Starting /dee2/code/volunteer_pipeline.sh SRR7495387 current disk space = 3057274888192 free memory = 1531537784 SRR7495387 SRAfilesize fc341145204f5a76d391a6a9735efeba SRR7495387.sra SRR7495387.sra file validated SRR7495387 is paired end SRR7495387 is conventional basespace SRR7495387 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495387_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.996 28.0 18.0 33.0 18.0 33.0 2 24.34825 25.0 18.0 29.0 18.0 33.0 3 30.42675 31.0 29.0 33.0 27.0 33.0 4 32.28325 33.0 32.0 33.0 32.0 33.0 5 32.72975 33.0 33.0 33.0 32.0 33.0 6 37.40525 38.0 38.0 38.0 36.0 38.0 7 37.7075 38.0 38.0 38.0 38.0 38.0 8 37.74 38.0 38.0 38.0 38.0 38.0 9 37.7855 38.0 38.0 38.0 38.0 38.0 10-14 37.839 38.0 38.0 38.0 38.0 38.0 15-19 37.854200000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.86525 38.0 38.0 38.0 38.0 38.0 25-29 37.8436 38.0 38.0 38.0 38.0 38.0 30-34 37.8235 38.0 38.0 38.0 38.0 38.0 35-39 37.829249999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.8103 38.0 38.0 38.0 38.0 38.0 45-49 37.7769 38.0 38.0 38.0 38.0 38.0 50-54 37.747400000000006 38.0 38.0 38.0 38.0 38.0 55-59 37.7193 38.0 38.0 38.0 38.0 38.0 60-64 37.69865 38.0 38.0 38.0 38.0 38.0 65-69 37.6568 38.0 38.0 38.0 38.0 38.0 70-74 37.6519 38.0 38.0 38.0 38.0 38.0 75-79 37.62525 38.0 38.0 38.0 38.0 38.0 80-84 37.6251 38.0 38.0 38.0 38.0 38.0 85-89 37.5791 38.0 38.0 38.0 38.0 38.0 90-94 37.5208 38.0 38.0 38.0 37.8 38.0 95-99 37.51625 38.0 38.0 38.0 38.0 38.0 100-104 37.45155 38.0 38.0 38.0 37.2 38.0 105-109 37.3801 38.0 38.0 38.0 37.0 38.0 110-114 37.323899999999995 38.0 38.0 38.0 37.0 38.0 115-119 37.23845 38.0 38.0 38.0 36.6 38.0 120-124 37.161 38.0 38.0 38.0 36.0 38.0 125-129 37.0849 38.0 38.0 38.0 36.0 38.0 130-134 36.9522 38.0 38.0 38.0 35.8 38.0 135-139 36.795649999999995 38.0 38.0 38.0 35.0 38.0 140-144 36.6233 38.0 38.0 38.0 35.0 38.0 145-149 36.4873 38.0 38.0 38.0 34.6 38.0 150-151 34.551874999999995 38.0 36.0 38.0 28.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 2.0 18 0.0 19 1.0 20 0.0 21 2.0 22 1.0 23 3.0 24 2.0 25 3.0 26 3.0 27 7.0 28 6.0 29 4.0 30 7.0 31 14.0 32 16.0 33 30.0 34 53.0 35 103.0 36 328.0 37 3413.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.5247623811906 13.131565782891446 7.20360180090045 30.14007003501751 2 25.243932949712285 14.010507880910684 32.12409306980235 28.621466099574683 3 18.85 18.7 28.349999999999998 34.1 4 21.224999999999998 23.825 24.7 30.25 5 21.582914572864322 30.954773869346734 24.49748743718593 22.964824120603016 6 20.95 33.525 24.75 20.775 7 14.625 27.675 40.65 17.05 8 17.05 29.25 29.925 23.775 9 17.974999999999998 26.900000000000002 32.625 22.5 10-14 19.515 30.555 27.439999999999998 22.49 15-19 19.365 29.4 27.665 23.57 20-24 19.41 28.705000000000002 27.825 24.060000000000002 25-29 19.585 29.175 27.87 23.369999999999997 30-34 19.965 28.910000000000004 27.41 23.715 35-39 20.035 29.2 26.99 23.775 40-44 20.005 28.439999999999998 27.755000000000003 23.799999999999997 45-49 20.41 28.155 27.73 23.705000000000002 50-54 20.04 29.134999999999998 27.065 23.76 55-59 19.935 29.049999999999997 27.235 23.78 60-64 20.105 28.835 27.82 23.24 65-69 20.365 28.575 27.625 23.435 70-74 19.91 28.849999999999998 27.015 24.224999999999998 75-79 20.335 27.66 28.13 23.875 80-84 19.950000000000003 28.28 27.76 24.01 85-89 20.035 28.044999999999998 27.655 24.265 90-94 19.97 28.095 27.33 24.605 95-99 20.119999999999997 27.975 27.74 24.165 100-104 20.8 27.544999999999998 28.139999999999997 23.515 105-109 20.595 27.400000000000002 28.13 23.875 110-114 20.575 27.544999999999998 27.855 24.025 115-119 20.810000000000002 27.73 27.37 24.09 120-124 20.805 28.025 27.11 24.060000000000002 125-129 21.12 28.060000000000002 27.189999999999998 23.630000000000003 130-134 20.765 27.944999999999997 27.525 23.765 135-139 20.560000000000002 27.675 27.279999999999998 24.485 140-144 21.13 27.779999999999998 27.145000000000003 23.945 145-149 20.621031051552578 27.51637581879094 27.541377068853446 24.321216060803042 150-151 20.441158039854617 27.860634164682292 27.62250908635167 24.075698709111418 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.5 24 3.5 25 3.5 26 8.5 27 12.5 28 13.5 29 15.5 30 16.5 31 26.0 32 37.5 33 41.5 34 60.5 35 84.5 36 94.5 37 107.0 38 121.5 39 151.0 40 172.5 41 183.0 42 222.5 43 243.0 44 257.0 45 263.0 46 258.5 47 268.0 48 240.0 49 227.5 50 212.0 51 156.0 52 114.0 53 92.0 54 77.0 55 62.5 56 43.0 57 31.0 58 23.5 59 12.5 60 12.5 61 8.5 62 3.0 63 3.0 64 3.5 65 3.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.075 3 0.0 4 0.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.005 150-151 0.2625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.6000000000000001 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 0.95 0.0 0.0 0.0 0.0 130-131 1.025 0.0 0.0 0.0 0.0 132-133 1.1125 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.2375 0.0 0.0 0.0 0.0 138-139 1.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAACAT 10 0.006830828 145.0 9 GTCCAGT 10 0.006830828 145.0 1 TAAAGTG 10 0.006830828 145.0 145 >>END_MODULE SRR7495387 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7495387_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.41025 34.0 33.0 34.0 33.0 34.0 2 33.5205 34.0 33.0 34.0 33.0 34.0 3 33.56925 34.0 33.0 34.0 33.0 34.0 4 33.531 34.0 33.0 34.0 33.0 34.0 5 33.551 34.0 33.0 34.0 33.0 34.0 6 37.72575 38.0 38.0 38.0 38.0 38.0 7 37.7585 38.0 38.0 38.0 38.0 38.0 8 37.774 38.0 38.0 38.0 38.0 38.0 9 37.7445 38.0 38.0 38.0 38.0 38.0 10-14 37.752250000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.7003 38.0 38.0 38.0 38.0 38.0 20-24 37.6783 38.0 38.0 38.0 38.0 38.0 25-29 37.691250000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.723699999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.714800000000004 38.0 38.0 38.0 38.0 38.0 40-44 37.68055 38.0 38.0 38.0 38.0 38.0 45-49 37.70155 38.0 38.0 38.0 38.0 38.0 50-54 37.6904 38.0 38.0 38.0 38.0 38.0 55-59 37.64325 38.0 38.0 38.0 38.0 38.0 60-64 37.63805 38.0 38.0 38.0 38.0 38.0 65-69 37.6452 38.0 38.0 38.0 38.0 38.0 70-74 37.6025 38.0 38.0 38.0 38.0 38.0 75-79 37.60555000000001 38.0 38.0 38.0 38.0 38.0 80-84 37.5658 38.0 38.0 38.0 38.0 38.0 85-89 37.56115 38.0 38.0 38.0 38.0 38.0 90-94 37.499199999999995 38.0 38.0 38.0 38.0 38.0 95-99 37.48365 38.0 38.0 38.0 38.0 38.0 100-104 37.486599999999996 38.0 38.0 38.0 38.0 38.0 105-109 37.38889999999999 38.0 38.0 38.0 38.0 38.0 110-114 37.3429 38.0 38.0 38.0 38.0 38.0 115-119 37.3051 38.0 38.0 38.0 38.0 38.0 120-124 37.25865 38.0 38.0 38.0 37.6 38.0 125-129 37.285250000000005 38.0 38.0 38.0 37.8 38.0 130-134 37.14059999999999 38.0 38.0 38.0 36.6 38.0 135-139 37.09755 38.0 38.0 38.0 36.2 38.0 140-144 37.011649999999996 38.0 38.0 38.0 36.0 38.0 145-149 36.9101 38.0 38.0 38.0 36.0 38.0 150-151 35.176249999999996 38.0 36.5 38.0 31.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 2.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 3.0 16 2.0 17 0.0 18 0.0 19 4.0 20 3.0 21 2.0 22 1.0 23 5.0 24 3.0 25 4.0 26 1.0 27 3.0 28 4.0 29 10.0 30 14.0 31 12.0 32 15.0 33 24.0 34 28.0 35 50.0 36 168.0 37 3636.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.33400100150226 25.28793189784677 11.69253880821232 23.685528292438658 2 25.881470367591895 28.557139284821204 28.232058014503625 17.329332333083272 3 20.785392696348172 29.389694847423716 30.440220110055026 19.384692346173086 4 23.841723015276735 35.03631354871024 21.7129977460556 19.408965689957427 5 24.64348261195897 36.727545659244434 21.36602451838879 17.262947210407805 6 21.510755377688845 38.71935967983992 21.76088044022011 18.009004502251123 7 20.599999999999998 21.6 36.3 21.5 8 22.275 26.174999999999997 27.224999999999998 24.325 9 22.25 26.224999999999998 27.55 23.974999999999998 10-14 24.095 29.385 25.445 21.075 15-19 23.298979387632578 28.311987192315392 27.111266760056036 21.277766659995997 20-24 22.8321240930698 29.44208156117088 26.649987490617967 21.075806855141355 25-29 23.605901475368842 28.272068017004255 26.996749187296825 21.12528132033008 30-34 22.785 27.975 27.450000000000003 21.790000000000003 35-39 23.064999999999998 28.315 26.83 21.790000000000003 40-44 23.330000000000002 27.71 27.41 21.55 45-49 23.369999999999997 27.72 27.04 21.87 50-54 23.605 28.395 26.8 21.2 55-59 23.235 28.1 27.0 21.665 60-64 23.595 27.33 27.16 21.915000000000003 65-69 23.39 28.035 26.740000000000002 21.834999999999997 70-74 23.922726590260748 27.215855062309192 27.110755217456585 21.750663129973475 75-79 23.565 27.794999999999998 27.134999999999998 21.505 80-84 23.400000000000002 27.82 26.69 22.09 85-89 23.625 27.779999999999998 27.01 21.584999999999997 90-94 23.0 27.875 26.825 22.3 95-99 24.5 28.005000000000003 26.3 21.195 100-104 23.785 27.750000000000004 26.974999999999998 21.490000000000002 105-109 24.00160144129717 27.664898408567712 27.05434891402262 21.2791512361125 110-114 23.56123215627348 27.473077886301027 27.473077886301027 21.492612071124466 115-119 23.50348144066523 27.96172919901818 27.3405800731353 21.194209287181284 120-124 23.62326814385035 27.939778922622914 27.21952683439204 21.2174260991347 125-129 23.51617580879044 27.751387569378466 27.556377818890944 21.176058802940148 130-134 23.997399739974 27.367736773677372 27.53775377537754 21.097109710971097 135-139 23.736186809340467 27.471373568678437 27.58137906895345 21.211060553027654 140-144 23.625 27.655 27.400000000000002 21.32 145-149 24.25 27.345000000000002 27.200000000000003 21.205 150-151 23.759398496240603 27.731829573934835 27.343358395989974 21.165413533834588 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 1.5 27 2.5 28 3.5 29 3.0 30 6.0 31 8.0 32 10.0 33 16.5 34 29.5 35 42.5 36 52.5 37 74.5 38 115.0 39 148.5 40 188.5 41 229.5 42 250.5 43 266.0 44 304.5 45 314.0 46 283.0 47 275.0 48 246.5 49 210.5 50 199.0 51 166.0 52 126.5 53 103.5 54 85.0 55 65.5 56 41.0 57 30.5 58 28.5 59 23.0 60 16.0 61 11.0 62 5.0 63 3.5 64 3.5 65 1.5 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.025 3 0.05 4 0.17500000000000002 5 0.075 6 0.05 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.06 20-24 0.075 25-29 0.025 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.095 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.09 110-114 0.17500000000000002 115-119 0.185 120-124 0.034999999999999996 125-129 0.005 130-134 0.01 135-139 0.005 140-144 0.0 145-149 0.0 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3198992443325 98.575 2 0.6297229219143577 1.25 3 0.025188916876574305 0.075 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.6000000000000001 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 0.9875 0.0 0.0 0.0 0.0 132-133 1.0625 0.0 0.0 0.0 0.0 134-135 1.1375000000000002 0.0 0.0 0.0 0.0 136-137 1.1875 0.0 0.0 0.0 0.0 138-139 1.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra Read 448076 spots for SRR7495387.sra Written 448076 spots for SRR7495387.sra Read 448057 spots for SRR7495387.sra Written 448057 spots for SRR7495387.sra SRR ids: ['SRR7495387.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_972xrqlr SRR7495387.sra spots: 8961159 blocks: [[1, 448057], [448058, 896114], [896115, 1344171], [1344172, 1792228], [1792229, 2240285], [2240286, 2688342], [2688343, 3136399], [3136400, 3584456], [3584457, 4032513], [4032514, 4480570], [4480571, 4928627], [4928628, 5376684], [5376685, 5824741], [5824742, 6272798], [6272799, 6720855], [6720856, 7168912], [7168913, 7616969], [7616970, 8065026], [8065027, 8513083], [8513084, 8961159]] SRR7495387 file size 3016971 SRR7495387 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7495387 SRR7495387_1.fastq SRR7495387_2.fastq Input file: SRR7495387_1.fastq Paired file: SRR7495387_2.fastq trimmed: SRR7495387-trimmed-pair1.fastq, SRR7495387-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 18:56:50 2025 >> started Mon Feb 10 18:57:04 2025 >> done (13.735s) 8961159 read pairs processed; of these: 4048 ( 0.05%) short read pairs filtered out after trimming by size control 6157 ( 0.07%) empty read pairs filtered out after trimming by size control 8950954 (99.89%) read pairs available; of these: 1787866 (19.97%) trimmed read pairs available after processing 7163088 (80.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 0 0.00% 22 3 0.00% 23 1 0.00% 24 5 0.00% 25 0 0.00% 26 3 0.00% 27 2 0.00% 28 8 0.00% 29 3 0.00% 30 4 0.00% 31 3 0.00% 32 1 0.00% 33 3 0.00% 34 2 0.00% 35 7 0.00% 36 3 0.00% 37 2 0.00% 38 6 0.00% 39 5 0.00% 40 6 0.00% 41 6 0.00% 42 5 0.00% 43 4 0.00% 44 7 0.00% 45 2 0.00% 46 5 0.00% 47 6 0.00% 48 8 0.00% 49 10 0.00% 50 8 0.00% 51 13 0.00% 52 8 0.00% 53 14 0.00% 54 14 0.00% 55 12 0.00% 56 11 0.00% 57 22 0.00% 58 20 0.00% 59 25 0.00% 60 27 0.00% 61 24 0.00% 62 35 0.00% 63 30 0.00% 64 38 0.00% 65 33 0.00% 66 54 0.00% 67 52 0.00% 68 61 0.00% 69 64 0.00% 70 76 0.00% 71 93 0.00% 72 94 0.00% 73 113 0.00% 74 122 0.00% 75 144 0.00% 76 166 0.00% 77 148 0.00% 78 216 0.00% 79 231 0.00% 80 247 0.00% 81 278 0.00% 82 319 0.00% 83 323 0.00% 84 540 0.01% 85 757 0.01% 86 845 0.01% 87 851 0.01% 88 1010 0.01% 89 940 0.01% 90 1067 0.01% 91 1094 0.01% 92 1128 0.01% 93 1165 0.01% 94 1231 0.01% 95 1274 0.01% 96 1395 0.02% 97 1414 0.02% 98 1570 0.02% 99 1535 0.02% 100 1760 0.02% 101 1811 0.02% 102 1854 0.02% 103 2112 0.02% 104 2097 0.02% 105 2294 0.03% 106 2314 0.03% 107 2487 0.03% 108 2623 0.03% 109 2712 0.03% 110 2760 0.03% 111 3060 0.03% 112 3254 0.04% 113 3356 0.04% 114 3583 0.04% 115 3717 0.04% 116 3876 0.04% 117 3975 0.04% 118 4250 0.05% 119 4445 0.05% 120 4517 0.05% 121 4975 0.06% 122 5119 0.06% 123 5360 0.06% 124 5414 0.06% 125 5698 0.06% 126 5888 0.07% 127 6041 0.07% 128 6181 0.07% 129 6637 0.07% 130 6718 0.08% 131 6997 0.08% 132 7262 0.08% 133 7750 0.09% 134 8103 0.09% 135 8376 0.09% 136 9212 0.10% 137 9424 0.11% 138 10123 0.11% 139 10843 0.12% 140 11781 0.13% 141 12547 0.14% 142 14011 0.16% 143 15478 0.17% 144 17827 0.20% 145 21546 0.24% 146 28149 0.31% 147 42800 0.48% 148 57530 0.64% 149 133765 1.49% 150 1212376 13.54% 151 7163088 80.03% 8950954 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=31 prefix-density=0.55 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=30 fanout-score=23.53 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=5.7 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=28 prefix-density=0.54 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=23 fanout-score=16.68 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=5.2 sequence=ATGGCTTCAACTTC SRR7495387 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 18:57:44 Started mapping on | Feb 10 18:57:44 Finished on | Feb 10 18:58:30 Mapping speed, Million of reads per hour | 700.51 Number of input reads | 8950954 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 8476549 Uniquely mapped reads % | 94.70% Average mapped length | 299.42 Number of splices: Total | 8473579 Number of splices: Annotated (sjdb) | 8364526 Number of splices: GT/AG | 8332150 Number of splices: GC/AG | 125449 Number of splices: AT/AC | 5018 Number of splices: Non-canonical | 10962 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.01% Deletion average length | 2.43 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 172035 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 28082 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.03% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 307343 307343 307343 N_multimapping 172035 172035 172035 N_noFeature 162340 8338635 194136 N_ambiguous 153772 481 47469 UnstrandedReadsAssigned:8160437 PositiveStrandReadsAssigned:137433 NegativeStrandReadsAssigned:8234944 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7495387 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7495387-trimmed-pair1.fastq SRR7495387-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,950,954 reads, 8,287,997 reads pseudoaligned [quant] estimated average fragment length: 331.656 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,050 rounds 52401 SRR7495387.ke.tsv 34699 SRR7495387.se.tsv 87100 total ==> SRR7495387.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1687.34 220 12.4231 Potri.005G024800.1.v4.1 1035 704.344 131 17.7214 Potri.004G059700.1.v4.1 961 630.366 14 2.11615 Potri.007G009000.2.v4.1 1416 1085.34 0 0 Potri.003G141000.2.v4.1 2943 2612.34 299 10.9057 Potri.016G087400.1.v4.1 270 60.7414 391 613.342 Potri.015G069301.1.v4.1 564 243.247 0 0 Potri.010G195200.1.v4.1 1773 1442.34 22 1.45333 Potri.012G127500.1.v4.1 977 646.344 138 20.3436 ==> SRR7495387.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 321 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 192 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 17 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7495387 completed mapping pipeline successfully