Starting /dee2/code/volunteer_pipeline.sh SRR7495381 current disk space = 3057665073152 free memory = 1144109880 SRR7495381 SRAfilesize 9ae30c77281690d358e62723bdfceba1 SRR7495381.sra SRR7495381.sra file validated SRR7495381 is paired end SRR7495381 is conventional basespace SRR7495381 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495381_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.07925 18.0 18.0 25.0 18.0 32.0 2 29.00075 29.0 27.0 31.0 27.0 33.0 3 32.134 32.0 32.0 33.0 32.0 33.0 4 32.75475 33.0 33.0 33.0 32.0 33.0 5 32.66775 33.0 33.0 33.0 32.0 34.0 6 37.45675 38.0 38.0 38.0 37.0 38.0 7 37.77525 38.0 38.0 38.0 38.0 38.0 8 37.805 38.0 38.0 38.0 38.0 38.0 9 37.83975 38.0 38.0 38.0 38.0 38.0 10-14 37.85825 38.0 38.0 38.0 38.0 38.0 15-19 37.88595 38.0 38.0 38.0 38.0 38.0 20-24 37.8767 38.0 38.0 38.0 38.0 38.0 25-29 37.8525 38.0 38.0 38.0 38.0 38.0 30-34 37.84739999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.843 38.0 38.0 38.0 38.0 38.0 40-44 37.850849999999994 38.0 38.0 38.0 38.0 38.0 45-49 37.82145 38.0 38.0 38.0 38.0 38.0 50-54 37.774449999999995 38.0 38.0 38.0 38.0 38.0 55-59 37.775 38.0 38.0 38.0 38.0 38.0 60-64 37.7567 38.0 38.0 38.0 38.0 38.0 65-69 37.715999999999994 38.0 38.0 38.0 38.0 38.0 70-74 37.6991 38.0 38.0 38.0 38.0 38.0 75-79 37.678700000000006 38.0 38.0 38.0 38.0 38.0 80-84 37.65304999999999 38.0 38.0 38.0 38.0 38.0 85-89 37.6315 38.0 38.0 38.0 38.0 38.0 90-94 37.586149999999996 38.0 38.0 38.0 38.0 38.0 95-99 37.552949999999996 38.0 38.0 38.0 38.0 38.0 100-104 37.49455 38.0 38.0 38.0 38.0 38.0 105-109 37.4448 38.0 38.0 38.0 37.6 38.0 110-114 37.41995 38.0 38.0 38.0 37.2 38.0 115-119 37.3784 38.0 38.0 38.0 37.0 38.0 120-124 37.2981 38.0 38.0 38.0 37.0 38.0 125-129 37.18755 38.0 38.0 38.0 36.0 38.0 130-134 37.101 38.0 38.0 38.0 36.0 38.0 135-139 37.081149999999994 38.0 38.0 38.0 36.0 38.0 140-144 37.0296 38.0 38.0 38.0 35.8 38.0 145-149 36.83335 38.0 38.0 38.0 35.2 38.0 150-151 34.92425 38.0 36.0 38.0 29.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 0.0 18 0.0 19 4.0 20 0.0 21 3.0 22 1.0 23 1.0 24 1.0 25 1.0 26 3.0 27 7.0 28 4.0 29 7.0 30 8.0 31 9.0 32 16.0 33 18.0 34 34.0 35 86.0 36 260.0 37 3535.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.515546639919755 21.915747241725175 7.021063189568706 32.54764292878636 2 22.675 13.55 32.45 31.324999999999996 3 17.4 17.825 26.724999999999998 38.05 4 21.9 22.725 24.8 30.575000000000003 5 22.597597597597595 29.654654654654657 23.873873873873876 23.873873873873876 6 21.45536384096024 33.13328332083021 23.730932733183295 21.680420105026258 7 15.35 27.85 37.625 19.175 8 17.7 27.950000000000003 30.55 23.799999999999997 9 17.75 24.925 34.4 22.925 10-14 19.705000000000002 29.585 27.060000000000002 23.65 15-19 19.475 29.165000000000003 27.185 24.175 20-24 20.395 28.285 27.26 24.060000000000002 25-29 19.72 28.910000000000004 27.425 23.945 30-34 19.425 28.599999999999998 27.965 24.01 35-39 20.07 28.244999999999997 27.67 24.015 40-44 20.47 28.194999999999997 27.08 24.255 45-49 20.5 28.050000000000004 27.58 23.87 50-54 20.335 28.084999999999997 27.12 24.46 55-59 19.84 27.944999999999997 27.865000000000002 24.349999999999998 60-64 20.29 28.28 27.279999999999998 24.15 65-69 20.330000000000002 27.88 27.255000000000003 24.535 70-74 20.165 28.165000000000003 27.54 24.13 75-79 19.99 27.91 27.38 24.72 80-84 19.59 27.560000000000002 27.839999999999996 25.009999999999998 85-89 19.615 28.425 27.525 24.435000000000002 90-94 20.560000000000002 27.694999999999997 27.765 23.98 95-99 20.419999999999998 27.48 27.435 24.665 100-104 20.044999999999998 27.93 27.43 24.595 105-109 20.830000000000002 27.250000000000004 27.589999999999996 24.33 110-114 19.919999999999998 27.860000000000003 27.715 24.505 115-119 20.200000000000003 28.165000000000003 27.034999999999997 24.6 120-124 20.385 28.015 27.255000000000003 24.345 125-129 20.89 27.575 27.21 24.325 130-134 20.66 27.950000000000003 27.560000000000002 23.830000000000002 135-139 21.015 27.189999999999998 27.794999999999998 24.0 140-144 21.035 27.845 27.515 23.605 145-149 20.330000000000002 27.605 27.439999999999998 24.625 150-151 20.749749247743228 27.106318956870613 27.344533600802407 24.799398194583752 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 2.0 25 1.5 26 2.5 27 4.5 28 10.0 29 11.5 30 13.0 31 22.0 32 26.0 33 39.5 34 54.0 35 59.0 36 72.0 37 91.5 38 116.0 39 141.5 40 189.0 41 216.5 42 207.0 43 240.0 44 269.0 45 254.5 46 258.0 47 258.0 48 247.5 49 235.0 50 199.0 51 158.0 52 140.0 53 118.0 54 89.0 55 63.5 56 44.0 57 43.0 58 32.5 59 22.0 60 15.5 61 9.0 62 6.5 63 4.5 64 3.0 65 3.0 66 2.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.1 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1375 0.0 0.0 0.0 0.0 114-115 0.1875 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.21250000000000002 0.0 0.0 0.0 0.0 122-123 0.2625 0.0 0.0 0.0 0.0 124-125 0.2875 0.0 0.0 0.0 0.0 126-127 0.3875 0.0 0.0 0.0 0.0 128-129 0.4125 0.0 0.0 0.0 0.0 130-131 0.425 0.0 0.0 0.0 0.0 132-133 0.475 0.0 0.0 0.0 0.0 134-135 0.475 0.0 0.0 0.0 0.0 136-137 0.475 0.0 0.0 0.0 0.0 138-139 0.5375000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTAT 10 0.006830828 145.0 4 >>END_MODULE SRR7495381 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495381_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3765 34.0 33.0 34.0 33.0 34.0 2 33.49275 34.0 33.0 34.0 33.0 34.0 3 33.41325 34.0 33.0 34.0 33.0 34.0 4 33.4515 34.0 33.0 34.0 33.0 34.0 5 33.5035 34.0 33.0 34.0 33.0 34.0 6 37.541 38.0 38.0 38.0 38.0 38.0 7 37.524 38.0 38.0 38.0 38.0 38.0 8 37.535 38.0 38.0 38.0 38.0 38.0 9 37.59375 38.0 38.0 38.0 38.0 38.0 10-14 37.4863 38.0 38.0 38.0 38.0 38.0 15-19 37.3952 38.0 38.0 38.0 38.0 38.0 20-24 37.32715 38.0 38.0 38.0 38.0 38.0 25-29 37.4174 38.0 38.0 38.0 38.0 38.0 30-34 37.63465 38.0 38.0 38.0 38.0 38.0 35-39 37.706050000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.6837 38.0 38.0 38.0 38.0 38.0 45-49 37.67334999999999 38.0 38.0 38.0 38.0 38.0 50-54 37.6442 38.0 38.0 38.0 38.0 38.0 55-59 37.43775 38.0 38.0 38.0 38.0 38.0 60-64 37.5609 38.0 38.0 38.0 38.0 38.0 65-69 37.52130000000001 38.0 38.0 38.0 38.0 38.0 70-74 37.40725 38.0 38.0 38.0 38.0 38.0 75-79 37.495050000000006 38.0 38.0 38.0 38.0 38.0 80-84 37.51649999999999 38.0 38.0 38.0 38.0 38.0 85-89 37.529250000000005 38.0 38.0 38.0 38.0 38.0 90-94 37.47765 38.0 38.0 38.0 38.0 38.0 95-99 37.480000000000004 38.0 38.0 38.0 38.0 38.0 100-104 37.2863 38.0 38.0 38.0 38.0 38.0 105-109 37.0927 38.0 38.0 38.0 38.0 38.0 110-114 36.9911 38.0 38.0 38.0 38.0 38.0 115-119 36.886449999999996 38.0 38.0 38.0 37.2 38.0 120-124 36.942750000000004 38.0 38.0 38.0 37.0 38.0 125-129 37.16925 38.0 38.0 38.0 37.2 38.0 130-134 37.16029999999999 38.0 38.0 38.0 36.6 38.0 135-139 37.0766 38.0 38.0 38.0 36.0 38.0 140-144 37.08885 38.0 38.0 38.0 36.0 38.0 145-149 37.0115 38.0 38.0 38.0 36.0 38.0 150-151 35.120625000000004 38.0 36.0 38.0 30.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 1.0 6 2.0 7 1.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 4.0 18 6.0 19 2.0 20 6.0 21 3.0 22 4.0 23 11.0 24 3.0 25 4.0 26 5.0 27 8.0 28 5.0 29 7.0 30 13.0 31 22.0 32 19.0 33 17.0 34 36.0 35 51.0 36 160.0 37 3602.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.625 25.0 10.05 24.325 2 24.025 29.95 29.175 16.85 3 19.45837512537613 28.711133400200602 31.745235707121367 20.085255767301906 4 22.294589178356713 34.5440881763527 24.574148296593187 18.587174348697395 5 23.942957217913435 35.876907680760574 21.61621215911934 18.563922942206652 6 20.642893018583628 36.8407835258664 23.63134103465595 18.884982420894023 7 20.51282051282051 23.40372046254399 36.97838109602816 19.10507792860734 8 21.30653266331658 26.407035175879397 27.28643216080402 25.0 9 21.53961885656971 26.1283851554664 28.91173520561685 23.42026078234704 10-14 23.192559074912015 29.06485671191554 26.063348416289596 21.679235796882857 15-19 23.73444819422757 28.489397068453133 26.620661864705585 21.15549287261371 20-24 22.787621788076127 28.6586904942198 26.80599727396638 21.747690443737692 25-29 22.939194286576473 29.442237086958706 26.163053865110896 21.455514761353918 30-34 23.49762321741306 28.116087065298974 27.250437828371275 21.135851888916687 35-39 22.985 28.175 27.0 21.84 40-44 22.947294729472947 27.262726272627262 27.797779777977798 21.992199219921993 45-49 22.756137806890344 27.951397569878495 27.51637581879094 21.77608880444022 50-54 22.667467106908802 27.73025163840112 27.530141577867827 22.072139676822253 55-59 23.9006985275642 27.624503743906732 27.262676516407858 21.21212121212121 60-64 22.812374849819783 27.503003604325187 27.47797356828194 22.206647977573088 65-69 22.976632233477083 27.554909236786678 27.093571356935115 22.374887172801124 70-74 23.404790660225444 27.903582930756844 26.464371980676326 22.227254428341382 75-79 22.587268993839835 27.986177192367407 27.28001201983272 22.146541793960033 80-84 24.007400740074008 27.86278627862786 26.092609260926093 22.037203720372037 85-89 23.284656931386277 27.50550110022004 27.170434086817362 22.039407881576313 90-94 23.54853227984198 28.059208881332196 26.814022103315498 21.578236735510327 95-99 23.40585146286572 27.446861715428856 27.176794198549636 21.97049262315579 100-104 24.262970217467732 26.985083622118427 27.36175983124906 21.390186329164784 105-109 23.31449333871619 28.224666935809445 26.937828017763422 21.52301170771094 110-114 24.239663984616165 27.10895197611457 27.124133394059 21.527250645210263 115-119 24.040311961916338 27.64104122353894 27.215638610351462 21.103008204193255 120-124 23.55196770938446 27.653884964682142 26.962663975782036 21.831483350151363 125-129 23.93372046455747 27.317781337605123 27.34281137364838 21.405686824189026 130-134 24.029417650590354 27.821693015809483 26.95117070242145 21.19771863117871 135-139 23.85454181672669 27.73109243697479 27.21588635454182 21.198479391756702 140-144 23.8404963226097 28.143293140541353 26.527242707760045 21.48896782908891 145-149 23.926748724106876 27.58430901631142 27.14900430301211 21.3399379565696 150-151 24.256493913916426 27.908144058225627 27.23051825825072 20.60484376960723 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 2.5 23 4.0 24 4.0 25 5.0 26 5.0 27 3.0 28 4.0 29 6.0 30 10.5 31 12.5 32 17.0 33 28.0 34 34.5 35 47.0 36 66.5 37 81.0 38 108.0 39 155.5 40 197.0 41 211.0 42 228.0 43 272.0 44 289.5 45 278.5 46 276.0 47 274.0 48 241.0 49 215.0 50 199.5 51 153.0 52 120.0 53 102.5 54 83.0 55 63.0 56 46.0 57 40.5 58 35.0 59 26.5 60 19.0 61 9.5 62 6.5 63 7.0 64 4.0 65 2.0 66 2.0 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.3 4 0.2 5 0.075 6 0.44999999999999996 7 0.5499999999999999 8 0.5 9 0.3 10-14 0.5499999999999999 15-19 0.735 20-24 0.955 25-29 0.585 30-34 0.075 35-39 0.0 40-44 0.01 45-49 0.005 50-54 0.055 55-59 0.505 60-64 0.12 65-69 0.29 70-74 0.64 75-79 0.165 80-84 0.01 85-89 0.02 90-94 0.015 95-99 0.025 100-104 0.445 105-109 0.9199999999999999 110-114 1.195 115-119 1.27 120-124 0.8999999999999999 125-129 0.12 130-134 0.06 135-139 0.04 140-144 0.065 145-149 0.06999999999999999 150-151 0.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.73160832064941 97.3 2 1.1161846778285134 2.1999999999999997 3 0.10147133434804667 0.3 4 0.050735667174023336 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0125 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1375 0.0 0.0 0.0 0.0 114-115 0.1875 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.21250000000000002 0.0 0.0 0.0 0.0 122-123 0.2625 0.0 0.0 0.0 0.0 124-125 0.2875 0.0 0.0 0.0 0.0 126-127 0.3875 0.0 0.0 0.0 0.0 128-129 0.4125 0.0 0.0 0.0 0.0 130-131 0.425 0.0 0.0 0.0 0.0 132-133 0.475 0.0 0.0 0.0 0.0 134-135 0.475 0.0 0.0 0.0 0.0 136-137 0.475 0.0 0.0 0.0 0.0 138-139 0.5375000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGCCGC 10 0.006830828 145.0 145 >>END_MODULE Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra Read 559896 spots for SRR7495381.sra Written 559896 spots for SRR7495381.sra SRR ids: ['SRR7495381.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_br_696ts SRR7495381.sra spots: 11197920 blocks: [[1, 559896], [559897, 1119792], [1119793, 1679688], [1679689, 2239584], [2239585, 2799480], [2799481, 3359376], [3359377, 3919272], [3919273, 4479168], [4479169, 5039064], [5039065, 5598960], [5598961, 6158856], [6158857, 6718752], [6718753, 7278648], [7278649, 7838544], [7838545, 8398440], [8398441, 8958336], [8958337, 9518232], [9518233, 10078128], [10078129, 10638024], [10638025, 11197920]] SRR7495381 file size 3772907 SRR7495381 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7495381 SRR7495381_1.fastq SRR7495381_2.fastq Input file: SRR7495381_1.fastq Paired file: SRR7495381_2.fastq trimmed: SRR7495381-trimmed-pair1.fastq, SRR7495381-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:19:12 2025 >> started Mon Feb 10 18:19:23 2025 >> done (11.811s) 11197920 read pairs processed; of these: 3814 ( 0.03%) short read pairs filtered out after trimming by size control 9810 ( 0.09%) empty read pairs filtered out after trimming by size control 11184296 (99.88%) read pairs available; of these: 2044413 (18.28%) trimmed read pairs available after processing 9139883 (81.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 8 0.00% 20 3 0.00% 21 0 0.00% 22 5 0.00% 23 5 0.00% 24 5 0.00% 25 1 0.00% 26 2 0.00% 27 2 0.00% 28 2 0.00% 29 3 0.00% 30 6 0.00% 31 7 0.00% 32 0 0.00% 33 3 0.00% 34 0 0.00% 35 3 0.00% 36 1 0.00% 37 2 0.00% 38 4 0.00% 39 3 0.00% 40 3 0.00% 41 3 0.00% 42 3 0.00% 43 2 0.00% 44 8 0.00% 45 4 0.00% 46 3 0.00% 47 3 0.00% 48 1 0.00% 49 5 0.00% 50 6 0.00% 51 8 0.00% 52 2 0.00% 53 4 0.00% 54 9 0.00% 55 10 0.00% 56 9 0.00% 57 11 0.00% 58 10 0.00% 59 12 0.00% 60 24 0.00% 61 12 0.00% 62 10 0.00% 63 18 0.00% 64 31 0.00% 65 17 0.00% 66 24 0.00% 67 31 0.00% 68 36 0.00% 69 40 0.00% 70 33 0.00% 71 43 0.00% 72 53 0.00% 73 58 0.00% 74 56 0.00% 75 69 0.00% 76 96 0.00% 77 175 0.00% 78 154 0.00% 79 123 0.00% 80 131 0.00% 81 175 0.00% 82 164 0.00% 83 230 0.00% 84 433 0.00% 85 605 0.01% 86 640 0.01% 87 693 0.01% 88 744 0.01% 89 824 0.01% 90 844 0.01% 91 886 0.01% 92 935 0.01% 93 925 0.01% 94 1056 0.01% 95 1033 0.01% 96 1061 0.01% 97 1127 0.01% 98 1161 0.01% 99 1281 0.01% 100 1333 0.01% 101 1366 0.01% 102 1495 0.01% 103 1480 0.01% 104 1621 0.01% 105 1760 0.02% 106 1840 0.02% 107 1918 0.02% 108 2103 0.02% 109 2154 0.02% 110 2167 0.02% 111 2399 0.02% 112 2502 0.02% 113 2691 0.02% 114 2763 0.02% 115 3060 0.03% 116 3192 0.03% 117 3351 0.03% 118 3519 0.03% 119 3650 0.03% 120 3994 0.04% 121 4078 0.04% 122 4394 0.04% 123 4552 0.04% 124 4535 0.04% 125 4827 0.04% 126 5014 0.04% 127 5226 0.05% 128 5403 0.05% 129 5812 0.05% 130 6072 0.05% 131 6285 0.06% 132 6435 0.06% 133 6916 0.06% 134 7515 0.07% 135 8056 0.07% 136 8421 0.08% 137 9125 0.08% 138 9816 0.09% 139 10815 0.10% 140 12358 0.11% 141 12796 0.11% 142 14447 0.13% 143 18257 0.16% 144 20025 0.18% 145 33724 0.30% 146 31119 0.28% 147 54073 0.48% 148 72361 0.65% 149 167380 1.50% 150 1417983 12.68% 151 9139883 81.72% 11184296 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=19 prefix-density=0.65 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.31 sequence-density-rank=11 fanout-score=17.18 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=6.9 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=13 prefix-density=0.54 prefix-fanout=2.8 sequence=ACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=33.13 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACA SRR7495381 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:20:14 Started mapping on | Feb 10 18:20:14 Finished on | Feb 10 18:21:22 Mapping speed, Million of reads per hour | 592.11 Number of input reads | 11184296 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 10523628 Uniquely mapped reads % | 94.09% Average mapped length | 299.59 Number of splices: Total | 10460190 Number of splices: Annotated (sjdb) | 10318303 Number of splices: GT/AG | 10286377 Number of splices: GC/AG | 155642 Number of splices: AT/AC | 5628 Number of splices: Non-canonical | 12543 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 225513 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 10765 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.77% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 440087 440087 440087 N_multimapping 225513 225513 225513 N_noFeature 182336 10386376 218610 N_ambiguous 155075 492 53843 UnstrandedReadsAssigned:10186217 PositiveStrandReadsAssigned:136760 NegativeStrandReadsAssigned:10251175 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7495381 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7495381-trimmed-pair1.fastq SRR7495381-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,184,296 reads, 10,325,590 reads pseudoaligned [quant] estimated average fragment length: 355.985 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR7495381.ke.tsv 34699 SRR7495381.se.tsv 87100 total ==> SRR7495381.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1663.01 269 13.2823 Potri.005G024800.1.v4.1 1035 680.015 117 14.1282 Potri.004G059700.1.v4.1 961 606.109 10 1.35478 Potri.007G009000.2.v4.1 1416 1061.01 0 0 Potri.003G141000.2.v4.1 2943 2588.01 479 15.198 Potri.016G087400.1.v4.1 270 54.6107 421 633.027 Potri.015G069301.1.v4.1 564 225.139 0 0 Potri.010G195200.1.v4.1 1773 1418.01 20 1.15816 Potri.012G127500.1.v4.1 977 622.076 403 53.1961 ==> SRR7495381.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 336 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 131 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 70 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7495381 completed mapping pipeline successfully