Starting /dee2/code/volunteer_pipeline.sh SRR7495383 current disk space = 3057638092800 free memory = 1104224380 SRR7495383 SRAfilesize 254f057866714354cf0775ae95ac28d7 SRR7495383.sra SRR7495383.sra file validated SRR7495383 is paired end SRR7495383 is conventional basespace SRR7495383 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495383_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.059 32.0 18.0 33.0 18.0 33.0 2 26.0765 27.0 18.0 31.0 18.0 33.0 3 30.9595 31.0 30.0 33.0 27.0 33.0 4 32.2805 33.0 32.0 33.0 32.0 33.0 5 32.97 33.0 33.0 33.0 33.0 34.0 6 36.94125 38.0 37.0 38.0 35.0 38.0 7 37.62475 38.0 38.0 38.0 37.0 38.0 8 37.75475 38.0 38.0 38.0 38.0 38.0 9 37.81625 38.0 38.0 38.0 38.0 38.0 10-14 37.8202 38.0 38.0 38.0 38.0 38.0 15-19 37.81695 38.0 38.0 38.0 38.0 38.0 20-24 37.810249999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.788650000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.7755 38.0 38.0 38.0 38.0 38.0 35-39 37.791399999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.77095 38.0 38.0 38.0 38.0 38.0 45-49 37.7359 38.0 38.0 38.0 38.0 38.0 50-54 37.6749 38.0 38.0 38.0 38.0 38.0 55-59 37.626999999999995 38.0 38.0 38.0 38.0 38.0 60-64 37.60635 38.0 38.0 38.0 38.0 38.0 65-69 37.6121 38.0 38.0 38.0 38.0 38.0 70-74 37.57275 38.0 38.0 38.0 38.0 38.0 75-79 37.54695 38.0 38.0 38.0 38.0 38.0 80-84 37.5165 38.0 38.0 38.0 37.6 38.0 85-89 37.4837 38.0 38.0 38.0 37.0 38.0 90-94 37.42505 38.0 38.0 38.0 37.0 38.0 95-99 37.376099999999994 38.0 38.0 38.0 37.0 38.0 100-104 37.3447 38.0 38.0 38.0 37.0 38.0 105-109 37.291399999999996 38.0 38.0 38.0 36.8 38.0 110-114 37.2097 38.0 38.0 38.0 36.0 38.0 115-119 37.0843 38.0 38.0 38.0 36.0 38.0 120-124 37.0721 38.0 38.0 38.0 36.0 38.0 125-129 36.9057 38.0 38.0 38.0 35.2 38.0 130-134 36.849399999999996 38.0 38.0 38.0 35.0 38.0 135-139 36.67925 38.0 38.0 38.0 35.0 38.0 140-144 36.568200000000004 38.0 38.0 38.0 34.8 38.0 145-149 36.38590000000001 38.0 38.0 38.0 34.6 38.0 150-151 34.16525 38.0 35.5 38.0 27.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 5.0 21 2.0 22 2.0 23 3.0 24 3.0 25 6.0 26 3.0 27 7.0 28 10.0 29 7.0 30 13.0 31 19.0 32 22.0 33 25.0 34 43.0 35 105.0 36 417.0 37 3307.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.4 11.95 7.7 31.95 2 23.441021788129227 12.021036814425244 35.236664162284 29.301277235161532 3 17.45 18.85 29.049999999999997 34.65 4 21.099999999999998 24.7 25.174999999999997 29.025000000000002 5 22.428035043804755 29.13642052565707 25.15644555694618 23.27909887359199 6 20.501882057716436 35.38268506900879 23.01129234629862 21.104140526976163 7 15.625 26.700000000000003 39.275 18.4 8 18.725 26.275 30.075000000000003 24.925 9 17.4 25.7 33.6 23.3 10-14 20.18 29.255 27.450000000000003 23.115 15-19 19.98 28.16 27.88 23.98 20-24 20.01 28.33 27.685 23.974999999999998 25-29 20.47 27.905 27.860000000000003 23.765 30-34 19.775000000000002 28.67 27.565 23.990000000000002 35-39 20.04 28.345 27.83 23.785 40-44 20.26 28.694999999999997 27.325 23.72 45-49 20.669999999999998 28.065 27.24 24.025 50-54 20.325 28.125 27.485 24.065 55-59 20.150000000000002 28.249999999999996 27.655 23.945 60-64 20.625 27.965 27.83 23.580000000000002 65-69 20.155 28.199999999999996 27.3 24.345 70-74 20.535 28.005000000000003 27.325 24.135 75-79 20.195 27.800000000000004 27.584999999999997 24.42 80-84 20.3 27.705000000000002 28.09 23.905 85-89 20.86 27.905 27.04 24.195 90-94 20.575 27.534999999999997 27.92 23.97 95-99 20.155 27.54 28.1 24.205 100-104 20.337033703370334 28.047804780478046 27.65776577657766 23.957395739573958 105-109 20.674999999999997 27.675 27.450000000000003 24.2 110-114 20.215 27.944999999999997 27.889999999999997 23.95 115-119 20.815 27.965 27.825 23.395 120-124 20.115 28.055000000000003 27.195000000000004 24.635 125-129 20.7 27.82 27.13 24.349999999999998 130-134 20.24 27.985 28.21 23.565 135-139 20.810000000000002 27.345000000000002 27.839999999999996 24.005000000000003 140-144 20.455000000000002 27.85 27.02 24.675 145-149 20.595 27.589999999999996 27.905 23.91 150-151 21.075053251472248 27.37752161383285 27.089337175792505 24.458087958902393 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.0 25 4.0 26 5.5 27 5.0 28 5.5 29 10.0 30 13.5 31 15.5 32 19.0 33 29.0 34 50.0 35 64.5 36 80.0 37 98.0 38 119.5 39 142.0 40 159.0 41 194.0 42 228.0 43 244.5 44 275.0 45 278.0 46 270.0 47 275.0 48 268.0 49 254.5 50 202.0 51 161.5 52 133.5 53 97.5 54 83.5 55 60.5 56 37.5 57 30.5 58 24.0 59 16.5 60 11.0 61 8.5 62 7.0 63 5.0 64 2.5 65 3.0 66 2.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.125 6 0.375 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.037500000000000006 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.1125 0.0 0.0 0.0 0.0 120-121 0.125 0.0 0.0 0.0 0.0 122-123 0.125 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.1875 0.0 0.0 0.0 0.0 128-129 0.2 0.0 0.0 0.0 0.0 130-131 0.21250000000000002 0.0 0.0 0.0 0.0 132-133 0.2625 0.0 0.0 0.0 0.0 134-135 0.3125 0.0 0.0 0.0 0.0 136-137 0.375 0.0 0.0 0.0 0.0 138-139 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTCGT 10 0.006830828 145.0 1 CTTCGTC 10 0.006830828 145.0 2 CATCAAA 30 0.0017973486 72.5 8 >>END_MODULE SRR7495383 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495383_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3465 34.0 33.0 34.0 33.0 34.0 2 33.43125 34.0 33.0 34.0 33.0 34.0 3 33.38175 34.0 33.0 34.0 33.0 34.0 4 33.36625 34.0 33.0 34.0 33.0 34.0 5 33.37325 34.0 33.0 34.0 33.0 34.0 6 37.4815 38.0 38.0 38.0 38.0 38.0 7 37.58075 38.0 38.0 38.0 38.0 38.0 8 37.512 38.0 38.0 38.0 38.0 38.0 9 37.436 38.0 38.0 38.0 38.0 38.0 10-14 37.45935 38.0 38.0 38.0 38.0 38.0 15-19 37.42085 38.0 38.0 38.0 38.0 38.0 20-24 37.25665 38.0 38.0 38.0 38.0 38.0 25-29 37.3733 38.0 38.0 38.0 38.0 38.0 30-34 37.596199999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.62505 38.0 38.0 38.0 38.0 38.0 40-44 37.59519999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.590450000000004 38.0 38.0 38.0 38.0 38.0 50-54 37.53875000000001 38.0 38.0 38.0 38.0 38.0 55-59 37.414699999999996 38.0 38.0 38.0 38.0 38.0 60-64 37.448750000000004 38.0 38.0 38.0 38.0 38.0 65-69 37.4106 38.0 38.0 38.0 38.0 38.0 70-74 37.230450000000005 38.0 38.0 38.0 38.0 38.0 75-79 37.391949999999994 38.0 38.0 38.0 38.0 38.0 80-84 37.424699999999994 38.0 38.0 38.0 38.0 38.0 85-89 37.4211 38.0 38.0 38.0 38.0 38.0 90-94 37.3428 38.0 38.0 38.0 38.0 38.0 95-99 37.28099999999999 38.0 38.0 38.0 38.0 38.0 100-104 37.162499999999994 38.0 38.0 38.0 37.2 38.0 105-109 36.87475 38.0 38.0 38.0 37.0 38.0 110-114 36.816050000000004 38.0 38.0 38.0 36.8 38.0 115-119 36.598150000000004 38.0 38.0 38.0 36.2 38.0 120-124 36.785700000000006 38.0 38.0 38.0 36.0 38.0 125-129 36.892700000000005 38.0 38.0 38.0 36.0 38.0 130-134 36.86665 38.0 38.0 38.0 36.0 38.0 135-139 36.814949999999996 38.0 38.0 38.0 36.0 38.0 140-144 36.66330000000001 38.0 38.0 38.0 35.4 38.0 145-149 36.54555 38.0 38.0 38.0 35.2 38.0 150-151 34.283625 38.0 35.5 38.0 18.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 3.0 15 1.0 16 3.0 17 7.0 18 7.0 19 5.0 20 4.0 21 3.0 22 3.0 23 7.0 24 6.0 25 12.0 26 4.0 27 7.0 28 5.0 29 14.0 30 19.0 31 20.0 32 22.0 33 25.0 34 42.0 35 77.0 36 208.0 37 3485.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.1 22.650000000000002 12.125 25.124999999999996 2 25.137568784392194 28.68934467233617 29.214607303651825 16.95847923961981 3 20.993227990970656 28.542763982944567 32.15450213192877 18.309505894156004 4 23.237139272271015 33.550815558343785 22.710163111668756 20.501882057716436 5 22.999749184850764 37.12064208678204 21.570102834211184 18.309505894156004 6 20.291310899045705 39.17629331993973 23.053741838272224 17.47865394274234 7 20.87719298245614 22.105263157894736 37.794486215538846 19.223057644110277 8 21.094927172275238 25.715720743345056 26.443997990959318 26.745354093420392 9 21.13065326633166 26.783919597989954 28.693467336683415 23.391959798994975 10-14 22.811777710782835 28.946839513616723 26.399356848557936 21.842025927042506 15-19 22.27197263168486 28.495245761432813 27.851285405242237 21.381496201640086 20-24 22.450732693279434 27.685699848408284 28.079838302172817 21.783729156139465 25-29 22.694357839686212 28.49743538167555 27.516846022327268 21.291360756310972 30-34 22.169433886777355 28.11562312462493 27.91058211642328 21.804360872174435 35-39 22.55 27.495000000000005 27.57 22.384999999999998 40-44 23.327332733273327 27.312731273127312 27.9027902790279 21.457145714571457 45-49 22.650000000000002 27.705000000000002 28.205000000000002 21.44 50-54 23.13470205307962 28.102153229844767 26.770155232849273 21.99298948422634 55-59 23.417721518987342 27.772754671488848 27.360859955796663 21.448663853727147 60-64 22.605517448555553 27.447053522255043 28.313222850848646 21.634206178340758 65-69 22.69261637239165 27.633426966292134 27.497993579454256 22.17596308186196 70-74 22.805338705615714 28.07856962981617 27.373457567363385 21.742634097204736 75-79 23.34819415919451 28.297350097680706 26.91980163302109 21.434654110103693 80-84 23.335 28.08 26.76 21.825 85-89 23.825 27.245 27.400000000000002 21.529999999999998 90-94 23.22 27.865000000000002 27.61 21.305 95-99 22.785 27.915 27.51 21.790000000000003 100-104 23.510547677506636 27.529187753670392 27.178433632309467 21.781830936513504 105-109 23.16697784730282 27.738810112529645 27.708533077660597 21.385678962506937 110-114 23.222676974382296 27.66914253953817 27.573139305745038 21.535041180334495 115-119 23.429352503417203 28.056497747177644 27.13005619399585 21.384093555409304 120-124 23.218599033816425 27.370169082125607 28.125 21.286231884057973 125-129 22.606303151575787 27.863931965982992 27.70385192596298 21.825912956478238 130-134 23.905 27.785 27.13 21.18 135-139 23.945 27.765 27.560000000000002 20.73 140-144 23.477347734773478 28.03780378037804 27.037703770377036 21.44714471447145 145-149 23.44 28.165000000000003 26.96 21.435000000000002 150-151 23.24676953958098 27.838414251662275 27.763141387529792 21.151674821226948 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 1.0 22 1.5 23 3.0 24 3.0 25 3.5 26 4.0 27 6.0 28 9.5 29 13.0 30 12.0 31 16.0 32 18.5 33 17.0 34 35.0 35 52.5 36 65.5 37 88.0 38 127.5 39 169.5 40 198.5 41 220.5 42 248.5 43 261.0 44 274.0 45 306.0 46 308.0 47 274.5 48 234.0 49 202.0 50 166.0 51 134.5 52 117.0 53 97.5 54 78.5 55 53.0 56 32.5 57 38.5 58 36.0 59 26.0 60 17.0 61 7.0 62 6.0 63 5.5 64 3.5 65 2.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.325 4 0.375 5 0.325 6 0.44999999999999996 7 0.25 8 0.44999999999999996 9 0.5 10-14 0.49 15-19 0.615 20-24 1.05 25-29 0.5700000000000001 30-34 0.02 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.15 55-59 0.45999999999999996 60-64 0.135 65-69 0.32 70-74 0.7250000000000001 75-79 0.185 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.215 105-109 0.915 110-114 1.045 115-119 1.2349999999999999 120-124 0.64 125-129 0.05 130-134 0.0 135-139 0.0 140-144 0.01 145-149 0.0 150-151 0.36250000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3195564516129 98.52499999999999 2 0.6300403225806451 1.25 3 0.0 0.0 4 0.025201612903225805 0.1 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCTGTAGCTTTCTCCAATTTCTTTTACACAGTCAAAAACCCTTTAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.025 0.0 0.0 0.0 0.0 102-103 0.025 0.0 0.0 0.0 0.0 104-105 0.025 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.037500000000000006 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.1 0.0 0.0 0.0 0.0 118-119 0.1125 0.0 0.0 0.0 0.0 120-121 0.125 0.0 0.0 0.0 0.0 122-123 0.125 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.1875 0.0 0.0 0.0 0.0 128-129 0.2 0.0 0.0 0.0 0.0 130-131 0.21250000000000002 0.0 0.0 0.0 0.0 132-133 0.2625 0.0 0.0 0.0 0.0 134-135 0.3125 0.0 0.0 0.0 0.0 136-137 0.375 0.0 0.0 0.0 0.0 138-139 0.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTCC 10 0.006830828 145.0 6 AAGAGTA 10 0.006830828 145.0 4 AACCATC 10 0.006830828 145.0 2 CCTTCCA 10 0.006830828 145.0 145 GTAGCTT 10 0.006830828 145.0 1 >>END_MODULE Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra Read 614555 spots for SRR7495383.sra Written 614555 spots for SRR7495383.sra Read 614538 spots for SRR7495383.sra Written 614538 spots for SRR7495383.sra SRR ids: ['SRR7495383.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5b9ptmca SRR7495383.sra spots: 12290777 blocks: [[1, 614538], [614539, 1229076], [1229077, 1843614], [1843615, 2458152], [2458153, 3072690], [3072691, 3687228], [3687229, 4301766], [4301767, 4916304], [4916305, 5530842], [5530843, 6145380], [6145381, 6759918], [6759919, 7374456], [7374457, 7988994], [7988995, 8603532], [8603533, 9218070], [9218071, 9832608], [9832609, 10447146], [10447147, 11061684], [11061685, 11676222], [11676223, 12290777]] SRR7495383 file size 4143240 SRR7495383 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7495383 SRR7495383_1.fastq SRR7495383_2.fastq Input file: SRR7495383_1.fastq Paired file: SRR7495383_2.fastq trimmed: SRR7495383-trimmed-pair1.fastq, SRR7495383-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:21:06 2025 >> started Mon Feb 10 18:21:19 2025 >> done (13.423s) 12290777 read pairs processed; of these: 5891 ( 0.05%) short read pairs filtered out after trimming by size control 4161 ( 0.03%) empty read pairs filtered out after trimming by size control 12280725 (99.92%) read pairs available; of these: 2563379 (20.87%) trimmed read pairs available after processing 9717346 (79.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 3 0.00% 22 5 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 4 0.00% 27 2 0.00% 28 3 0.00% 29 5 0.00% 30 3 0.00% 31 2 0.00% 32 2 0.00% 33 5 0.00% 34 2 0.00% 35 5 0.00% 36 1 0.00% 37 1 0.00% 38 2 0.00% 39 4 0.00% 40 1 0.00% 41 2 0.00% 42 3 0.00% 43 3 0.00% 44 2 0.00% 45 3 0.00% 46 1 0.00% 47 7 0.00% 48 7 0.00% 49 6 0.00% 50 8 0.00% 51 3 0.00% 52 2 0.00% 53 6 0.00% 54 6 0.00% 55 7 0.00% 56 6 0.00% 57 10 0.00% 58 11 0.00% 59 23 0.00% 60 8 0.00% 61 15 0.00% 62 21 0.00% 63 13 0.00% 64 18 0.00% 65 16 0.00% 66 28 0.00% 67 28 0.00% 68 36 0.00% 69 44 0.00% 70 31 0.00% 71 54 0.00% 72 34 0.00% 73 45 0.00% 74 57 0.00% 75 58 0.00% 76 76 0.00% 77 95 0.00% 78 95 0.00% 79 106 0.00% 80 120 0.00% 81 123 0.00% 82 154 0.00% 83 197 0.00% 84 481 0.00% 85 682 0.01% 86 767 0.01% 87 810 0.01% 88 937 0.01% 89 869 0.01% 90 985 0.01% 91 963 0.01% 92 897 0.01% 93 1022 0.01% 94 1021 0.01% 95 1096 0.01% 96 1144 0.01% 97 1181 0.01% 98 1275 0.01% 99 1330 0.01% 100 1404 0.01% 101 1526 0.01% 102 1576 0.01% 103 1655 0.01% 104 1691 0.01% 105 1825 0.01% 106 1778 0.01% 107 1995 0.02% 108 2143 0.02% 109 2163 0.02% 110 2147 0.02% 111 2498 0.02% 112 2474 0.02% 113 2701 0.02% 114 2915 0.02% 115 3127 0.03% 116 3293 0.03% 117 3420 0.03% 118 3724 0.03% 119 4031 0.03% 120 4293 0.03% 121 4589 0.04% 122 4763 0.04% 123 5122 0.04% 124 5336 0.04% 125 5314 0.04% 126 5523 0.04% 127 5903 0.05% 128 6188 0.05% 129 6531 0.05% 130 6773 0.06% 131 7242 0.06% 132 7560 0.06% 133 8248 0.07% 134 8922 0.07% 135 9617 0.08% 136 10150 0.08% 137 11183 0.09% 138 11881 0.10% 139 12945 0.11% 140 14448 0.12% 141 15887 0.13% 142 18135 0.15% 143 20752 0.17% 144 24717 0.20% 145 30066 0.24% 146 39910 0.32% 147 56612 0.46% 148 98360 0.80% 149 233298 1.90% 150 1797918 14.64% 151 9717346 79.13% 12280725 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=19 prefix-density=0.62 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=65.45 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.1 sequence=ACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=13 prefix-density=0.53 prefix-fanout=2.7 sequence=ACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=32.00 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=10.5 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7495383 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:22:00 Started mapping on | Feb 10 18:22:01 Finished on | Feb 10 18:22:52 Mapping speed, Million of reads per hour | 866.87 Number of input reads | 12280725 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 11376350 Uniquely mapped reads % | 92.64% Average mapped length | 299.93 Number of splices: Total | 11266090 Number of splices: Annotated (sjdb) | 11124563 Number of splices: GT/AG | 11076832 Number of splices: GC/AG | 169501 Number of splices: AT/AC | 6129 Number of splices: Non-canonical | 13628 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.01% Deletion average length | 2.39 Insertion rate per base | 0.01% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 232414 % of reads mapped to multiple loci | 1.89% Number of reads mapped to too many loci | 16138 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.32% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 679257 679257 679257 N_multimapping 232414 232414 232414 N_noFeature 182558 11237314 220100 N_ambiguous 159036 460 57288 UnstrandedReadsAssigned:11034756 PositiveStrandReadsAssigned:138576 NegativeStrandReadsAssigned:11098962 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7495383 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7495383-trimmed-pair1.fastq SRR7495383-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,280,725 reads, 11,165,586 reads pseudoaligned [quant] estimated average fragment length: 392.966 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,011 rounds 52401 SRR7495383.ke.tsv 34699 SRR7495383.se.tsv 87100 total ==> SRR7495383.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1626.03 290 14.4641 Potri.005G024800.1.v4.1 1035 643.034 117 14.7562 Potri.004G059700.1.v4.1 961 569.225 19 2.70703 Potri.007G009000.2.v4.1 1416 1024.03 0 0 Potri.003G141000.2.v4.1 2943 2551.03 493 15.673 Potri.016G087400.1.v4.1 270 54.4142 398 593.19 Potri.015G069301.1.v4.1 564 200.985 0 0 Potri.010G195200.1.v4.1 1773 1381.03 13 0.763417 Potri.012G127500.1.v4.1 977 585.146 355 49.2025 ==> SRR7495383.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 428 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 152 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 68 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7495383 completed mapping pipeline successfully