Starting /dee2/code/volunteer_pipeline.sh SRR7495386 current disk space = 3057630445568 free memory = 1143130152 SRR7495386 SRAfilesize d7f57096aa5950735af9745f9f8a8c84 SRR7495386.sra SRR7495386.sra file validated SRR7495386 is paired end SRR7495386 is conventional basespace SRR7495386 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495386_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.82675 31.0 25.0 32.0 18.0 33.0 2 28.9835 31.0 28.0 33.0 18.0 33.0 3 32.116 33.0 31.0 33.0 30.0 33.0 4 32.86725 33.0 33.0 33.0 33.0 34.0 5 33.1335 33.0 33.0 34.0 33.0 34.0 6 37.3015 38.0 38.0 38.0 36.0 38.0 7 37.64075 38.0 38.0 38.0 38.0 38.0 8 37.742 38.0 38.0 38.0 38.0 38.0 9 37.787 38.0 38.0 38.0 38.0 38.0 10-14 37.771100000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.782650000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.80475 38.0 38.0 38.0 38.0 38.0 25-29 37.75855 38.0 38.0 38.0 38.0 38.0 30-34 37.74615 38.0 38.0 38.0 38.0 38.0 35-39 37.74935 38.0 38.0 38.0 38.0 38.0 40-44 37.72135 38.0 38.0 38.0 38.0 38.0 45-49 37.70825000000001 38.0 38.0 38.0 38.0 38.0 50-54 37.65445 38.0 38.0 38.0 38.0 38.0 55-59 37.60665 38.0 38.0 38.0 38.0 38.0 60-64 37.54955 38.0 38.0 38.0 38.0 38.0 65-69 37.580499999999994 38.0 38.0 38.0 38.0 38.0 70-74 37.5322 38.0 38.0 38.0 37.8 38.0 75-79 37.4824 38.0 38.0 38.0 37.4 38.0 80-84 37.450450000000004 38.0 38.0 38.0 37.2 38.0 85-89 37.435500000000005 38.0 38.0 38.0 37.0 38.0 90-94 37.34755 38.0 38.0 38.0 37.0 38.0 95-99 37.32825 38.0 38.0 38.0 37.0 38.0 100-104 37.22855 38.0 38.0 38.0 36.4 38.0 105-109 37.21485 38.0 38.0 38.0 36.2 38.0 110-114 37.197250000000004 38.0 38.0 38.0 36.0 38.0 115-119 37.0615 38.0 38.0 38.0 36.0 38.0 120-124 36.97595 38.0 38.0 38.0 36.0 38.0 125-129 36.8487 38.0 38.0 38.0 35.2 38.0 130-134 36.8015 38.0 38.0 38.0 35.0 38.0 135-139 36.628949999999996 38.0 38.0 38.0 35.0 38.0 140-144 36.433350000000004 38.0 38.0 38.0 34.0 38.0 145-149 36.28959999999999 38.0 38.0 38.0 33.8 38.0 150-151 34.140125 37.0 35.5 38.0 27.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 0.0 17 2.0 18 2.0 19 0.0 20 1.0 21 1.0 22 0.0 23 2.0 24 2.0 25 5.0 26 7.0 27 5.0 28 6.0 29 12.0 30 10.0 31 23.0 32 38.0 33 48.0 34 43.0 35 110.0 36 413.0 37 3268.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.5169215342191 12.860366006517923 10.554023564803208 34.06868889445976 2 22.875 12.725 34.150000000000006 30.25 3 16.85 19.25 27.775 36.125 4 22.125 24.875 24.275 28.725 5 22.94958615500376 27.890644594933534 24.604966139954854 24.55480311010785 6 22.425 32.0 24.224999999999998 21.349999999999998 7 15.575 26.525 38.725 19.175 8 18.775 27.025 29.675 24.525 9 18.125 25.35 33.7 22.825 10-14 19.685 29.425 27.700000000000003 23.189999999999998 15-19 19.564999999999998 28.09 27.97 24.375 20-24 20.19 28.07 27.66 24.08 25-29 19.735 28.449999999999996 28.005000000000003 23.810000000000002 30-34 20.115 28.065 27.77 24.05 35-39 20.585 27.955000000000002 27.215 24.245 40-44 20.345 28.444999999999997 27.215 23.995 45-49 20.549999999999997 28.51 27.48 23.46 50-54 20.64 28.07 27.615000000000002 23.674999999999997 55-59 20.11 28.275 27.13 24.485 60-64 20.244999999999997 28.235 27.639999999999997 23.880000000000003 65-69 20.25 27.82 27.310000000000002 24.62 70-74 20.265 28.610000000000003 27.644999999999996 23.48 75-79 20.055 27.825 27.534999999999997 24.585 80-84 19.605 28.52 27.3 24.575 85-89 20.775 27.775 27.21 24.240000000000002 90-94 20.695 27.58 27.37 24.355 95-99 20.715 27.700000000000003 27.555000000000003 24.03 100-104 20.36 28.17 27.325 24.145 105-109 20.935000000000002 27.47 27.445000000000004 24.15 110-114 20.935000000000002 27.33 27.750000000000004 23.985 115-119 21.52 27.0 27.725 23.755000000000003 120-124 20.51 27.245 27.47 24.775 125-129 20.705000000000002 27.805000000000003 27.47 24.02 130-134 20.485 27.73 27.495000000000005 24.29 135-139 20.45 27.48 27.310000000000002 24.759999999999998 140-144 20.7 27.529999999999998 27.455000000000002 24.315 145-149 21.035 27.32 27.27 24.375 150-151 20.52855711422846 27.129258517034067 28.2314629258517 24.110721442885772 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 2.5 26 2.5 27 4.5 28 8.5 29 12.5 30 18.0 31 21.0 32 25.0 33 35.0 34 50.5 35 63.5 36 80.5 37 91.5 38 117.0 39 147.0 40 167.5 41 196.5 42 224.0 43 245.5 44 244.0 45 257.5 46 277.0 47 264.0 48 239.5 49 223.5 50 211.0 51 174.0 52 133.5 53 116.0 54 92.0 55 59.5 56 44.5 57 41.0 58 29.0 59 20.0 60 18.0 61 12.0 62 6.5 63 4.0 64 3.5 65 2.5 66 1.5 67 1.0 68 0.5 69 1.5 70 1.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.325 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16750756811302 98.275 2 0.756811301715439 1.5 3 0.07568113017154389 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.175 0.0 0.0 0.0 0.0 124-125 0.175 0.0 0.0 0.0 0.0 126-127 0.1875 0.0 0.0 0.0 0.0 128-129 0.21250000000000002 0.0 0.0 0.0 0.0 130-131 0.25 0.0 0.0 0.0 0.0 132-133 0.2625 0.0 0.0 0.0 0.0 134-135 0.325 0.0 0.0 0.0 0.0 136-137 0.3625 0.0 0.0 0.0 0.0 138-139 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCTGA 10 0.006830828 145.0 145 >>END_MODULE SRR7495386 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495386_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98675 34.0 33.0 34.0 33.0 34.0 2 33.2565 34.0 33.0 34.0 33.0 34.0 3 33.3495 34.0 33.0 34.0 33.0 34.0 4 33.28075 34.0 33.0 34.0 33.0 34.0 5 33.2685 34.0 33.0 34.0 33.0 34.0 6 37.46225 38.0 38.0 38.0 38.0 38.0 7 37.5195 38.0 38.0 38.0 38.0 38.0 8 37.52275 38.0 38.0 38.0 38.0 38.0 9 37.53425 38.0 38.0 38.0 38.0 38.0 10-14 37.519000000000005 38.0 38.0 38.0 38.0 38.0 15-19 37.443 38.0 38.0 38.0 38.0 38.0 20-24 37.3835 38.0 38.0 38.0 38.0 38.0 25-29 37.4601 38.0 38.0 38.0 38.0 38.0 30-34 37.48225 38.0 38.0 38.0 38.0 38.0 35-39 37.48075 38.0 38.0 38.0 38.0 38.0 40-44 37.4496 38.0 38.0 38.0 38.0 38.0 45-49 37.467949999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.438849999999995 38.0 38.0 38.0 38.0 38.0 55-59 37.39900000000001 38.0 38.0 38.0 38.0 38.0 60-64 37.39245 38.0 38.0 38.0 38.0 38.0 65-69 37.357749999999996 38.0 38.0 38.0 38.0 38.0 70-74 37.2953 38.0 38.0 38.0 38.0 38.0 75-79 37.34795 38.0 38.0 38.0 38.0 38.0 80-84 37.30005 38.0 38.0 38.0 38.0 38.0 85-89 37.28345 38.0 38.0 38.0 38.0 38.0 90-94 37.22610000000001 38.0 38.0 38.0 37.2 38.0 95-99 37.131150000000005 38.0 38.0 38.0 37.0 38.0 100-104 37.11795 38.0 38.0 38.0 37.0 38.0 105-109 37.0085 38.0 38.0 38.0 37.0 38.0 110-114 36.8916 38.0 38.0 38.0 36.2 38.0 115-119 36.774449999999995 38.0 38.0 38.0 36.0 38.0 120-124 36.824299999999994 38.0 38.0 38.0 36.0 38.0 125-129 36.84525000000001 38.0 38.0 38.0 35.8 38.0 130-134 36.73995 38.0 38.0 38.0 35.6 38.0 135-139 36.624399999999994 38.0 38.0 38.0 35.2 38.0 140-144 36.36045000000001 38.0 38.0 38.0 34.6 38.0 145-149 36.249900000000004 38.0 38.0 38.0 34.8 38.0 150-151 34.14375 38.0 35.5 38.0 24.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 0.0 10 2.0 11 0.0 12 1.0 13 0.0 14 2.0 15 2.0 16 2.0 17 1.0 18 4.0 19 0.0 20 4.0 21 4.0 22 5.0 23 5.0 24 6.0 25 9.0 26 11.0 27 14.0 28 9.0 29 15.0 30 16.0 31 21.0 32 38.0 33 50.0 34 53.0 35 73.0 36 227.0 37 3415.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.34895439657345 22.34819853867473 16.099773242630384 26.203073822121443 2 26.650000000000002 27.950000000000003 28.9 16.5 3 20.26519889917438 28.096072054040533 31.423567675756818 20.21516137102827 4 23.05764411027569 33.959899749373434 23.333333333333332 19.649122807017545 5 23.673673673673672 35.88588588588589 22.597597597597595 17.842842842842842 6 20.424999999999997 37.1 23.474999999999998 19.0 7 20.275000000000002 21.125 37.375 21.224999999999998 8 21.4 26.450000000000003 26.525 25.624999999999996 9 23.036518259129565 25.662831415707853 28.8144072036018 22.486243121560783 10-14 23.49352402860429 29.25938890833625 25.878881832274843 21.368205230784618 15-19 23.16474712068102 27.786680020030047 27.756634952428644 21.29193790686029 20-24 22.68056739010576 28.705328053731645 27.13147210666132 21.482632449501278 25-29 22.892590925008754 28.035419480714392 27.054880184101254 22.017109410175596 30-34 22.73 27.46 27.805000000000003 22.005 35-39 22.91 28.110000000000003 27.29 21.69 40-44 23.21 27.525 27.284999999999997 21.98 45-49 23.3 27.99 26.985 21.725 50-54 22.97 28.425 26.935 21.67 55-59 23.330000000000002 28.194999999999997 26.945000000000004 21.529999999999998 60-64 23.415 27.644999999999996 26.655 22.285 65-69 23.86 27.175 27.195000000000004 21.77 70-74 23.63927695157979 27.89544840018026 26.83891642882179 21.626358219418158 75-79 23.225 27.6 27.339999999999996 21.834999999999997 80-84 23.815 28.144999999999996 26.72 21.32 85-89 23.82 27.21 27.295 21.675 90-94 23.995 26.855 27.29 21.86 95-99 24.01 27.625 26.75 21.615000000000002 100-104 23.59 27.415 27.16 21.834999999999997 105-109 23.109664496745115 27.931897846770156 26.790185277916873 22.16825237856785 110-114 23.820022046297222 27.24220863814009 27.02675618799479 21.911013127567895 115-119 23.457967377666247 27.447929736511924 27.59849435382685 21.495608531994982 120-124 23.673673673673672 27.557557557557555 27.432432432432428 21.336336336336338 125-129 23.7 28.215 26.575 21.51 130-134 24.695 27.33 26.945000000000004 21.029999999999998 135-139 24.055 27.650000000000002 27.139999999999997 21.154999999999998 140-144 23.805 28.144999999999996 26.5 21.55 145-149 24.18 27.62 27.005000000000003 21.195 150-151 23.822645290581164 27.89328657314629 27.542585170340683 20.741482965931866 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 0.5 24 0.5 25 1.0 26 5.5 27 6.0 28 4.5 29 5.5 30 8.5 31 14.0 32 17.0 33 25.0 34 32.0 35 41.0 36 64.0 37 89.5 38 112.5 39 138.5 40 166.0 41 209.5 42 276.0 43 296.5 44 272.0 45 266.5 46 277.5 47 266.5 48 235.5 49 204.0 50 185.0 51 154.0 52 116.5 53 98.0 54 94.0 55 79.0 56 57.0 57 47.0 58 35.0 59 29.5 60 20.0 61 14.5 62 11.5 63 8.5 64 4.5 65 0.5 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.775 2 0.0 3 0.075 4 0.25 5 0.1 6 0.0 7 0.0 8 0.0 9 0.05 10-14 0.015 15-19 0.15 20-24 0.245 25-29 0.055 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.145 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.15 110-114 0.21 115-119 0.375 120-124 0.1 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8619119878604 97.725 2 1.112797167425392 2.1999999999999997 3 0.025290844714213456 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0625 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.2 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.2 0.0 0.0 0.0 0.0 126-127 0.21250000000000002 0.0 0.0 0.0 0.0 128-129 0.2375 0.0 0.0 0.0 0.0 130-131 0.275 0.0 0.0 0.0 0.0 132-133 0.2875 0.0 0.0 0.0 0.0 134-135 0.35 0.0 0.0 0.0 0.0 136-137 0.3875 0.0 0.0 0.0 0.0 138-139 0.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGAGC 10 0.006830828 145.0 2 >>END_MODULE Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra Read 534123 spots for SRR7495386.sra Written 534123 spots for SRR7495386.sra Read 534122 spots for SRR7495386.sra Written 534122 spots for SRR7495386.sra SRR ids: ['SRR7495386.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2j0538eh SRR7495386.sra spots: 10682441 blocks: [[1, 534122], [534123, 1068244], [1068245, 1602366], [1602367, 2136488], [2136489, 2670610], [2670611, 3204732], [3204733, 3738854], [3738855, 4272976], [4272977, 4807098], [4807099, 5341220], [5341221, 5875342], [5875343, 6409464], [6409465, 6943586], [6943587, 7477708], [7477709, 8011830], [8011831, 8545952], [8545953, 9080074], [9080075, 9614196], [9614197, 10148318], [10148319, 10682441]] SRR7495386 file size 3598228 SRR7495386 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7495386 SRR7495386_1.fastq SRR7495386_2.fastq Input file: SRR7495386_1.fastq Paired file: SRR7495386_2.fastq trimmed: SRR7495386-trimmed-pair1.fastq, SRR7495386-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:20:21 2025 >> started Mon Feb 10 18:20:36 2025 >> done (15.510s) 10682441 read pairs processed; of these: 7580 ( 0.07%) short read pairs filtered out after trimming by size control 10078 ( 0.09%) empty read pairs filtered out after trimming by size control 10664783 (99.83%) read pairs available; of these: 2448875 (22.96%) trimmed read pairs available after processing 8215908 (77.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 0 0.00% 25 2 0.00% 26 5 0.00% 27 1 0.00% 28 3 0.00% 29 37 0.00% 30 5 0.00% 31 4 0.00% 32 2 0.00% 33 5 0.00% 34 3 0.00% 35 5 0.00% 36 1 0.00% 37 2 0.00% 38 2 0.00% 39 16 0.00% 40 6 0.00% 41 7 0.00% 42 5 0.00% 43 5 0.00% 44 3 0.00% 45 6 0.00% 46 10 0.00% 47 4 0.00% 48 12 0.00% 49 23 0.00% 50 14 0.00% 51 10 0.00% 52 17 0.00% 53 17 0.00% 54 11 0.00% 55 14 0.00% 56 22 0.00% 57 24 0.00% 58 24 0.00% 59 22 0.00% 60 14 0.00% 61 27 0.00% 62 30 0.00% 63 33 0.00% 64 39 0.00% 65 40 0.00% 66 39 0.00% 67 39 0.00% 68 54 0.00% 69 55 0.00% 70 58 0.00% 71 81 0.00% 72 92 0.00% 73 76 0.00% 74 120 0.00% 75 108 0.00% 76 164 0.00% 77 164 0.00% 78 158 0.00% 79 169 0.00% 80 181 0.00% 81 184 0.00% 82 261 0.00% 83 260 0.00% 84 702 0.01% 85 922 0.01% 86 975 0.01% 87 979 0.01% 88 1007 0.01% 89 1064 0.01% 90 1144 0.01% 91 1134 0.01% 92 1133 0.01% 93 1136 0.01% 94 1205 0.01% 95 1243 0.01% 96 1343 0.01% 97 1303 0.01% 98 1385 0.01% 99 1418 0.01% 100 1509 0.01% 101 1665 0.02% 102 1722 0.02% 103 1766 0.02% 104 1769 0.02% 105 1890 0.02% 106 1973 0.02% 107 2096 0.02% 108 2167 0.02% 109 2297 0.02% 110 2408 0.02% 111 2652 0.02% 112 2725 0.03% 113 2952 0.03% 114 3194 0.03% 115 3307 0.03% 116 3539 0.03% 117 3676 0.03% 118 3759 0.04% 119 4060 0.04% 120 4375 0.04% 121 4584 0.04% 122 4831 0.05% 123 4947 0.05% 124 5102 0.05% 125 5399 0.05% 126 5749 0.05% 127 6050 0.06% 128 6213 0.06% 129 6583 0.06% 130 6898 0.06% 131 7109 0.07% 132 7526 0.07% 133 8237 0.08% 134 8755 0.08% 135 9494 0.09% 136 10430 0.10% 137 11352 0.11% 138 12176 0.11% 139 13576 0.13% 140 14933 0.14% 141 16585 0.16% 142 18651 0.17% 143 21849 0.20% 144 25887 0.24% 145 31980 0.30% 146 41429 0.39% 147 58733 0.55% 148 97862 0.92% 149 222200 2.08% 150 1677357 15.73% 151 8215908 77.04% 10664783 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=20 prefix-density=0.47 prefix-fanout=2.3 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.18 sequence-density-rank=23 fanout-score=17.25 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=6.4 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=36 prefix-density=0.40 prefix-fanout=2.0 sequence=TCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=32 fanout-score=26.98 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=6.0 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7495386 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:21:28 Started mapping on | Feb 10 18:21:28 Finished on | Feb 10 18:22:27 Mapping speed, Million of reads per hour | 650.73 Number of input reads | 10664783 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 9852164 Uniquely mapped reads % | 92.38% Average mapped length | 299.62 Number of splices: Total | 9602619 Number of splices: Annotated (sjdb) | 9463674 Number of splices: GT/AG | 9419536 Number of splices: GC/AG | 163447 Number of splices: AT/AC | 5955 Number of splices: Non-canonical | 13681 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.01% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 209986 % of reads mapped to multiple loci | 1.97% Number of reads mapped to too many loci | 19940 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.44% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 609985 609985 609985 N_multimapping 209986 209986 209986 N_noFeature 206306 9698750 250069 N_ambiguous 168002 671 57943 UnstrandedReadsAssigned:9477856 PositiveStrandReadsAssigned:152743 NegativeStrandReadsAssigned:9544152 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7495386 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7495386-trimmed-pair1.fastq SRR7495386-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,664,783 reads, 9,595,743 reads pseudoaligned [quant] estimated average fragment length: 394.17 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,018 rounds 52401 SRR7495386.ke.tsv 34699 SRR7495386.se.tsv 87100 total ==> SRR7495386.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1624.83 397 21.8485 Potri.005G024800.1.v4.1 1035 641.83 314 43.7471 Potri.004G059700.1.v4.1 961 567.942 7 1.10213 Potri.007G009000.2.v4.1 1416 1022.83 0 0 Potri.003G141000.2.v4.1 2943 2549.83 668 23.4264 Potri.016G087400.1.v4.1 270 56.939 298 468 Potri.015G069301.1.v4.1 564 196.031 0 0 Potri.010G195200.1.v4.1 1773 1379.83 30 1.94418 Potri.012G127500.1.v4.1 977 583.902 101 15.4676 ==> SRR7495386.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 388 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 115 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 32 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7495386 completed mapping pipeline successfully