Starting /dee2/code/volunteer_pipeline.sh SRR7495382 current disk space = 3057291751424 free memory = 1507171016 SRR7495382 SRAfilesize 7b82d90a11e046cf3e18947d87b02b62 SRR7495382.sra SRR7495382.sra file validated SRR7495382 is paired end SRR7495382 is conventional basespace SRR7495382 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495382_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.002 32.0 25.0 33.0 18.0 34.0 2 31.679 33.0 31.0 34.0 29.0 34.0 3 32.97525 33.0 33.0 34.0 32.0 34.0 4 32.87 33.0 33.0 33.0 32.0 34.0 5 33.036 33.0 33.0 34.0 33.0 34.0 6 37.31325 38.0 38.0 38.0 36.0 38.0 7 37.747 38.0 38.0 38.0 38.0 38.0 8 37.78475 38.0 38.0 38.0 38.0 38.0 9 37.88425 38.0 38.0 38.0 38.0 38.0 10-14 37.8677 38.0 38.0 38.0 38.0 38.0 15-19 37.851749999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.843599999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.8423 38.0 38.0 38.0 38.0 38.0 30-34 37.8319 38.0 38.0 38.0 38.0 38.0 35-39 37.81535 38.0 38.0 38.0 38.0 38.0 40-44 37.79145 38.0 38.0 38.0 38.0 38.0 45-49 37.768350000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.7438 38.0 38.0 38.0 38.0 38.0 55-59 37.7471 38.0 38.0 38.0 38.0 38.0 60-64 37.689800000000005 38.0 38.0 38.0 38.0 38.0 65-69 37.69435 38.0 38.0 38.0 38.0 38.0 70-74 37.6677 38.0 38.0 38.0 38.0 38.0 75-79 37.632949999999994 38.0 38.0 38.0 38.0 38.0 80-84 37.652 38.0 38.0 38.0 38.0 38.0 85-89 37.621849999999995 38.0 38.0 38.0 38.0 38.0 90-94 37.6046 38.0 38.0 38.0 38.0 38.0 95-99 37.5366 38.0 38.0 38.0 38.0 38.0 100-104 37.4934 38.0 38.0 38.0 37.6 38.0 105-109 37.43245 38.0 38.0 38.0 37.0 38.0 110-114 37.4283 38.0 38.0 38.0 37.0 38.0 115-119 37.35549999999999 38.0 38.0 38.0 37.0 38.0 120-124 37.2608 38.0 38.0 38.0 36.8 38.0 125-129 37.21390000000001 38.0 38.0 38.0 36.0 38.0 130-134 37.106849999999994 38.0 38.0 38.0 36.0 38.0 135-139 37.063950000000006 38.0 38.0 38.0 35.8 38.0 140-144 36.95845 38.0 38.0 38.0 35.6 38.0 145-149 36.70005 38.0 38.0 38.0 35.0 38.0 150-151 34.7515 38.0 36.0 38.0 29.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 3.0 21 1.0 22 0.0 23 0.0 24 1.0 25 4.0 26 2.0 27 1.0 28 6.0 29 5.0 30 12.0 31 15.0 32 11.0 33 32.0 34 53.0 35 74.0 36 266.0 37 3512.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.88167460516421 11.506643268989722 8.072198546001504 32.53948357984457 2 22.45 12.525 33.900000000000006 31.125000000000004 3 19.05 19.325 26.474999999999998 35.15 4 22.525000000000002 24.0 25.25 28.225 5 23.533834586466167 30.350877192982455 24.862155388471177 21.2531328320802 6 21.065799349512133 34.07555666750062 24.69352014010508 20.165123842882164 7 15.5 26.150000000000002 40.925 17.424999999999997 8 18.2 26.724999999999998 30.099999999999998 24.975 9 17.599999999999998 24.575 34.300000000000004 23.525 10-14 19.935 29.34 27.794999999999998 22.93 15-19 20.085 28.115000000000002 28.025 23.775 20-24 20.04 27.57 28.395 23.995 25-29 19.725 28.955 27.279999999999998 24.04 30-34 19.794999999999998 28.634999999999998 27.694999999999997 23.875 35-39 20.36 28.22 27.534999999999997 23.885 40-44 20.560000000000002 28.754999999999995 26.765 23.919999999999998 45-49 20.085 28.265 27.83 23.82 50-54 19.919999999999998 28.410000000000004 27.58 24.09 55-59 20.395 28.139999999999997 27.860000000000003 23.605 60-64 19.665 28.605000000000004 27.68 24.05 65-69 20.09 28.095 27.455000000000002 24.36 70-74 20.14 27.88 27.925 24.055 75-79 20.335 28.15 27.88 23.635 80-84 20.46 27.900000000000002 27.905 23.735 85-89 20.19 28.43 27.275 24.104999999999997 90-94 20.735 28.095 27.22 23.95 95-99 20.43 27.47 27.339999999999996 24.759999999999998 100-104 20.455000000000002 27.875 27.72 23.95 105-109 20.735 27.62 27.625 24.02 110-114 20.335 28.04 27.474999999999998 24.15 115-119 20.57 28.04 27.250000000000004 24.14 120-124 20.3 27.334999999999997 28.01 24.355 125-129 20.825 27.345000000000002 27.625 24.205 130-134 20.565 27.205000000000002 27.935 24.295 135-139 20.485 28.15 27.034999999999997 24.33 140-144 20.599999999999998 27.675 27.705000000000002 24.02 145-149 20.595 27.224999999999998 27.175 25.005 150-151 21.329987452948558 27.565872020075282 27.139272271016313 23.96486825595985 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 0.5 25 2.0 26 3.5 27 4.5 28 6.5 29 9.5 30 14.0 31 18.0 32 26.5 33 32.5 34 42.5 35 60.0 36 85.0 37 106.0 38 136.5 39 173.5 40 183.0 41 191.5 42 226.5 43 252.5 44 269.0 45 278.5 46 266.5 47 260.5 48 241.0 49 216.0 50 183.0 51 153.5 52 115.5 53 93.5 54 92.0 55 65.0 56 49.5 57 35.0 58 24.5 59 25.5 60 19.5 61 11.5 62 6.0 63 3.5 64 4.0 65 3.5 66 1.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.25 6 0.075 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.05 0.0 0.0 0.0 0.0 124-125 0.0625 0.0 0.0 0.0 0.0 126-127 0.1 0.0 0.0 0.0 0.0 128-129 0.1 0.0 0.0 0.0 0.0 130-131 0.1375 0.0 0.0 0.0 0.0 132-133 0.15 0.0 0.0 0.0 0.0 134-135 0.175 0.0 0.0 0.0 0.0 136-137 0.2 0.0 0.0 0.0 0.0 138-139 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7495382 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495382_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.28625 34.0 33.0 34.0 33.0 34.0 2 33.4325 34.0 33.0 34.0 33.0 34.0 3 33.31375 34.0 33.0 34.0 33.0 34.0 4 33.30975 34.0 33.0 34.0 33.0 34.0 5 33.349 34.0 33.0 34.0 33.0 34.0 6 37.4315 38.0 38.0 38.0 38.0 38.0 7 37.39425 38.0 38.0 38.0 38.0 38.0 8 37.45725 38.0 38.0 38.0 38.0 38.0 9 37.429 38.0 38.0 38.0 38.0 38.0 10-14 37.3832 38.0 38.0 38.0 38.0 38.0 15-19 37.32225 38.0 38.0 38.0 38.0 38.0 20-24 37.239700000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.328450000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.5103 38.0 38.0 38.0 38.0 38.0 35-39 37.56715 38.0 38.0 38.0 38.0 38.0 40-44 37.59779999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.57455 38.0 38.0 38.0 38.0 38.0 50-54 37.49335 38.0 38.0 38.0 38.0 38.0 55-59 37.32595 38.0 38.0 38.0 38.0 38.0 60-64 37.43105 38.0 38.0 38.0 38.0 38.0 65-69 37.3593 38.0 38.0 38.0 38.0 38.0 70-74 37.244049999999994 38.0 38.0 38.0 38.0 38.0 75-79 37.36964999999999 38.0 38.0 38.0 38.0 38.0 80-84 37.42745 38.0 38.0 38.0 38.0 38.0 85-89 37.39225 38.0 38.0 38.0 38.0 38.0 90-94 37.349900000000005 38.0 38.0 38.0 38.0 38.0 95-99 37.307249999999996 38.0 38.0 38.0 38.0 38.0 100-104 37.1448 38.0 38.0 38.0 37.6 38.0 105-109 36.9101 38.0 38.0 38.0 37.0 38.0 110-114 36.810649999999995 38.0 38.0 38.0 37.0 38.0 115-119 36.7322 38.0 38.0 38.0 37.0 38.0 120-124 36.777499999999996 38.0 38.0 38.0 36.2 38.0 125-129 36.9464 38.0 38.0 38.0 36.0 38.0 130-134 36.88785 38.0 38.0 38.0 36.0 38.0 135-139 36.8107 38.0 38.0 38.0 36.0 38.0 140-144 36.763999999999996 38.0 38.0 38.0 36.0 38.0 145-149 36.71085 38.0 38.0 38.0 35.8 38.0 150-151 34.8615 38.0 36.0 38.0 29.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 0.0 4 2.0 5 0.0 6 1.0 7 1.0 8 2.0 9 0.0 10 1.0 11 3.0 12 1.0 13 0.0 14 2.0 15 1.0 16 5.0 17 4.0 18 3.0 19 3.0 20 4.0 21 9.0 22 5.0 23 4.0 24 7.0 25 11.0 26 5.0 27 9.0 28 5.0 29 15.0 30 15.0 31 19.0 32 26.0 33 20.0 34 38.0 35 65.0 36 197.0 37 3512.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.574999999999996 23.05 11.774999999999999 25.6 2 25.224999999999998 26.8 29.325000000000003 18.65 3 20.43630892678034 28.13440320962889 31.94583751253761 19.483450351053158 4 22.67602104735655 33.85116512152343 23.427712352793787 20.04510147832623 5 24.086129193790686 35.40310465698548 22.183274912368553 18.327491236855284 6 20.185789605824755 38.63921667085112 23.273914135074065 17.901079588250063 7 20.38712921065862 23.252890899949723 36.14881850175968 20.211161387631975 8 20.311323123273915 25.935224704996234 27.84333417022345 25.910118001506405 9 23.005519317611643 24.636226793778224 29.07676869041646 23.28148519819368 10-14 22.582268290228438 29.31468249974841 26.683103552379993 21.41994565764315 15-19 22.556921217005844 28.692323191617973 27.231513197662704 21.51924239371348 20-24 22.61075789686144 28.28236956302351 26.945201332122316 22.161671207992732 25-29 22.268061984302676 28.72308311531495 27.45522237874824 21.553632521634132 30-34 22.335686038944786 28.377634279421333 27.55168443710267 21.73499524453121 35-39 22.665 27.74 27.93 21.665 40-44 22.112211221122113 28.16781678167817 27.81278127812781 21.907190719071906 45-49 22.57612880644032 28.14140707035352 27.33136656832842 21.951097554877744 50-54 22.83169010560032 27.7663780591562 27.61623542365247 21.78569641159101 55-59 22.714249811510427 27.85121889922091 27.504398089972355 21.930133199296307 60-64 23.474907342482222 27.481718922167687 27.58188921165982 21.461484523690274 65-69 22.985853315942613 27.345239289655865 27.350255844286142 22.31865155011538 70-74 23.300286850183685 27.14508580343214 27.08972875044034 22.46489859594384 75-79 23.286916449609297 27.644760569024246 27.28912041675015 21.77920256461631 80-84 22.846854056216863 27.91337401220366 27.438231469440833 21.80154046213864 85-89 22.94188256476943 28.088426527958386 26.668000400120036 22.301690507152145 90-94 23.065766441610403 28.06201550387597 26.76169042260565 22.110527631907978 95-99 23.435545995698064 27.237256765544494 27.457355810114553 21.86984142864289 100-104 23.450216015271778 27.59971867778559 27.373656184065105 21.576409122877525 105-109 23.408334174149932 26.87922510342044 28.342245989304814 21.370194733124812 110-114 23.066424021838035 27.757557375391773 27.616014558689717 21.56000404408048 115-119 23.19097257362615 28.311911749822894 26.945653273960126 21.551462402590833 120-124 23.50716158967117 27.804115392374417 27.26447448053258 21.42424853742183 125-129 23.751315064375532 27.453534392064526 27.849306146986624 20.945844396573317 130-134 23.379224030037545 27.729662077596995 26.998748435544428 21.892365456821025 135-139 23.9153280288245 27.398288545263473 27.173097132562678 21.513286293349346 140-144 23.361866146067978 27.99719677629274 27.1462181508735 21.49471892676578 145-149 23.456975521850126 27.821995294588774 27.07613755819192 21.644891625369176 150-151 23.50502512562814 28.5678391959799 26.821608040201006 21.105527638190953 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.5 20 2.5 21 2.5 22 1.5 23 2.0 24 3.5 25 3.5 26 4.0 27 6.0 28 7.0 29 8.0 30 12.0 31 16.0 32 22.0 33 33.0 34 37.5 35 46.5 36 71.5 37 101.0 38 123.0 39 153.0 40 190.5 41 205.0 42 240.5 43 277.0 44 275.5 45 267.5 46 266.5 47 269.5 48 247.5 49 207.0 50 177.5 51 139.5 52 119.5 53 110.0 54 85.0 55 64.5 56 50.0 57 38.5 58 29.5 59 25.0 60 16.5 61 11.5 62 8.5 63 5.0 64 1.5 65 1.0 66 1.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.3 4 0.22499999999999998 5 0.15 6 0.42500000000000004 7 0.5499999999999999 8 0.42500000000000004 9 0.35000000000000003 10-14 0.63 15-19 0.74 20-24 0.91 25-29 0.62 30-34 0.11499999999999999 35-39 0.0 40-44 0.01 45-49 0.005 50-54 0.095 55-59 0.525 60-64 0.16999999999999998 65-69 0.33 70-74 0.645 75-79 0.18 80-84 0.03 85-89 0.03 90-94 0.025 95-99 0.045 100-104 0.47000000000000003 105-109 0.89 110-114 1.09 115-119 1.1900000000000002 120-124 0.86 125-129 0.19499999999999998 130-134 0.125 135-139 0.08499999999999999 140-144 0.11499999999999999 145-149 0.11499999999999999 150-151 0.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11616161616162 98.125 2 0.7828282828282829 1.55 3 0.07575757575757576 0.22499999999999998 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.05 0.0 0.0 0.0 0.0 124-125 0.0625 0.0 0.0 0.0 0.0 126-127 0.1 0.0 0.0 0.0 0.0 128-129 0.1 0.0 0.0 0.0 0.0 130-131 0.16249999999999998 0.0 0.0 0.0 0.0 132-133 0.175 0.0 0.0 0.0 0.0 134-135 0.2 0.0 0.0 0.0 0.0 136-137 0.225 0.0 0.0 0.0 0.0 138-139 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTGTCA 10 0.006832588 144.9875 9 >>END_MODULE Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra Read 635761 spots for SRR7495382.sra Written 635761 spots for SRR7495382.sra SRR ids: ['SRR7495382.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fbydzab6 SRR7495382.sra spots: 12715220 blocks: [[1, 635761], [635762, 1271522], [1271523, 1907283], [1907284, 2543044], [2543045, 3178805], [3178806, 3814566], [3814567, 4450327], [4450328, 5086088], [5086089, 5721849], [5721850, 6357610], [6357611, 6993371], [6993372, 7629132], [7629133, 8264893], [8264894, 8900654], [8900655, 9536415], [9536416, 10172176], [10172177, 10807937], [10807938, 11443698], [11443699, 12079459], [12079460, 12715220]] SRR7495382 file size 4287070 SRR7495382 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7495382 SRR7495382_1.fastq SRR7495382_2.fastq Input file: SRR7495382_1.fastq Paired file: SRR7495382_2.fastq trimmed: SRR7495382-trimmed-pair1.fastq, SRR7495382-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:53:33 2025 >> started Mon Feb 10 18:53:51 2025 >> done (17.782s) 12715220 read pairs processed; of these: 4987 ( 0.04%) short read pairs filtered out after trimming by size control 3925 ( 0.03%) empty read pairs filtered out after trimming by size control 12706308 (99.93%) read pairs available; of these: 2493366 (19.62%) trimmed read pairs available after processing 10212942 (80.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 6 0.00% 23 2 0.00% 24 0 0.00% 25 4 0.00% 26 1 0.00% 27 3 0.00% 28 5 0.00% 29 0 0.00% 30 2 0.00% 31 4 0.00% 32 2 0.00% 33 2 0.00% 34 2 0.00% 35 7 0.00% 36 1 0.00% 37 2 0.00% 38 1 0.00% 39 3 0.00% 40 3 0.00% 41 2 0.00% 42 4 0.00% 43 1 0.00% 44 2 0.00% 45 2 0.00% 46 7 0.00% 47 1 0.00% 48 3 0.00% 49 2 0.00% 50 2 0.00% 51 6 0.00% 52 6 0.00% 53 7 0.00% 54 3 0.00% 55 3 0.00% 56 9 0.00% 57 10 0.00% 58 9 0.00% 59 9 0.00% 60 8 0.00% 61 13 0.00% 62 10 0.00% 63 20 0.00% 64 17 0.00% 65 24 0.00% 66 32 0.00% 67 23 0.00% 68 26 0.00% 69 28 0.00% 70 30 0.00% 71 33 0.00% 72 42 0.00% 73 32 0.00% 74 51 0.00% 75 58 0.00% 76 76 0.00% 77 107 0.00% 78 85 0.00% 79 101 0.00% 80 112 0.00% 81 117 0.00% 82 152 0.00% 83 184 0.00% 84 478 0.00% 85 714 0.01% 86 723 0.01% 87 740 0.01% 88 854 0.01% 89 879 0.01% 90 866 0.01% 91 890 0.01% 92 927 0.01% 93 1006 0.01% 94 1048 0.01% 95 1026 0.01% 96 1076 0.01% 97 1113 0.01% 98 1150 0.01% 99 1241 0.01% 100 1330 0.01% 101 1408 0.01% 102 1427 0.01% 103 1579 0.01% 104 1494 0.01% 105 1652 0.01% 106 1782 0.01% 107 1826 0.01% 108 1897 0.01% 109 2041 0.02% 110 2226 0.02% 111 2249 0.02% 112 2416 0.02% 113 2841 0.02% 114 2801 0.02% 115 2913 0.02% 116 3131 0.02% 117 3279 0.03% 118 3404 0.03% 119 3768 0.03% 120 4137 0.03% 121 4256 0.03% 122 4461 0.04% 123 4760 0.04% 124 4854 0.04% 125 5095 0.04% 126 5308 0.04% 127 5527 0.04% 128 5835 0.05% 129 6113 0.05% 130 6351 0.05% 131 6685 0.05% 132 7138 0.06% 133 7518 0.06% 134 8160 0.06% 135 8855 0.07% 136 9548 0.08% 137 10203 0.08% 138 11439 0.09% 139 12588 0.10% 140 14514 0.11% 141 15621 0.12% 142 17502 0.14% 143 23687 0.19% 144 27519 0.22% 145 41611 0.33% 146 39614 0.31% 147 68368 0.54% 148 95764 0.75% 149 219330 1.73% 150 1729284 13.61% 151 10212942 80.38% 12706308 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=21 prefix-density=0.54 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=16.69 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.7 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGA criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=30 prefix-density=0.44 prefix-fanout=2.0 sequence=TCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=28 fanout-score=35.63 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=11.9 sequence=AAAGAAAAGAAAA SRR7495382 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:54:34 Started mapping on | Feb 10 18:54:34 Finished on | Feb 10 18:55:51 Mapping speed, Million of reads per hour | 594.06 Number of input reads | 12706308 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11788909 Uniquely mapped reads % | 92.78% Average mapped length | 299.60 Number of splices: Total | 11480587 Number of splices: Annotated (sjdb) | 11318166 Number of splices: GT/AG | 11281694 Number of splices: GC/AG | 177965 Number of splices: AT/AC | 6082 Number of splices: Non-canonical | 14846 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.41 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265939 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 8513 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.03% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 658344 658344 658344 N_multimapping 265939 265939 265939 N_noFeature 225845 11649584 263398 N_ambiguous 161731 596 59691 UnstrandedReadsAssigned:11401333 PositiveStrandReadsAssigned:138729 NegativeStrandReadsAssigned:11465820 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7495382 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7495382-trimmed-pair1.fastq SRR7495382-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,706,308 reads, 11,566,586 reads pseudoaligned [quant] estimated average fragment length: 406.228 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,019 rounds 52401 SRR7495382.ke.tsv 34699 SRR7495382.se.tsv 87100 total ==> SRR7495382.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1612.77 332 15.9645 Potri.005G024800.1.v4.1 1035 629.772 156 19.2102 Potri.004G059700.1.v4.1 961 555.984 19 2.65022 Potri.007G009000.2.v4.1 1416 1010.77 0 0 Potri.003G141000.2.v4.1 2943 2537.77 836 25.5473 Potri.016G087400.1.v4.1 270 52.7504 296 435.168 Potri.015G069301.1.v4.1 564 192.247 0 0 Potri.010G195200.1.v4.1 1773 1367.77 37 2.09787 Potri.012G127500.1.v4.1 977 571.846 512 69.4355 ==> SRR7495382.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 579 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 92 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 72 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7495382 completed mapping pipeline successfully