Starting /dee2/code/volunteer_pipeline.sh SRR7495385 current disk space = 3057681793024 free memory = 944623164 SRR7495385 SRAfilesize cbebde4ddc88be56a232e96af9419628 SRR7495385.sra SRR7495385.sra file validated SRR7495385 is paired end SRR7495385 is conventional basespace SRR7495385 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495385_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.895 18.0 18.0 33.0 18.0 33.0 2 25.865 27.0 18.0 31.0 18.0 33.0 3 29.2145 29.0 27.0 33.0 25.0 33.0 4 31.3735 32.0 32.0 33.0 27.0 33.0 5 32.60475 33.0 33.0 33.0 32.0 33.0 6 36.38525 38.0 36.0 38.0 33.0 38.0 7 37.00425 38.0 37.0 38.0 35.0 38.0 8 37.23725 38.0 38.0 38.0 36.0 38.0 9 37.47525 38.0 38.0 38.0 37.0 38.0 10-14 37.582499999999996 38.0 38.0 38.0 37.6 38.0 15-19 37.6454 38.0 38.0 38.0 38.0 38.0 20-24 37.66155 38.0 38.0 38.0 38.0 38.0 25-29 37.627449999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.60785 38.0 38.0 38.0 38.0 38.0 35-39 37.61905 38.0 38.0 38.0 38.0 38.0 40-44 37.57430000000001 38.0 38.0 38.0 38.0 38.0 45-49 37.5342 38.0 38.0 38.0 37.8 38.0 50-54 37.53515 38.0 38.0 38.0 38.0 38.0 55-59 37.477999999999994 38.0 38.0 38.0 37.2 38.0 60-64 37.47065 38.0 38.0 38.0 37.2 38.0 65-69 37.414849999999994 38.0 38.0 38.0 37.0 38.0 70-74 37.40454999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.32895 38.0 38.0 38.0 37.0 38.0 80-84 37.32925 38.0 38.0 38.0 37.0 38.0 85-89 37.2254 38.0 38.0 38.0 36.6 38.0 90-94 37.259100000000004 38.0 38.0 38.0 36.8 38.0 95-99 37.1867 38.0 38.0 38.0 36.0 38.0 100-104 37.14085 38.0 38.0 38.0 36.0 38.0 105-109 37.0544 38.0 38.0 38.0 36.0 38.0 110-114 36.955200000000005 38.0 38.0 38.0 35.6 38.0 115-119 36.86595 38.0 38.0 38.0 35.2 38.0 120-124 36.75779999999999 38.0 38.0 38.0 35.0 38.0 125-129 36.645399999999995 38.0 38.0 38.0 34.8 38.0 130-134 36.42880000000001 38.0 38.0 38.0 34.0 38.0 135-139 36.3771 38.0 38.0 38.0 34.0 38.0 140-144 36.25600000000001 38.0 37.8 38.0 33.6 38.0 145-149 35.8816 38.0 37.0 38.0 33.0 38.0 150-151 33.301125 37.0 33.5 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 0.0 21 1.0 22 2.0 23 3.0 24 4.0 25 6.0 26 5.0 27 11.0 28 15.0 29 10.0 30 23.0 31 18.0 32 41.0 33 67.0 34 106.0 35 175.0 36 579.0 37 2929.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.219883688728885 12.766546662974246 8.169482137911936 32.84408751038493 2 21.25 13.575000000000001 35.6 29.575000000000003 3 18.9 19.900000000000002 27.35 33.85 4 21.525 25.874999999999996 24.025 28.575 5 23.25 30.625000000000004 24.224999999999998 21.9 6 22.45 33.074999999999996 23.974999999999998 20.5 7 15.049999999999999 27.200000000000003 40.949999999999996 16.8 8 17.675 25.1 32.175 25.05 9 16.8 25.474999999999998 34.425 23.3 10-14 19.605 29.99 27.02 23.385 15-19 19.645000000000003 28.439999999999998 28.405 23.51 20-24 19.945 28.395 27.625 24.035 25-29 19.744999999999997 29.044999999999998 27.51 23.7 30-34 20.169999999999998 28.505000000000003 27.150000000000002 24.175 35-39 19.355 28.735 27.615000000000002 24.295 40-44 20.375 28.585 27.455000000000002 23.585 45-49 19.86 27.839999999999996 27.810000000000002 24.490000000000002 50-54 19.900000000000002 28.07 27.915 24.115000000000002 55-59 20.07 27.91 27.889999999999997 24.13 60-64 19.895 28.765 27.735 23.605 65-69 19.919999999999998 27.875 27.96 24.245 70-74 20.29 28.585 27.6 23.525 75-79 20.435 28.12 27.439999999999998 24.005000000000003 80-84 20.345 27.860000000000003 27.284999999999997 24.51 85-89 20.0 28.455000000000002 27.400000000000002 24.145 90-94 20.435 28.65 27.339999999999996 23.575 95-99 20.1 27.87 27.834999999999997 24.195 100-104 20.02 27.345000000000002 28.444999999999997 24.19 105-109 19.935 28.34 28.000000000000004 23.724999999999998 110-114 20.115 27.79 28.055000000000003 24.04 115-119 20.4 27.275 27.805000000000003 24.52 120-124 20.455000000000002 27.839999999999996 27.43 24.275 125-129 20.165 27.42 28.365000000000002 24.05 130-134 20.02 27.779999999999998 28.335 23.865 135-139 20.76 27.625 27.29 24.325 140-144 20.705000000000002 27.04 28.134999999999998 24.12 145-149 20.385 26.765 28.12 24.73 150-151 20.7375 27.4125 27.700000000000003 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 1.0 23 1.0 24 1.5 25 2.0 26 3.0 27 5.0 28 6.5 29 12.5 30 15.5 31 21.0 32 30.5 33 37.5 34 58.0 35 71.0 36 81.5 37 105.0 38 127.0 39 143.0 40 164.0 41 198.5 42 234.0 43 273.0 44 285.5 45 277.0 46 269.0 47 259.5 48 248.0 49 232.5 50 198.5 51 152.5 52 126.0 53 98.5 54 68.0 55 48.0 56 35.5 57 27.0 58 22.5 59 19.0 60 14.5 61 8.5 62 3.5 63 2.5 64 1.5 65 2.0 66 1.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.275 0.0 0.0 0.0 0.0 126-127 0.3 0.0 0.0 0.0 0.0 128-129 0.3 0.0 0.0 0.0 0.0 130-131 0.3 0.0 0.0 0.0 0.0 132-133 0.3125 0.0 0.0 0.0 0.0 134-135 0.3375 0.0 0.0 0.0 0.0 136-137 0.4375 0.0 0.0 0.0 0.0 138-139 0.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCACA 10 0.0068449317 144.90001 6 >>END_MODULE SRR7495385 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495385_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07625 34.0 33.0 34.0 32.0 34.0 2 33.151 34.0 33.0 34.0 33.0 34.0 3 33.172 34.0 33.0 34.0 33.0 34.0 4 33.13475 34.0 33.0 34.0 33.0 34.0 5 33.1685 34.0 33.0 34.0 33.0 34.0 6 37.41525 38.0 38.0 38.0 38.0 38.0 7 37.414 38.0 38.0 38.0 38.0 38.0 8 37.414 38.0 38.0 38.0 38.0 38.0 9 37.38875 38.0 38.0 38.0 38.0 38.0 10-14 37.369299999999996 38.0 38.0 38.0 37.8 38.0 15-19 37.35345 38.0 38.0 38.0 37.4 38.0 20-24 37.328149999999994 38.0 38.0 38.0 37.2 38.0 25-29 37.30265000000001 38.0 38.0 38.0 37.2 38.0 30-34 37.29995 38.0 38.0 38.0 37.0 38.0 35-39 37.3001 38.0 38.0 38.0 37.0 38.0 40-44 37.2864 38.0 38.0 38.0 37.2 38.0 45-49 37.2617 38.0 38.0 38.0 37.0 38.0 50-54 37.240300000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.19645 38.0 38.0 38.0 37.0 38.0 60-64 37.1971 38.0 38.0 38.0 37.0 38.0 65-69 37.118750000000006 38.0 38.0 38.0 36.8 38.0 70-74 37.11015 38.0 38.0 38.0 37.0 38.0 75-79 37.10875 38.0 38.0 38.0 36.6 38.0 80-84 37.0653 38.0 38.0 38.0 36.6 38.0 85-89 37.0413 38.0 38.0 38.0 36.0 38.0 90-94 36.92825 38.0 38.0 38.0 36.0 38.0 95-99 36.87859999999999 38.0 38.0 38.0 36.0 38.0 100-104 36.7639 38.0 38.0 38.0 35.6 38.0 105-109 36.75025 38.0 38.0 38.0 35.6 38.0 110-114 36.6712 38.0 38.0 38.0 35.0 38.0 115-119 36.5582 38.0 38.0 38.0 34.4 38.0 120-124 36.4067 38.0 38.0 38.0 34.0 38.0 125-129 36.3361 38.0 38.0 38.0 34.0 38.0 130-134 36.18495 38.0 38.0 38.0 34.0 38.0 135-139 36.0394 38.0 38.0 38.0 33.4 38.0 140-144 35.91 38.0 38.0 38.0 33.0 38.0 145-149 35.4481 38.0 36.4 38.0 32.6 38.0 150-151 32.6485 37.0 33.5 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 0.0 5 0.0 6 2.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 1.0 13 0.0 14 2.0 15 1.0 16 1.0 17 0.0 18 3.0 19 2.0 20 2.0 21 6.0 22 6.0 23 6.0 24 11.0 25 13.0 26 11.0 27 17.0 28 12.0 29 17.0 30 37.0 31 32.0 32 37.0 33 52.0 34 83.0 35 170.0 36 398.0 37 3065.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.559508895013785 24.354798296166376 12.628413931345527 25.457278877474316 2 26.935605111500877 26.76021047356552 28.990228013029316 17.313956401904285 3 19.218241042345277 30.74417439238286 31.145076421949387 18.892508143322477 4 24.555249310949637 33.57554497619644 22.25006264094212 19.6191430719118 5 23.62816336757705 36.18140816837885 21.523427712352795 18.667000751691308 6 19.86986986986987 38.188188188188185 23.573573573573572 18.36836836836837 7 20.075093867334168 22.152690863579476 38.04755944931164 19.72465581977472 8 21.12112112112112 26.75175175175175 26.776776776776778 25.350350350350347 9 21.57157157157157 25.100100100100097 30.03003003003003 23.2982982982983 10-14 22.992591109331197 29.129955947136565 26.376651982378856 21.500800961153384 15-19 23.011505752876438 27.898949474737368 27.463731865932967 21.625812906453227 20-24 22.59259259259259 28.763763763763762 27.272272272272275 21.371371371371374 25-29 23.00800800800801 28.3983983983984 27.432432432432428 21.16116116116116 30-34 22.367367367367365 28.683683683683686 27.86786786786787 21.08108108108108 35-39 23.001851759171213 27.936539712727093 27.68129723237075 21.380311295730944 40-44 22.983386709367494 28.69295436349079 26.946557245796637 21.377101681345074 45-49 22.962962962962962 27.767767767767772 27.93793793793794 21.33133133133133 50-54 22.916041228860202 28.459921945361756 27.27409186430501 21.34994496147303 55-59 23.385724296726398 27.910701771949142 26.844528981880067 21.85904494944439 60-64 22.87944753040084 27.843667117049492 27.188109893409397 22.08877545914027 65-69 23.02802802802803 28.298298298298295 27.25225225225225 21.42142142142142 70-74 22.902902902902902 28.06806806806807 27.16216216216216 21.866866866866864 75-79 23.170853768391552 27.689920928835953 27.534781303172856 21.60444399959964 80-84 23.312146539212254 27.446073770081576 27.596216405585306 21.645563285120865 85-89 23.56738901956859 28.001601521445373 27.08072669035584 21.350282768630198 90-94 23.429915428113894 27.373267277185608 27.41830555972577 21.778511734974728 95-99 23.015714142728456 28.155339805825243 27.699929936943253 21.129016114503052 100-104 23.383706965572458 27.977381905524418 27.41693354683747 21.22197758206565 105-109 23.121965867574197 27.446073770081576 27.531154596867026 21.9008057654772 110-114 23.165849264337904 27.664898408567712 27.564808327494745 21.60444399959964 115-119 23.88769330864321 27.731344777538663 26.710374856113305 21.67058705770482 120-124 23.243243243243246 28.27827827827828 27.257257257257255 21.22122122122122 125-129 23.31681433648696 28.007208289532965 27.361465685538366 21.31451168844171 130-134 23.321820093107075 27.80697802472844 27.371477198778592 21.499724683385892 135-139 22.694964460906995 27.960756832515766 27.29001902092302 22.05425968565422 140-144 23.922510887520648 27.486609601041195 27.386494468638933 21.20438504279922 145-149 23.050745671103996 28.105294765288757 27.5497948153338 21.294164748273445 150-151 24.087043521760883 27.826413206603302 26.538269134567283 21.548274137068535 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.5 24 4.0 25 3.5 26 1.5 27 2.0 28 4.0 29 4.5 30 5.5 31 9.5 32 18.0 33 27.0 34 37.5 35 53.5 36 69.5 37 87.5 38 122.0 39 158.5 40 192.5 41 223.0 42 257.5 43 289.0 44 303.5 45 296.5 46 276.0 47 273.5 48 259.5 49 223.5 50 170.5 51 126.5 52 107.0 53 96.0 54 82.0 55 59.5 56 39.5 57 30.5 58 24.0 59 18.5 60 15.0 61 8.5 62 4.5 63 2.0 64 3.0 65 2.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.22499999999999998 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.1 7 0.125 8 0.1 9 0.1 10-14 0.12 15-19 0.05 20-24 0.1 25-29 0.1 30-34 0.1 35-39 0.095 40-44 0.08 45-49 0.1 50-54 0.06999999999999999 55-59 0.11 60-64 0.08499999999999999 65-69 0.1 70-74 0.1 75-79 0.09 80-84 0.095 85-89 0.095 90-94 0.08499999999999999 95-99 0.09 100-104 0.08 105-109 0.095 110-114 0.09 115-119 0.095 120-124 0.1 125-129 0.11499999999999999 130-134 0.11499999999999999 135-139 0.11 140-144 0.11499999999999999 145-149 0.09 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.6298815822625347 1.25 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.275 0.0 0.0 0.0 0.0 126-127 0.3 0.0 0.0 0.0 0.0 128-129 0.3 0.0 0.0 0.0 0.0 130-131 0.3 0.0 0.0 0.0 0.0 132-133 0.3125 0.0 0.0 0.0 0.0 134-135 0.3375 0.0 0.0 0.0 0.0 136-137 0.4375 0.0 0.0 0.0 0.0 138-139 0.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAGAC 10 0.006830828 145.0 1 GAATGAT 10 0.006830828 145.0 4 TTCTATT 10 0.006830828 145.0 145 TGAATGA 10 0.006830828 145.0 3 >>END_MODULE Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127230 spots for SRR7495385.sra Written 1127230 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra Read 1127229 spots for SRR7495385.sra Written 1127229 spots for SRR7495385.sra SRR ids: ['SRR7495385.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pee8fmpg SRR7495385.sra spots: 22544581 blocks: [[1, 1127229], [1127230, 2254458], [2254459, 3381687], [3381688, 4508916], [4508917, 5636145], [5636146, 6763374], [6763375, 7890603], [7890604, 9017832], [9017833, 10145061], [10145062, 11272290], [11272291, 12399519], [12399520, 13526748], [13526749, 14653977], [14653978, 15781206], [15781207, 16908435], [16908436, 18035664], [18035665, 19162893], [19162894, 20290122], [20290123, 21417351], [21417352, 22544581]] SRR7495385 file size 7617918 SRR7495385 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7495385 SRR7495385_1.fastq SRR7495385_2.fastq Input file: SRR7495385_1.fastq Paired file: SRR7495385_2.fastq trimmed: SRR7495385-trimmed-pair1.fastq, SRR7495385-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:17:17 2025 >> started Mon Feb 10 18:17:43 2025 >> done (26.339s) 22544581 read pairs processed; of these: 12014 ( 0.05%) short read pairs filtered out after trimming by size control 38606 ( 0.17%) empty read pairs filtered out after trimming by size control 22493961 (99.78%) read pairs available; of these: 7182052 (31.93%) trimmed read pairs available after processing 15311909 (68.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 4 0.00% 20 7 0.00% 21 4 0.00% 22 5 0.00% 23 3 0.00% 24 9 0.00% 25 3 0.00% 26 3 0.00% 27 8 0.00% 28 12 0.00% 29 4 0.00% 30 7 0.00% 31 4 0.00% 32 7 0.00% 33 8 0.00% 34 3 0.00% 35 5 0.00% 36 2 0.00% 37 8 0.00% 38 7 0.00% 39 5 0.00% 40 5 0.00% 41 16 0.00% 42 8 0.00% 43 8 0.00% 44 11 0.00% 45 10 0.00% 46 4 0.00% 47 15 0.00% 48 13 0.00% 49 9 0.00% 50 15 0.00% 51 13 0.00% 52 12 0.00% 53 17 0.00% 54 17 0.00% 55 14 0.00% 56 22 0.00% 57 28 0.00% 58 30 0.00% 59 41 0.00% 60 56 0.00% 61 51 0.00% 62 41 0.00% 63 58 0.00% 64 63 0.00% 65 76 0.00% 66 75 0.00% 67 97 0.00% 68 97 0.00% 69 107 0.00% 70 106 0.00% 71 152 0.00% 72 161 0.00% 73 169 0.00% 74 186 0.00% 75 221 0.00% 76 278 0.00% 77 286 0.00% 78 300 0.00% 79 328 0.00% 80 381 0.00% 81 441 0.00% 82 500 0.00% 83 556 0.00% 84 1190 0.01% 85 1611 0.01% 86 1734 0.01% 87 1736 0.01% 88 1912 0.01% 89 1945 0.01% 90 1994 0.01% 91 2178 0.01% 92 2335 0.01% 93 2283 0.01% 94 2425 0.01% 95 2467 0.01% 96 2536 0.01% 97 2739 0.01% 98 2952 0.01% 99 3140 0.01% 100 3223 0.01% 101 3411 0.02% 102 3573 0.02% 103 3696 0.02% 104 3916 0.02% 105 4209 0.02% 106 4359 0.02% 107 4685 0.02% 108 4917 0.02% 109 5220 0.02% 110 5482 0.02% 111 5727 0.03% 112 6122 0.03% 113 6631 0.03% 114 7093 0.03% 115 7450 0.03% 116 8008 0.04% 117 7956 0.04% 118 8422 0.04% 119 8747 0.04% 120 9181 0.04% 121 9880 0.04% 122 10084 0.04% 123 10720 0.05% 124 11209 0.05% 125 11935 0.05% 126 12680 0.06% 127 13518 0.06% 128 14350 0.06% 129 15354 0.07% 130 16382 0.07% 131 17592 0.08% 132 18707 0.08% 133 20275 0.09% 134 21999 0.10% 135 24301 0.11% 136 26231 0.12% 137 29022 0.13% 138 31765 0.14% 139 35609 0.16% 140 40410 0.18% 141 45423 0.20% 142 52554 0.23% 143 63225 0.28% 144 76790 0.34% 145 98186 0.44% 146 130731 0.58% 147 193986 0.86% 148 324065 1.44% 149 739013 3.29% 150 4903639 21.80% 151 15311909 68.07% 22493961 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=22 prefix-density=0.60 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.14 sequence-density-rank=28 fanout-score=25.59 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=7.3 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=26 prefix-density=0.51 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=23.75 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.8 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7495385 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:18:29 Started mapping on | Feb 10 18:18:29 Finished on | Feb 10 18:20:14 Mapping speed, Million of reads per hour | 771.22 Number of input reads | 22493961 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20944102 Uniquely mapped reads % | 93.11% Average mapped length | 299.29 Number of splices: Total | 21235386 Number of splices: Annotated (sjdb) | 20979792 Number of splices: GT/AG | 20884786 Number of splices: GC/AG | 312113 Number of splices: AT/AC | 11655 Number of splices: Non-canonical | 26832 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406033 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 30282 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.93% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1158351 1158351 1158351 N_multimapping 406033 406033 406033 N_noFeature 375026 20642358 447510 N_ambiguous 338178 995 108490 UnstrandedReadsAssigned:20230898 PositiveStrandReadsAssigned:300749 NegativeStrandReadsAssigned:20388102 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7495385 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7495385-trimmed-pair1.fastq SRR7495385-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,493,961 reads, 20,478,987 reads pseudoaligned [quant] estimated average fragment length: 372.501 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR7495385.ke.tsv 34699 SRR7495385.se.tsv 87100 total ==> SRR7495385.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1646.5 605 15.3142 Potri.005G024800.1.v4.1 1035 663.499 239 15.0127 Potri.004G059700.1.v4.1 961 589.597 47 3.32233 Potri.007G009000.2.v4.1 1416 1044.5 0 0 Potri.003G141000.2.v4.1 2943 2571.5 843 13.6629 Potri.016G087400.1.v4.1 270 54.8134 758 576.346 Potri.015G069301.1.v4.1 564 212.3 0 0 Potri.010G195200.1.v4.1 1773 1401.5 42 1.24898 Potri.012G127500.1.v4.1 977 605.552 493 33.931 ==> SRR7495385.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 962 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 296 Potri.001G212900.v4.1 16 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 43 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 5 SRR7495385 completed mapping pipeline successfully