Starting /dee2/code/volunteer_pipeline.sh SRR7495384 current disk space = 3057526702080 free memory = 1294347844 SRR7495384 SRAfilesize 0a6b5adf0efc390068cd64ed7ef35277 SRR7495384.sra SRR7495384.sra file validated SRR7495384 is paired end SRR7495384 is conventional basespace SRR7495384 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495384_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.15025 32.0 28.0 33.0 18.0 33.0 2 32.1115 33.0 31.0 33.0 31.0 33.0 3 32.96925 33.0 33.0 33.0 33.0 34.0 4 33.39225 34.0 33.0 34.0 33.0 34.0 5 33.5435 34.0 34.0 34.0 33.0 34.0 6 37.701 38.0 38.0 38.0 38.0 38.0 7 37.78325 38.0 38.0 38.0 38.0 38.0 8 37.833 38.0 38.0 38.0 38.0 38.0 9 37.86575 38.0 38.0 38.0 38.0 38.0 10-14 37.8753 38.0 38.0 38.0 38.0 38.0 15-19 37.836 38.0 38.0 38.0 38.0 38.0 20-24 37.84045 38.0 38.0 38.0 38.0 38.0 25-29 37.814049999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.8252 38.0 38.0 38.0 38.0 38.0 35-39 37.78675 38.0 38.0 38.0 38.0 38.0 40-44 37.77915 38.0 38.0 38.0 38.0 38.0 45-49 37.750299999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.73349999999999 38.0 38.0 38.0 38.0 38.0 55-59 37.65865 38.0 38.0 38.0 38.0 38.0 60-64 37.63655 38.0 38.0 38.0 38.0 38.0 65-69 37.5991 38.0 38.0 38.0 38.0 38.0 70-74 37.629200000000004 38.0 38.0 38.0 38.0 38.0 75-79 37.58800000000001 38.0 38.0 38.0 38.0 38.0 80-84 37.5321 38.0 38.0 38.0 38.0 38.0 85-89 37.539049999999996 38.0 38.0 38.0 37.8 38.0 90-94 37.4902 38.0 38.0 38.0 37.8 38.0 95-99 37.397000000000006 38.0 38.0 38.0 37.0 38.0 100-104 37.34635 38.0 38.0 38.0 37.0 38.0 105-109 37.326800000000006 38.0 38.0 38.0 37.0 38.0 110-114 37.2312 38.0 38.0 38.0 36.6 38.0 115-119 37.17755 38.0 38.0 38.0 36.2 38.0 120-124 37.05030000000001 38.0 38.0 38.0 36.0 38.0 125-129 37.0206 38.0 38.0 38.0 36.0 38.0 130-134 36.92665 38.0 38.0 38.0 35.4 38.0 135-139 36.762100000000004 38.0 38.0 38.0 35.0 38.0 140-144 36.65475 38.0 38.0 38.0 35.0 38.0 145-149 36.46075 38.0 38.0 38.0 34.6 38.0 150-151 34.481875 38.0 35.5 38.0 27.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 3.0 17 1.0 18 2.0 19 2.0 20 2.0 21 2.0 22 1.0 23 0.0 24 1.0 25 3.0 26 4.0 27 5.0 28 8.0 29 7.0 30 10.0 31 14.0 32 21.0 33 26.0 34 42.0 35 90.0 36 318.0 37 3437.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.450965638324554 12.916980185603212 7.750188111361926 32.88186606471031 2 22.595190380761522 13.577154308617235 33.291583166332664 30.53607214428858 3 19.0 16.575 26.474999999999998 37.95 4 21.224999999999998 22.650000000000002 25.25 30.875000000000004 5 22.945463684342798 28.650414677054535 25.835637094747423 22.56848454385524 6 22.325 32.925 23.175 21.575 7 15.55 27.375 38.975 18.099999999999998 8 18.375 26.6 31.424999999999997 23.599999999999998 9 18.775 24.55 33.650000000000006 23.025000000000002 10-14 19.825 29.675 27.474999999999998 23.025000000000002 15-19 19.645000000000003 29.125 27.715 23.515 20-24 20.11 28.475 27.555000000000003 23.86 25-29 20.385 28.310000000000002 27.675 23.630000000000003 30-34 20.06 28.53 27.175 24.235 35-39 19.845 28.860000000000003 26.995 24.3 40-44 19.84 28.610000000000003 27.950000000000003 23.599999999999998 45-49 20.52 28.12 27.315 24.044999999999998 50-54 20.369999999999997 28.305000000000003 27.689999999999998 23.635 55-59 20.595 28.34 26.935 24.13 60-64 20.935000000000002 28.42 26.75 23.895 65-69 20.825 28.660000000000004 26.529999999999998 23.985 70-74 20.41 28.115000000000002 27.26 24.215 75-79 20.06 28.33 27.3 24.310000000000002 80-84 19.945 28.055000000000003 27.33 24.67 85-89 20.525 28.044999999999998 27.400000000000002 24.03 90-94 20.24 27.935 27.650000000000002 24.175 95-99 20.974999999999998 27.834999999999997 27.250000000000004 23.94 100-104 20.724999999999998 28.365000000000002 27.24 23.669999999999998 105-109 20.830000000000002 28.115000000000002 27.6 23.455000000000002 110-114 20.025000000000002 27.68 28.03 24.265 115-119 20.555 27.450000000000003 27.865000000000002 24.13 120-124 20.805 27.875 27.500000000000004 23.82 125-129 20.575 28.17 26.875 24.38 130-134 20.76 27.61 27.625 24.005000000000003 135-139 20.835 27.61 27.85 23.705000000000002 140-144 20.69 27.495000000000005 27.655 24.16 145-149 20.810000000000002 27.815 27.005000000000003 24.37 150-151 20.91273821464393 27.570210631895687 27.269307923771315 24.247743229689068 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 4.5 25 5.0 26 3.5 27 5.5 28 7.5 29 10.5 30 14.5 31 17.0 32 26.5 33 38.0 34 53.0 35 59.0 36 69.0 37 95.5 38 116.5 39 150.0 40 174.5 41 190.0 42 220.5 43 249.5 44 264.5 45 261.0 46 260.5 47 271.5 48 264.5 49 222.0 50 179.5 51 154.5 52 135.5 53 117.0 54 89.5 55 63.5 56 54.5 57 47.0 58 30.5 59 20.5 60 12.5 61 11.0 62 11.0 63 5.0 64 2.5 65 1.5 66 2.0 67 1.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.2 3 0.0 4 0.0 5 0.525 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.528834046839587 1.05 3 0.1007302946361118 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.225 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.3 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.375 0.0 0.0 0.0 0.0 128-129 0.4 0.0 0.0 0.0 0.0 130-131 0.4 0.0 0.0 0.0 0.0 132-133 0.4 0.0 0.0 0.0 0.0 134-135 0.4 0.0 0.0 0.0 0.0 136-137 0.4375 0.0 0.0 0.0 0.0 138-139 0.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7495384 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495384_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3005 34.0 33.0 34.0 33.0 34.0 2 33.49725 34.0 33.0 34.0 33.0 34.0 3 33.5045 34.0 33.0 34.0 33.0 34.0 4 33.37725 34.0 33.0 34.0 33.0 34.0 5 33.447 34.0 33.0 34.0 33.0 34.0 6 37.56625 38.0 38.0 38.0 38.0 38.0 7 37.6965 38.0 38.0 38.0 38.0 38.0 8 37.67075 38.0 38.0 38.0 38.0 38.0 9 37.56 38.0 38.0 38.0 38.0 38.0 10-14 37.6546 38.0 38.0 38.0 38.0 38.0 15-19 37.52935 38.0 38.0 38.0 38.0 38.0 20-24 37.510400000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.573949999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.664849999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.6194 38.0 38.0 38.0 38.0 38.0 40-44 37.6408 38.0 38.0 38.0 38.0 38.0 45-49 37.63005 38.0 38.0 38.0 38.0 38.0 50-54 37.601600000000005 38.0 38.0 38.0 38.0 38.0 55-59 37.57725 38.0 38.0 38.0 38.0 38.0 60-64 37.57385 38.0 38.0 38.0 38.0 38.0 65-69 37.5629 38.0 38.0 38.0 38.0 38.0 70-74 37.4233 38.0 38.0 38.0 38.0 38.0 75-79 37.489250000000006 38.0 38.0 38.0 38.0 38.0 80-84 37.44665 38.0 38.0 38.0 38.0 38.0 85-89 37.41775 38.0 38.0 38.0 38.0 38.0 90-94 37.357299999999995 38.0 38.0 38.0 37.8 38.0 95-99 37.312799999999996 38.0 38.0 38.0 38.0 38.0 100-104 37.31855 38.0 38.0 38.0 38.0 38.0 105-109 37.14245 38.0 38.0 38.0 37.2 38.0 110-114 37.07535 38.0 38.0 38.0 37.0 38.0 115-119 37.032650000000004 38.0 38.0 38.0 37.0 38.0 120-124 36.998850000000004 38.0 38.0 38.0 36.8 38.0 125-129 37.0342 38.0 38.0 38.0 36.2 38.0 130-134 36.885799999999996 38.0 38.0 38.0 36.0 38.0 135-139 36.783500000000004 38.0 38.0 38.0 35.6 38.0 140-144 36.696000000000005 38.0 38.0 38.0 35.6 38.0 145-149 36.49865 38.0 38.0 38.0 35.0 38.0 150-151 34.63875 38.0 36.0 38.0 28.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 2.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 4.0 15 0.0 16 3.0 17 1.0 18 1.0 19 3.0 20 3.0 21 4.0 22 3.0 23 4.0 24 5.0 25 6.0 26 5.0 27 14.0 28 10.0 29 17.0 30 13.0 31 13.0 32 26.0 33 24.0 34 36.0 35 75.0 36 207.0 37 3515.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.84297520661157 23.541197094916104 11.645379413974455 25.97044828449787 2 25.4 28.625 29.775000000000002 16.2 3 20.926157697121404 27.80976220275344 30.538172715894866 20.72590738423029 4 24.109382839939787 32.037129954841944 23.30657300551932 20.546914199698946 5 23.804755944931163 36.070087609511894 22.202753441802255 17.922403003754695 6 20.91798344620015 39.15224479558566 21.193880110358666 18.735891647855528 7 19.5 22.725 37.7 20.075000000000003 8 21.175 26.525 26.625 25.674999999999997 9 21.057909250438705 25.14414640260717 31.135622963148656 22.662321383805466 10-14 22.966890067020106 28.758627588276482 26.357907372211663 21.91657497249175 15-19 23.190731731781934 28.04052359697076 27.228045538893625 21.54069913235368 20-24 23.230854105020313 28.542053262450473 26.78168413661668 21.44540849591253 25-29 23.03688504078875 28.547119763775587 26.875531755167408 21.540463440268255 30-34 22.735 27.975 27.800000000000004 21.490000000000002 35-39 23.015 27.42 27.265 22.3 40-44 23.095 27.560000000000002 27.325 22.02 45-49 22.975 27.61 26.939999999999998 22.475 50-54 23.165 27.815 27.205000000000002 21.815 55-59 23.198479771965793 27.149072360854127 27.104065609841477 22.548382257338602 60-64 22.446122306115306 27.316365818290915 27.83139156957848 22.4061203060153 65-69 23.2746549309862 27.0754150830166 27.470494098819763 22.179435887177434 70-74 23.661363978521603 27.279570432077083 27.108947658955184 21.95011793044613 75-79 23.224644928985796 27.110422084416886 27.375475095019002 22.289457891578316 80-84 23.244999999999997 28.384999999999998 26.795 21.575 85-89 23.455000000000002 27.125 27.49 21.93 90-94 24.154999999999998 27.055 27.67 21.12 95-99 23.595 27.139999999999997 27.055 22.21 100-104 23.79 27.185 27.134999999999998 21.89 105-109 23.486026792433897 27.083437860619135 27.369424514575286 22.061110832371682 110-114 23.796845172309855 27.56957701195619 26.62513814930172 22.00843966643223 115-119 23.412379421221864 27.662781350482312 27.466840836012864 21.45799839228296 120-124 23.65876872213595 27.565997094625054 27.075088914491808 21.700145268747182 125-129 23.72 27.065 27.415 21.8 130-134 23.75 27.700000000000003 27.065 21.485000000000003 135-139 23.919999999999998 27.18 27.305 21.595 140-144 23.755000000000003 27.565 26.974999999999998 21.705 145-149 24.060000000000002 27.744999999999997 26.595000000000002 21.6 150-151 24.025078369905955 27.36050156739812 27.42319749216301 21.191222570532915 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 1.5 26 1.5 27 3.5 28 3.5 29 3.0 30 8.5 31 11.5 32 12.5 33 19.0 34 31.0 35 40.5 36 56.5 37 86.0 38 123.5 39 151.5 40 182.5 41 215.0 42 235.0 43 252.5 44 263.5 45 293.0 46 307.5 47 276.5 48 244.5 49 230.0 50 195.5 51 152.5 52 126.0 53 106.5 54 95.0 55 73.0 56 53.5 57 39.0 58 30.0 59 28.0 60 17.5 61 8.5 62 6.0 63 5.0 64 3.0 65 2.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.125 4 0.35000000000000003 5 0.125 6 0.325 7 0.0 8 0.0 9 0.27499999999999997 10-14 0.03 15-19 0.305 20-24 0.305 25-29 0.095 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.015 60-64 0.005 65-69 0.02 70-74 0.365 75-79 0.02 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.345 110-114 0.47000000000000003 115-119 0.48 120-124 0.185 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.3125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96359959555106 97.875 2 0.9605662285136503 1.9 3 0.07583417593528817 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.3 0.0 0.0 0.0 0.0 126-127 0.325 0.0 0.0 0.0 0.0 128-129 0.35 0.0 0.0 0.0 0.0 130-131 0.35 0.0 0.0 0.0 0.0 132-133 0.35 0.0 0.0 0.0 0.0 134-135 0.3625 0.0 0.0 0.0 0.0 136-137 0.4125 0.0 0.0 0.0 0.0 138-139 0.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra Read 481927 spots for SRR7495384.sra Written 481927 spots for SRR7495384.sra SRR ids: ['SRR7495384.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_57p408z1 SRR7495384.sra spots: 9638540 blocks: [[1, 481927], [481928, 963854], [963855, 1445781], [1445782, 1927708], [1927709, 2409635], [2409636, 2891562], [2891563, 3373489], [3373490, 3855416], [3855417, 4337343], [4337344, 4819270], [4819271, 5301197], [5301198, 5783124], [5783125, 6265051], [6265052, 6746978], [6746979, 7228905], [7228906, 7710832], [7710833, 8192759], [8192760, 8674686], [8674687, 9156613], [9156614, 9638540]] SRR7495384 file size 3245190 SRR7495384 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7495384 SRR7495384_1.fastq SRR7495384_2.fastq Input file: SRR7495384_1.fastq Paired file: SRR7495384_2.fastq trimmed: SRR7495384-trimmed-pair1.fastq, SRR7495384-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:28:08 2025 >> started Mon Feb 10 18:28:20 2025 >> done (12.435s) 9638540 read pairs processed; of these: 4427 ( 0.05%) short read pairs filtered out after trimming by size control 4848 ( 0.05%) empty read pairs filtered out after trimming by size control 9629265 (99.90%) read pairs available; of these: 2007951 (20.85%) trimmed read pairs available after processing 7621314 (79.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 7 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 2 0.00% 32 1 0.00% 33 2 0.00% 34 0 0.00% 35 0 0.00% 36 3 0.00% 37 1 0.00% 38 4 0.00% 39 4 0.00% 40 0 0.00% 41 5 0.00% 42 4 0.00% 43 3 0.00% 44 1 0.00% 45 5 0.00% 46 4 0.00% 47 4 0.00% 48 7 0.00% 49 5 0.00% 50 4 0.00% 51 5 0.00% 52 6 0.00% 53 3 0.00% 54 7 0.00% 55 6 0.00% 56 11 0.00% 57 16 0.00% 58 16 0.00% 59 15 0.00% 60 14 0.00% 61 14 0.00% 62 15 0.00% 63 23 0.00% 64 24 0.00% 65 25 0.00% 66 31 0.00% 67 42 0.00% 68 40 0.00% 69 30 0.00% 70 38 0.00% 71 54 0.00% 72 43 0.00% 73 55 0.00% 74 77 0.00% 75 84 0.00% 76 113 0.00% 77 109 0.00% 78 102 0.00% 79 124 0.00% 80 140 0.00% 81 138 0.00% 82 149 0.00% 83 213 0.00% 84 399 0.00% 85 619 0.01% 86 680 0.01% 87 703 0.01% 88 765 0.01% 89 779 0.01% 90 774 0.01% 91 806 0.01% 92 862 0.01% 93 826 0.01% 94 915 0.01% 95 1013 0.01% 96 1044 0.01% 97 1072 0.01% 98 1100 0.01% 99 1213 0.01% 100 1210 0.01% 101 1336 0.01% 102 1351 0.01% 103 1418 0.01% 104 1575 0.02% 105 1615 0.02% 106 1736 0.02% 107 1793 0.02% 108 1876 0.02% 109 1986 0.02% 110 2168 0.02% 111 2344 0.02% 112 2361 0.02% 113 2514 0.03% 114 2705 0.03% 115 2891 0.03% 116 3088 0.03% 117 3229 0.03% 118 3337 0.03% 119 3574 0.04% 120 3773 0.04% 121 4060 0.04% 122 4310 0.04% 123 4464 0.05% 124 4647 0.05% 125 4818 0.05% 126 4864 0.05% 127 5241 0.05% 128 5544 0.06% 129 5750 0.06% 130 5970 0.06% 131 6454 0.07% 132 6772 0.07% 133 7063 0.07% 134 8021 0.08% 135 8332 0.09% 136 8981 0.09% 137 9743 0.10% 138 10583 0.11% 139 11314 0.12% 140 12582 0.13% 141 13865 0.14% 142 15428 0.16% 143 17572 0.18% 144 20808 0.22% 145 25334 0.26% 146 34345 0.36% 147 52945 0.55% 148 73026 0.76% 149 172177 1.79% 150 1379629 14.33% 151 7621314 79.15% 9629265 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=20 prefix-density=0.65 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=9.50 fanout-score-rank=1 prefix-density=0.02 prefix-fanout=2.8 sequence=AAAAATTGAAACGATATATCAAGTTCGGGACAAGTAGTACATCATGTGGAGATCGAGTTTATGCGAAGGTTCGAAATAGATAAATACAAGTTCCTAATCAAAAAGCCCTACTATTTTCATGCATCAACTATCTCTCCAGCCTCAGCAGCAGCAAGCACAAGCTCTGGCTGTAGACTGAATGTTCCATCTAGGGCATT criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=31 prefix-density=0.48 prefix-fanout=2.0 sequence=TCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=17.23 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.6 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR7495384 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:29:00 Started mapping on | Feb 10 18:29:00 Finished on | Feb 10 18:29:48 Mapping speed, Million of reads per hour | 722.19 Number of input reads | 9629265 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 8945142 Uniquely mapped reads % | 92.90% Average mapped length | 299.77 Number of splices: Total | 8756095 Number of splices: Annotated (sjdb) | 8642674 Number of splices: GT/AG | 8598573 Number of splices: GC/AG | 143115 Number of splices: AT/AC | 4353 Number of splices: Non-canonical | 10054 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 182693 % of reads mapped to multiple loci | 1.90% Number of reads mapped to too many loci | 9268 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.10% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 506906 506906 506906 N_multimapping 182693 182693 182693 N_noFeature 152714 8830839 182397 N_ambiguous 128909 469 44114 UnstrandedReadsAssigned:8663519 PositiveStrandReadsAssigned:113834 NegativeStrandReadsAssigned:8718631 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7495384 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7495384-trimmed-pair1.fastq SRR7495384-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,629,265 reads, 8,759,645 reads pseudoaligned [quant] estimated average fragment length: 378.851 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 953 rounds 52401 SRR7495384.ke.tsv 34699 SRR7495384.se.tsv 87100 total ==> SRR7495384.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1640.15 208 12.4315 Potri.005G024800.1.v4.1 1035 657.149 115 17.1545 Potri.004G059700.1.v4.1 961 583.243 9 1.51265 Potri.007G009000.2.v4.1 1416 1038.15 0 0 Potri.003G141000.2.v4.1 2943 2565.15 611 23.3493 Potri.016G087400.1.v4.1 270 56.5356 242 419.603 Potri.015G069301.1.v4.1 564 210.325 0 0 Potri.010G195200.1.v4.1 1773 1395.15 13 0.913414 Potri.012G127500.1.v4.1 977 599.174 330 53.989 ==> SRR7495384.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 319 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 117 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 35 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7495384 completed mapping pipeline successfully