.57% 149 120684 1.32% 150 1068468 11.67% 151 7587476 82.85% 9158189 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=22 prefix-density=0.57 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=23.07 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.7 sequence=AAAAAAATTGAAACGATATATCAAGTTCGGGACAAGTAGTACATCATGTGGAGATCGAGTTTATGCGAAGGTTCGAAATAGATAAATACAAGTTCCTAATCAAAAAGCCCTACTATTTTCATGCATCAACTATCTCTCCAGCCTCAGCAGCAGCAAGCACAAGCTCTGGCTGTAGACTGAATGTTCCATCTAGGGCATTTGG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=27 prefix-density=0.46 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=24.02 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.4 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7495380 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:16:54 Started mapping on | Feb 10 18:16:55 Finished on | Feb 10 18:17:52 Mapping speed, Million of reads per hour | 578.41 Number of input reads | 9158189 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 8608497 Uniquely mapped reads % | 94.00% Average mapped length | 299.39 Number of splices: Total | 8203587 Number of splices: Annotated (sjdb) | 8085823 Number of splices: GT/AG | 8059304 Number of splices: GC/AG | 128157 Number of splices: AT/AC | 4861 Number of splices: Non-canonical | 11265 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 192505 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 23777 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 365444 365444 365444 N_multimapping 192505 192505 192505 N_noFeature 190251 8493842 217977 N_ambiguous 136951 446 49833 UnstrandedReadsAssigned:8281295 PositiveStrandReadsAssigned:114209 NegativeStrandReadsAssigned:8340687 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7495380 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7495380-trimmed-pair1.fastq SRR7495380-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,158,189 reads, 8,436,970 reads pseudoaligned [quant] estimated average fragment length: 302.956 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,026 rounds 52401 SRR7495380.ke.tsv 34699 SRR7495380.se.tsv 87100 total ==> SRR7495380.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1716.04 189 10.5189 Potri.005G024800.1.v4.1 1035 733.044 128 16.677 Potri.004G059700.1.v4.1 961 659.059 14 2.02881 Potri.007G009000.2.v4.1 1416 1114.04 0 0 Potri.003G141000.2.v4.1 2943 2641.04 476 17.2135 Potri.016G087400.1.v4.1 270 50.8419 298 559.798 Potri.015G069301.1.v4.1 564 268.483 0 0 Potri.010G195200.1.v4.1 1773 1471.04 23.8314 1.54725 Potri.012G127500.1.v4.1 977 675.049 369 52.2069 ==> SRR7495380.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 294 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 144 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 62 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7495380 completed mapping pipeline successfully