Starting /dee2/code/volunteer_pipeline.sh SRR8424223 current disk space = 3050673844224 free memory = 1578742004 SRR8424223 SRAfilesize 4e7b4de9edfea2e02a885338f9813287 SRR8424223.sra SRR8424223.sra file validated SRR8424223 is paired end SRR8424223 is conventional basespace SRR8424223 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424223_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.145 32.0 32.0 32.0 32.0 32.0 2 31.2875 32.0 32.0 32.0 32.0 32.0 3 34.71 37.0 32.0 37.0 32.0 37.0 4 35.38625 37.0 37.0 37.0 32.0 37.0 5 35.92625 37.0 37.0 37.0 32.0 37.0 6 39.00475 41.0 37.0 41.0 32.0 41.0 7 39.0545 41.0 41.0 41.0 37.0 41.0 8 38.98625 41.0 41.0 41.0 32.0 41.0 9 39.19125 41.0 41.0 41.0 37.0 41.0 10-11 39.349875 41.0 41.0 41.0 37.0 41.0 12-13 39.24875 41.0 41.0 41.0 37.0 41.0 14-15 39.2675 41.0 41.0 41.0 37.0 41.0 16-17 39.252375 41.0 41.0 41.0 37.0 41.0 18-19 39.161 41.0 41.0 41.0 37.0 41.0 20-21 38.399625 41.0 39.0 41.0 34.5 41.0 22-23 39.119375000000005 41.0 41.0 41.0 37.0 41.0 24-25 39.09525 41.0 41.0 41.0 37.0 41.0 26-27 38.982375000000005 41.0 41.0 41.0 37.0 41.0 28-29 38.510374999999996 41.0 39.0 41.0 32.0 41.0 30-31 38.771 41.0 39.0 41.0 32.0 41.0 32-33 39.0235 41.0 41.0 41.0 37.0 41.0 34-35 38.928 41.0 41.0 41.0 32.0 41.0 36-37 39.096625 41.0 41.0 41.0 37.0 41.0 38-39 39.079125 41.0 41.0 41.0 34.5 41.0 40-41 38.838499999999996 41.0 41.0 41.0 34.5 41.0 42-43 38.7705 41.0 41.0 41.0 32.0 41.0 44-45 38.973625 41.0 41.0 41.0 37.0 41.0 46-47 38.707499999999996 41.0 41.0 41.0 32.0 41.0 48-49 38.814875 41.0 41.0 41.0 32.0 41.0 50-51 38.867875 41.0 41.0 41.0 34.5 41.0 52-53 38.838499999999996 41.0 41.0 41.0 32.0 41.0 54-55 38.79575 41.0 41.0 41.0 34.5 41.0 56-57 38.825375 41.0 41.0 41.0 34.5 41.0 58-59 38.738 41.0 41.0 41.0 32.0 41.0 60-61 38.548625 41.0 39.0 41.0 32.0 41.0 62-63 38.834625 41.0 41.0 41.0 32.0 41.0 64-65 38.631875 41.0 41.0 41.0 32.0 41.0 66-67 38.69425 41.0 41.0 41.0 32.0 41.0 68-69 38.70325 41.0 39.0 41.0 32.0 41.0 70-71 38.63825 41.0 39.0 41.0 32.0 41.0 72-73 38.637125 41.0 39.0 41.0 32.0 41.0 74-75 38.47 41.0 39.0 41.0 32.0 41.0 76-77 37.9015 41.0 37.0 41.0 29.5 41.0 78-79 38.259874999999994 41.0 37.0 41.0 32.0 41.0 80-81 38.558875 41.0 39.0 41.0 32.0 41.0 82-83 38.568875 41.0 41.0 41.0 32.0 41.0 84-85 38.729749999999996 41.0 41.0 41.0 32.0 41.0 86-87 38.609375 41.0 41.0 41.0 32.0 41.0 88-89 38.460375 41.0 37.0 41.0 32.0 41.0 90-91 38.432125 41.0 37.0 41.0 32.0 41.0 92-93 38.413875000000004 41.0 37.0 41.0 32.0 41.0 94-95 38.477374999999995 41.0 37.0 41.0 32.0 41.0 96-97 38.323125000000005 41.0 37.0 41.0 32.0 41.0 98-99 38.146 41.0 37.0 41.0 32.0 41.0 100-101 38.40275 41.0 39.0 41.0 32.0 41.0 102-103 38.282375 41.0 37.0 41.0 32.0 41.0 104-105 38.115125 41.0 37.0 41.0 32.0 41.0 106-107 38.04675 41.0 37.0 41.0 32.0 41.0 108-109 38.116375000000005 41.0 37.0 41.0 32.0 41.0 110-111 38.233374999999995 41.0 37.0 41.0 32.0 41.0 112-113 38.101 41.0 37.0 41.0 32.0 41.0 114-115 37.94199999999999 41.0 37.0 41.0 32.0 41.0 116-117 37.926 41.0 37.0 41.0 32.0 41.0 118-119 38.101625 41.0 37.0 41.0 32.0 41.0 120-121 38.085125 41.0 37.0 41.0 32.0 41.0 122-123 37.899125 41.0 37.0 41.0 32.0 41.0 124-125 37.899625 41.0 37.0 41.0 32.0 41.0 126 36.3075 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 7.0 25 9.0 26 13.0 27 16.0 28 29.0 29 39.0 30 59.0 31 74.0 32 96.0 33 96.0 34 128.0 35 182.0 36 192.0 37 242.0 38 339.0 39 580.0 40 1899.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.61344113188479 10.68721576553815 14.249621020717534 40.44972208185953 2 25.2 16.475 32.5 25.825 3 23.225 23.525 23.75 29.5 4 26.0 30.425 19.525000000000002 24.05 5 24.625 34.825 21.7 18.85 6 18.8 35.15 24.25 21.8 7 13.975000000000001 25.525 40.9 19.6 8 18.05 23.599999999999998 32.1 26.25 9 17.625 21.15 34.150000000000006 27.075 10-11 19.950000000000003 33.575 23.8125 22.662499999999998 12-13 19.3375 26.5375 29.212500000000002 24.9125 14-15 20.7 26.987499999999997 28.849999999999998 23.4625 16-17 20.674999999999997 27.55 27.0625 24.712500000000002 18-19 20.0 27.3625 28.0875 24.55 20-21 21.378430121250798 27.657945118059992 27.223994894703257 23.73962986598596 22-23 20.974999999999998 29.262500000000003 26.5625 23.200000000000003 24-25 20.075000000000003 27.85 28.000000000000004 24.075 26-27 20.45 28.487499999999997 27.3875 23.674999999999997 28-29 21.06060606060606 28.434343434343432 27.03282828282828 23.47222222222222 30-31 20.5375 27.800000000000004 26.724999999999998 24.9375 32-33 19.8625 29.3375 26.974999999999998 23.825 34-35 20.0125 28.462500000000002 27.4125 24.1125 36-37 19.8375 28.875 26.6625 24.625 38-39 20.7875 27.762500000000003 27.525 23.925 40-41 21.3625 28.6125 26.974999999999998 23.05 42-43 20.1 28.425 27.1125 24.3625 44-45 21.0375 28.812500000000004 26.1 24.05 46-47 19.775000000000002 29.075 27.05 24.099999999999998 48-49 20.7625 27.325 27.462500000000002 24.45 50-51 20.674999999999997 28.575 27.0875 23.6625 52-53 20.4 28.8625 27.3875 23.35 54-55 20.9 27.8875 26.400000000000002 24.8125 56-57 20.9 27.400000000000002 27.3375 24.3625 58-59 20.575 28.625 27.400000000000002 23.400000000000002 60-61 20.25 28.3125 26.9625 24.474999999999998 62-63 21.712500000000002 27.212500000000002 27.3375 23.7375 64-65 21.55 28.3375 26.375 23.7375 66-67 19.9875 27.224999999999998 28.5625 24.224999999999998 68-69 20.9375 27.8875 26.625 24.55 70-71 21.0375 27.8875 28.15 22.925 72-73 21.075 27.625 27.1125 24.1875 74-75 20.5375 27.474999999999998 28.3375 23.65 76-77 20.75 28.037499999999998 27.025 24.1875 78-79 20.65 27.900000000000002 27.325 24.125 80-81 21.4875 27.275 27.400000000000002 23.8375 82-83 20.724999999999998 28.7 26.275 24.3 84-85 20.75 27.987499999999997 27.1375 24.125 86-87 21.337500000000002 27.750000000000004 27.212500000000002 23.7 88-89 21.087500000000002 28.375 27.250000000000004 23.2875 90-91 21.875 26.325 27.325 24.474999999999998 92-93 21.05 27.975 27.0625 23.9125 94-95 21.6 28.512500000000003 26.1 23.7875 96-97 21.087500000000002 27.975 27.275 23.6625 98-99 21.837500000000002 27.525 26.887499999999996 23.75 100-101 21.3 28.375 26.687499999999996 23.6375 102-103 21.0125 26.85 27.762500000000003 24.375 104-105 21.25 26.775 27.8125 24.1625 106-107 21.762500000000003 27.8125 26.887499999999996 23.5375 108-109 20.575 29.7875 26.2625 23.375 110-111 22.2 28.037499999999998 26.0 23.7625 112-113 21.325 27.775 27.250000000000004 23.65 114-115 21.637500000000003 27.6875 26.775 23.9 116-117 22.05 27.8875 26.3625 23.7 118-119 21.462500000000002 28.5625 26.0 23.974999999999998 120-121 22.0625 28.0875 26.3 23.549999999999997 122-123 22.662499999999998 27.35 26.1125 23.875 124-125 21.9625 27.212500000000002 27.5125 23.3125 126 22.075 28.199999999999996 25.4 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 2.5 24 2.5 25 2.0 26 4.0 27 6.0 28 9.0 29 12.5 30 18.0 31 25.0 32 32.5 33 36.0 34 48.5 35 63.0 36 71.5 37 88.0 38 112.5 39 144.5 40 170.0 41 191.0 42 214.5 43 236.5 44 266.0 45 271.0 46 254.5 47 239.5 48 231.5 49 209.5 50 181.0 51 157.5 52 130.5 53 117.0 54 93.0 55 71.5 56 60.0 57 51.0 58 46.0 59 32.5 60 24.5 61 21.5 62 14.0 63 9.0 64 3.5 65 1.5 66 3.0 67 4.0 68 4.0 69 3.5 70 2.0 71 0.5 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 2.0625 22-23 0.0 24-25 0.0 26-27 0.0 28-29 1.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96412329459324 97.925 2 1.010611419909045 2.0 3 0.025265285497726126 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8424223 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424223_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 14.4025 2.0 2.0 32.0 2.0 32.0 2 29.81375 32.0 32.0 32.0 27.0 32.0 3 30.76 32.0 32.0 32.0 27.0 37.0 4 32.26375 37.0 32.0 37.0 22.0 37.0 5 33.2725 37.0 32.0 37.0 27.0 37.0 6 35.761 41.0 32.0 41.0 22.0 41.0 7 35.49325 41.0 32.0 41.0 22.0 41.0 8 36.03325 41.0 37.0 41.0 22.0 41.0 9 36.09 41.0 37.0 41.0 22.0 41.0 10-11 36.38175 41.0 37.0 41.0 22.0 41.0 12-13 36.442375 41.0 37.0 41.0 24.5 41.0 14-15 36.0225 41.0 37.0 41.0 22.0 41.0 16-17 36.343 41.0 37.0 41.0 22.0 41.0 18-19 36.134249999999994 41.0 37.0 41.0 22.0 41.0 20-21 36.101 41.0 37.0 41.0 22.0 41.0 22-23 36.09925 41.0 37.0 41.0 22.0 41.0 24-25 36.065375 41.0 37.0 41.0 22.0 41.0 26-27 35.328375 41.0 32.0 41.0 22.0 41.0 28-29 35.896375 41.0 37.0 41.0 22.0 41.0 30-31 35.815875000000005 41.0 37.0 41.0 22.0 41.0 32-33 35.7745 41.0 37.0 41.0 22.0 41.0 34-35 35.787375 41.0 37.0 41.0 22.0 41.0 36-37 35.8565 41.0 37.0 41.0 22.0 41.0 38-39 35.398875000000004 41.0 34.5 41.0 22.0 41.0 40-41 35.401875000000004 41.0 32.0 41.0 22.0 41.0 42-43 35.661874999999995 41.0 34.5 41.0 22.0 41.0 44-45 35.652 41.0 37.0 41.0 22.0 41.0 46-47 35.745 41.0 34.5 41.0 22.0 41.0 48-49 35.55475 41.0 32.0 41.0 22.0 41.0 50-51 35.58125 41.0 32.0 41.0 22.0 41.0 52-53 35.367875 41.0 32.0 41.0 22.0 41.0 54-55 35.345749999999995 41.0 32.0 41.0 22.0 41.0 56-57 35.5065 41.0 32.0 41.0 22.0 41.0 58-59 35.4035 41.0 32.0 41.0 22.0 41.0 60-61 35.327125 41.0 32.0 41.0 22.0 41.0 62-63 35.2845 41.0 32.0 41.0 22.0 41.0 64-65 35.22125 41.0 32.0 41.0 22.0 41.0 66-67 35.1665 41.0 32.0 41.0 22.0 41.0 68-69 35.2035 41.0 32.0 41.0 22.0 41.0 70-71 35.08075 41.0 32.0 41.0 22.0 41.0 72-73 34.86750000000001 41.0 32.0 41.0 17.0 41.0 74-75 34.990125000000006 41.0 32.0 41.0 22.0 41.0 76-77 33.77375 39.0 29.5 41.0 22.0 41.0 78-79 34.171 39.0 32.0 41.0 17.0 41.0 80-81 34.440625 41.0 32.0 41.0 12.0 41.0 82-83 34.36475 41.0 29.5 41.0 17.0 41.0 84-85 34.3575 41.0 32.0 41.0 17.0 41.0 86-87 34.140125 39.0 29.5 41.0 17.0 41.0 88-89 34.69975 41.0 32.0 41.0 12.0 41.0 90-91 34.6255 41.0 32.0 41.0 12.0 41.0 92-93 34.541125 41.0 32.0 41.0 17.0 41.0 94-95 33.716375 37.0 29.5 41.0 12.0 41.0 96-97 34.11725 41.0 29.5 41.0 17.0 41.0 98-99 34.48125 41.0 32.0 41.0 12.0 41.0 100-101 33.97525 39.0 32.0 41.0 12.0 41.0 102-103 34.496875 41.0 32.0 41.0 12.0 41.0 104-105 34.5975 41.0 32.0 41.0 12.0 41.0 106-107 34.494125 41.0 32.0 41.0 12.0 41.0 108-109 34.393375 41.0 32.0 41.0 12.0 41.0 110-111 32.651125 37.0 24.5 41.0 12.0 41.0 112-113 33.527125 37.0 27.0 41.0 12.0 41.0 114-115 33.291125 37.0 27.0 41.0 12.0 41.0 116-117 33.45725 37.0 27.0 41.0 12.0 41.0 118-119 32.256 37.0 24.5 41.0 12.0 41.0 120-121 33.3925 37.0 27.0 41.0 12.0 41.0 122-123 33.9055 37.0 32.0 41.0 12.0 41.0 124-125 33.347875 37.0 27.0 41.0 12.0 41.0 126 31.44575 37.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 4.0 16 4.0 17 19.0 18 23.0 19 37.0 20 35.0 21 57.0 22 53.0 23 78.0 24 71.0 25 76.0 26 87.0 27 97.0 28 105.0 29 95.0 30 119.0 31 149.0 32 151.0 33 183.0 34 163.0 35 219.0 36 244.0 37 305.0 38 377.0 39 603.0 40 646.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.28953229398664 19.766146993318486 17.817371937639198 32.12694877505568 2 27.0 26.450000000000003 29.599999999999998 16.950000000000003 3 23.474999999999998 31.574999999999996 26.5 18.45 4 26.474999999999998 36.325 20.375 16.825000000000003 5 27.625 36.85 21.0 14.524999999999999 6 19.05 39.625 22.225 19.1 7 19.575 18.8 39.225 22.400000000000002 8 22.1 23.674999999999997 29.225 25.0 9 23.375 22.25 30.349999999999998 24.025 10-11 24.25 32.587500000000006 23.375 19.787499999999998 12-13 22.725 25.974999999999998 29.4125 21.8875 14-15 22.9375 26.825 28.512500000000003 21.725 16-17 24.5125 25.924999999999997 28.000000000000004 21.5625 18-19 22.9875 27.150000000000002 28.225 21.637500000000003 20-21 23.925 26.424999999999997 27.450000000000003 22.2 22-23 24.2625 27.737499999999997 26.35 21.65 24-25 22.85 28.675 26.937499999999996 21.5375 26-27 23.35 27.05 27.400000000000002 22.2 28-29 23.3375 27.6875 27.250000000000004 21.725 30-31 23.3875 26.987499999999997 27.900000000000002 21.725 32-33 24.462500000000002 27.787499999999998 26.6625 21.087500000000002 34-35 23.9 27.712500000000002 27.6875 20.7 36-37 24.3625 27.275 27.500000000000004 20.8625 38-39 24.6875 28.050000000000004 27.150000000000002 20.1125 40-41 23.4375 28.1125 27.3 21.15 42-43 23.5 26.450000000000003 28.075 21.975 44-45 23.5375 28.199999999999996 27.3875 20.875 46-47 24.1875 27.275 27.9125 20.625 48-49 23.6875 27.1375 27.2625 21.912499999999998 50-51 23.7125 27.575 27.6625 21.05 52-53 23.225 27.9125 27.712500000000002 21.15 54-55 23.1625 27.037499999999998 27.85 21.95 56-57 23.925 26.5875 27.762500000000003 21.725 58-59 23.75 26.75 27.55 21.95 60-61 23.150000000000002 27.775 27.200000000000003 21.875 62-63 23.45 27.725 27.075 21.75 64-65 23.400000000000002 27.250000000000004 27.787499999999998 21.5625 66-67 23.474999999999998 27.237499999999997 27.0125 22.275 68-69 23.8375 27.0 27.250000000000004 21.912499999999998 70-71 23.962500000000002 27.237499999999997 27.925 20.875 72-73 23.7875 27.8125 26.8125 21.587500000000002 74-75 22.725 28.9 26.5875 21.7875 76-77 23.9125 27.0 27.3125 21.775 78-79 24.0375 27.9375 27.487499999999997 20.5375 80-81 24.175 27.5875 25.900000000000002 22.3375 82-83 23.9375 28.0875 26.5 21.475 84-85 24.165103189493433 26.97936210131332 27.34208880550344 21.513445903689806 86-87 23.9375 27.875 26.75 21.4375 88-89 23.556002009040682 27.68709191361125 27.034153691612257 21.72275238573581 90-91 23.474999999999998 26.687499999999996 27.737499999999997 22.1 92-93 23.95 27.437499999999996 26.5375 22.075 94-95 23.175 26.150000000000002 28.4125 22.2625 96-97 23.408263217380384 26.886851689061913 27.389174934070077 22.31571015948763 98-99 23.8375 27.8625 27.675 20.625 100-101 24.0 27.35 26.900000000000002 21.75 102-103 22.525000000000002 27.487499999999997 27.762500000000003 22.225 104-105 23.75 26.4625 27.5625 22.225 106-107 24.087500000000002 27.5125 26.987499999999997 21.4125 108-109 23.925 27.400000000000002 28.000000000000004 20.674999999999997 110-111 24.45 27.425 26.5875 21.5375 112-113 23.9375 27.9125 26.924999999999997 21.224999999999998 114-115 23.248207321675682 27.600956095106305 27.46257390866776 21.688262674550256 116-117 24.425 27.537499999999998 25.650000000000002 22.3875 118-119 23.625 27.250000000000004 27.5625 21.5625 120-121 24.1875 26.525 27.8125 21.475 122-123 24.3875 27.2625 27.6 20.75 124-125 24.8125 27.950000000000003 26.4625 20.775 126 23.95 26.775 27.500000000000004 21.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 1.0 22 1.0 23 2.5 24 1.5 25 1.0 26 3.0 27 5.0 28 7.5 29 10.0 30 12.5 31 14.0 32 19.0 33 29.5 34 46.0 35 60.0 36 78.0 37 101.0 38 134.5 39 162.5 40 176.5 41 198.0 42 212.5 43 233.0 44 259.5 45 269.0 46 254.0 47 251.5 48 246.5 49 219.5 50 199.0 51 158.0 52 115.5 53 102.0 54 93.0 55 71.5 56 63.5 57 51.0 58 30.0 59 25.5 60 23.0 61 16.5 62 7.5 63 6.0 64 6.0 65 4.0 66 3.0 67 2.0 68 1.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 55.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0625 86-87 0.0 88-89 0.44999999999999996 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.46249999999999997 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.6375 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31972789115646 98.55000000000001 2 0.6046863189720333 1.2 3 0.05039052658100278 0.15 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114 1.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATTGG 15 0.0040609157 59.5875 16-17 >>END_MODULE Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754331 spots for SRR8424223.sra Written 3754331 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra Read 3754324 spots for SRR8424223.sra Written 3754324 spots for SRR8424223.sra SRR ids: ['SRR8424223.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vyvo4j2i SRR8424223.sra spots: 75086487 blocks: [[1, 3754324], [3754325, 7508648], [7508649, 11262972], [11262973, 15017296], [15017297, 18771620], [18771621, 22525944], [22525945, 26280268], [26280269, 30034592], [30034593, 33788916], [33788917, 37543240], [37543241, 41297564], [41297565, 45051888], [45051889, 48806212], [48806213, 52560536], [52560537, 56314860], [56314861, 60069184], [60069185, 63823508], [63823509, 67577832], [67577833, 71332156], [71332157, 75086487]] SRR8424223 file size 21756313 SRR8424223 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8424223 SRR8424223_1.fastq SRR8424223_2.fastq Input file: SRR8424223_1.fastq Paired file: SRR8424223_2.fastq trimmed: SRR8424223-trimmed-pair1.fastq, SRR8424223-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:05:27 2025 >> started Tue Feb 11 13:06:42 2025 >> done (75.683s) 75086487 read pairs processed; of these: 49 ( 0.00%) short read pairs filtered out after trimming by size control 34223 ( 0.05%) empty read pairs filtered out after trimming by size control 75052215 (99.95%) read pairs available; of these: 2888479 ( 3.85%) trimmed read pairs available after processing 72163736 (96.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 27 0.00% 20 14 0.00% 21 19 0.00% 22 29 0.00% 23 35 0.00% 24 40 0.00% 25 59 0.00% 26 72 0.00% 27 83 0.00% 28 88 0.00% 29 91 0.00% 30 93 0.00% 31 114 0.00% 32 85 0.00% 33 104 0.00% 34 109 0.00% 35 112 0.00% 36 140 0.00% 37 124 0.00% 38 123 0.00% 39 131 0.00% 40 160 0.00% 41 166 0.00% 42 122 0.00% 43 180 0.00% 44 187 0.00% 45 209 0.00% 46 248 0.00% 47 224 0.00% 48 234 0.00% 49 238 0.00% 50 271 0.00% 51 290 0.00% 52 266 0.00% 53 313 0.00% 54 321 0.00% 55 395 0.00% 56 383 0.00% 57 369 0.00% 58 392 0.00% 59 415 0.00% 60 470 0.00% 61 530 0.00% 62 579 0.00% 63 578 0.00% 64 643 0.00% 65 737 0.00% 66 771 0.00% 67 901 0.00% 68 901 0.00% 69 981 0.00% 70 1101 0.00% 71 1233 0.00% 72 1215 0.00% 73 1356 0.00% 74 1418 0.00% 75 1668 0.00% 76 1829 0.00% 77 2062 0.00% 78 2347 0.00% 79 2670 0.00% 80 3090 0.00% 81 3222 0.00% 82 3782 0.01% 83 4030 0.01% 84 4365 0.01% 85 4955 0.01% 86 5547 0.01% 87 6460 0.01% 88 7297 0.01% 89 8617 0.01% 90 9393 0.01% 91 10396 0.01% 92 11872 0.02% 93 12465 0.02% 94 14093 0.02% 95 15325 0.02% 96 17625 0.02% 97 19679 0.03% 98 21928 0.03% 99 25476 0.03% 100 28732 0.04% 101 31769 0.04% 102 34856 0.05% 103 38153 0.05% 104 41104 0.05% 105 44236 0.06% 106 48693 0.06% 107 54000 0.07% 108 60247 0.08% 109 67563 0.09% 110 74567 0.10% 111 82050 0.11% 112 89398 0.12% 113 94729 0.13% 114 101053 0.13% 115 108004 0.14% 116 113675 0.15% 117 122225 0.16% 118 131971 0.18% 119 143170 0.19% 120 155161 0.21% 121 169381 0.23% 122 179634 0.24% 123 191290 0.25% 124 201402 0.27% 125 240720 0.32% 126 72163736 96.15% 75052215 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=26 prefix-density=0.53 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=21 fanout-score=9.01 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=5.1 sequence=TTTCTCAATTTG criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=31 prefix-density=0.47 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=24.58 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.0 sequence=CCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCT SRR8424223 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 13:43:03 Started mapping on | Feb 11 13:43:06 Finished on | Feb 11 13:49:02 Mapping speed, Million of reads per hour | 758.94 Number of input reads | 75050763 Average input read length | 231 UNIQUE READS: Uniquely mapped reads number | 62652536 Uniquely mapped reads % | 83.48% Average mapped length | 228.61 Number of splices: Total | 45691063 Number of splices: Annotated (sjdb) | 44968299 Number of splices: GT/AG | 44755622 Number of splices: GC/AG | 738618 Number of splices: AT/AC | 41391 Number of splices: Non-canonical | 155432 Mismatch rate per base, % | 0.78% Deletion rate per base | 0.02% Deletion average length | 2.42 Insertion rate per base | 0.02% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2358472 % of reads mapped to multiple loci | 3.14% Number of reads mapped to too many loci | 1204727 % of reads mapped to too many loci | 1.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.33% % of reads unmapped: other | 0.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 10040061 10040061 10040061 N_multimapping 2358472 2358472 2358472 N_noFeature 1430394 60913095 2737371 N_ambiguous 1090556 23840 635976 UnstrandedReadsAssigned:60131586 PositiveStrandReadsAssigned:1715601 NegativeStrandReadsAssigned:59279189 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR8424223 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8424223-trimmed-pair1.fastq SRR8424223-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 75,050,763 reads, 67,924,647 reads pseudoaligned [quant] estimated average fragment length: 179.503 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52401 SRR8424223.ke.tsv 34699 SRR8424223.se.tsv 87100 total ==> SRR8424223.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1839.5 2708 23.7664 Potri.005G024800.1.v4.1 1035 856.497 622 11.7241 Potri.004G059700.1.v4.1 961 782.497 15 0.309473 Potri.007G009000.2.v4.1 1416 1237.5 5 0.0652289 Potri.003G141000.2.v4.1 2943 2764.5 1456.43 8.50528 Potri.016G087400.1.v4.1 270 103.722 1923.27 299.353 Potri.015G069301.1.v4.1 564 385.624 0 0 Potri.010G195200.1.v4.1 1773 1594.5 158 1.59973 Potri.012G127500.1.v4.1 977 798.497 2719 54.9731 ==> SRR8424223.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 377 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1124 Potri.001G212900.v4.1 4688 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 29 Potri.001G416900.v4.1 92 Potri.001G452600.v4.1 0 SRR8424223 completed mapping pipeline successfully