Starting /dee2/code/volunteer_pipeline.sh SRR8424224 current disk space = 3050736517120 free memory = 1517926888 SRR8424224 SRAfilesize 836b5f4bb6f066ddd951b5b00c00ebc4 SRR8424224.sra SRR8424224.sra file validated SRR8424224 is paired end SRR8424224 is conventional basespace SRR8424224 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424224_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 5.91125 2.0 2.0 2.0 2.0 32.0 2 31.69375 32.0 32.0 32.0 32.0 32.0 3 32.22875 32.0 32.0 32.0 32.0 37.0 4 35.815 37.0 37.0 37.0 32.0 37.0 5 36.23 37.0 37.0 37.0 37.0 37.0 6 39.64025 41.0 41.0 41.0 37.0 41.0 7 39.684 41.0 41.0 41.0 37.0 41.0 8 40.0435 41.0 41.0 41.0 37.0 41.0 9 39.95825 41.0 41.0 41.0 37.0 41.0 10-11 40.073875 41.0 41.0 41.0 37.0 41.0 12-13 40.10525 41.0 41.0 41.0 37.0 41.0 14-15 40.051625 41.0 41.0 41.0 37.0 41.0 16-17 40.07575 41.0 41.0 41.0 37.0 41.0 18-19 40.025999999999996 41.0 41.0 41.0 37.0 41.0 20-21 40.039375 41.0 41.0 41.0 37.0 41.0 22-23 39.987625 41.0 41.0 41.0 37.0 41.0 24-25 40.067125000000004 41.0 41.0 41.0 37.0 41.0 26-27 39.990375 41.0 41.0 41.0 37.0 41.0 28-29 39.967749999999995 41.0 41.0 41.0 37.0 41.0 30-31 40.005125 41.0 41.0 41.0 37.0 41.0 32-33 39.863 41.0 41.0 41.0 37.0 41.0 34-35 39.87425 41.0 41.0 41.0 37.0 41.0 36-37 39.947500000000005 41.0 41.0 41.0 37.0 41.0 38-39 39.818375 41.0 41.0 41.0 37.0 41.0 40-41 39.923249999999996 41.0 41.0 41.0 37.0 41.0 42-43 39.989 41.0 41.0 41.0 37.0 41.0 44-45 39.74975 41.0 41.0 41.0 37.0 41.0 46-47 39.901125 41.0 41.0 41.0 37.0 41.0 48-49 39.860625 41.0 41.0 41.0 37.0 41.0 50-51 39.760125 41.0 41.0 41.0 37.0 41.0 52-53 39.801375 41.0 41.0 41.0 37.0 41.0 54-55 39.769999999999996 41.0 41.0 41.0 37.0 41.0 56-57 39.717875 41.0 41.0 41.0 37.0 41.0 58-59 39.75275 41.0 41.0 41.0 37.0 41.0 60-61 39.615125 41.0 41.0 41.0 37.0 41.0 62-63 39.618875 41.0 41.0 41.0 37.0 41.0 64-65 39.710750000000004 41.0 41.0 41.0 37.0 41.0 66-67 39.598875 41.0 41.0 41.0 37.0 41.0 68-69 39.651125 41.0 41.0 41.0 37.0 41.0 70-71 39.612625 41.0 41.0 41.0 37.0 41.0 72-73 39.612375 41.0 41.0 41.0 37.0 41.0 74-75 39.482 41.0 41.0 41.0 37.0 41.0 76-77 38.381 41.0 39.0 41.0 34.5 41.0 78-79 38.701625 41.0 39.0 41.0 32.0 41.0 80-81 39.31075 41.0 41.0 41.0 37.0 41.0 82-83 39.42875 41.0 41.0 41.0 37.0 41.0 84-85 39.252750000000006 41.0 41.0 41.0 37.0 41.0 86-87 39.3285 41.0 41.0 41.0 37.0 41.0 88-89 39.2785 41.0 41.0 41.0 37.0 41.0 90-91 39.200500000000005 41.0 41.0 41.0 37.0 41.0 92-93 39.245000000000005 41.0 41.0 41.0 37.0 41.0 94-95 39.235125 41.0 41.0 41.0 37.0 41.0 96-97 38.78275 41.0 41.0 41.0 34.5 41.0 98-99 38.93775 41.0 41.0 41.0 34.5 41.0 100-101 39.100375 41.0 41.0 41.0 37.0 41.0 102-103 39.12825 41.0 41.0 41.0 37.0 41.0 104-105 38.530125 41.0 39.0 41.0 32.0 41.0 106-107 38.468625 41.0 39.0 41.0 32.0 41.0 108-109 38.730875 41.0 39.0 41.0 32.0 41.0 110-111 38.872249999999994 41.0 41.0 41.0 34.5 41.0 112-113 38.712999999999994 41.0 41.0 41.0 32.0 41.0 114-115 38.588499999999996 41.0 41.0 41.0 32.0 41.0 116-117 38.555499999999995 41.0 39.0 41.0 32.0 41.0 118-119 38.588625 41.0 39.0 41.0 32.0 41.0 120-121 38.067375 41.0 37.0 41.0 29.5 41.0 122-123 38.55625 41.0 41.0 41.0 32.0 41.0 124-125 38.5035 41.0 39.0 41.0 32.0 41.0 126 37.15275 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 6.0 26 5.0 27 7.0 28 11.0 29 15.0 30 23.0 31 39.0 32 52.0 33 84.0 34 98.0 35 114.0 36 154.0 37 214.0 38 328.0 39 668.0 40 2181.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.463276836158194 12.994350282485875 14.312617702448211 38.22975517890772 2 26.474999999999998 16.3 31.35 25.874999999999996 3 24.15 22.1 23.375 30.375000000000004 4 27.450000000000003 30.225 18.75 23.575 5 25.15 34.5 20.974999999999998 19.375 6 19.025 35.15 24.9 20.925 7 13.350000000000001 26.125 39.95 20.575 8 17.875 22.725 33.225 26.174999999999997 9 19.025 21.125 33.175 26.674999999999997 10-11 20.875 33.3625 23.425 22.3375 12-13 20.625 25.637500000000003 28.4 25.337500000000002 14-15 19.9375 27.625 28.000000000000004 24.4375 16-17 20.9875 27.575 27.187499999999996 24.25 18-19 20.424999999999997 27.962500000000002 27.325 24.2875 20-21 20.1375 27.700000000000003 27.800000000000004 24.3625 22-23 20.7625 28.4375 26.924999999999997 23.875 24-25 20.6125 27.200000000000003 27.3125 24.875 26-27 19.975 28.1125 27.5875 24.325 28-29 20.837500000000002 27.725 27.0125 24.425 30-31 20.0625 28.599999999999998 27.0875 24.25 32-33 19.6125 28.599999999999998 27.6625 24.125 34-35 20.4 27.950000000000003 27.125 24.525 36-37 21.2375 28.037499999999998 26.700000000000003 24.025 38-39 21.4125 28.4375 26.0375 24.1125 40-41 20.974999999999998 28.325 27.725 22.975 42-43 21.05 28.625 25.95 24.375 44-45 20.8125 29.512500000000003 25.887500000000003 23.7875 46-47 20.8125 28.499999999999996 26.85 23.8375 48-49 21.125 27.6875 27.125 24.0625 50-51 20.5375 27.8125 27.85 23.799999999999997 52-53 20.8 28.1375 27.825 23.2375 54-55 19.900000000000002 28.212500000000002 27.0875 24.8 56-57 21.05 27.9125 26.9625 24.075 58-59 20.837500000000002 27.750000000000004 27.05 24.3625 60-61 21.275 27.275 27.1 24.349999999999998 62-63 21.4375 27.237499999999997 27.187499999999996 24.1375 64-65 21.3125 28.1125 27.075 23.5 66-67 21.2 27.650000000000002 27.05 24.099999999999998 68-69 20.4875 27.975 27.175 24.3625 70-71 20.65 27.8875 27.737499999999997 23.724999999999998 72-73 21.275 27.525 27.212500000000002 23.9875 74-75 20.95 27.375 27.3375 24.337500000000002 76-77 21.512500000000003 28.8875 26.450000000000003 23.150000000000002 78-79 20.6375 28.237499999999997 27.700000000000003 23.425 80-81 21.337500000000002 27.500000000000004 26.700000000000003 24.462500000000002 82-83 21.2875 28.537499999999998 26.55 23.625 84-85 21.987499999999997 27.900000000000002 27.3125 22.8 86-87 21.025 27.5125 27.0625 24.4 88-89 21.075 27.55 27.35 24.025 90-91 21.8 26.875 27.725 23.599999999999998 92-93 20.9375 28.037499999999998 26.924999999999997 24.099999999999998 94-95 21.212500000000002 27.0625 27.6125 24.1125 96-97 21.75 27.5125 27.05 23.6875 98-99 20.9 28.462500000000002 26.9125 23.724999999999998 100-101 20.05 28.762500000000003 26.650000000000002 24.5375 102-103 21.025 28.037499999999998 26.75 24.1875 104-105 21.212500000000002 26.625 28.212500000000002 23.95 106-107 21.775 26.875 27.0625 24.2875 108-109 21.075 27.987499999999997 27.450000000000003 23.4875 110-111 21.8 27.675 26.1125 24.4125 112-113 20.8 28.875 27.0625 23.2625 114-115 20.775 27.750000000000004 27.55 23.925 116-117 21.7875 28.275 26.3625 23.575 118-119 21.115139392424055 27.853481685210653 26.92836604575572 24.103012876609576 120-121 20.9875 28.325 26.525 24.1625 122-123 22.6875 27.125 26.700000000000003 23.4875 124-125 21.5375 28.025 26.974999999999998 23.4625 126 22.400000000000002 27.025 25.924999999999997 24.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 2.0 23 1.0 24 1.5 25 4.0 26 6.0 27 7.0 28 10.0 29 13.0 30 16.0 31 28.0 32 34.0 33 35.5 34 53.0 35 71.5 36 81.5 37 96.5 38 130.5 39 166.0 40 185.5 41 215.0 42 231.5 43 227.0 44 243.0 45 267.5 46 254.5 47 228.5 48 224.0 49 212.5 50 172.5 51 146.5 52 122.5 53 97.0 54 92.5 55 72.5 56 56.5 57 45.0 58 36.0 59 31.5 60 20.5 61 13.5 62 10.5 63 5.0 64 2.5 65 2.5 66 2.0 67 2.5 68 3.0 69 2.0 70 1.5 71 1.0 72 0.0 73 1.0 74 3.5 75 3.5 76 2.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 86.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0125 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.24382794604225 96.5 2 1.7052685161618735 3.35 3 0.050903537795876815 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.7125 0.0 0.0 0.0 0.0 108-109 0.85 0.0 0.0 0.0 0.0 110-111 1.0875 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGATTA 5 0.009913621 866.4545 1 CCACGTT 5 0.009913621 866.4545 1 CTGGGGA 5 0.009913621 866.4545 1 TGTCAAT 5 0.009913621 866.4545 1 TAGGCGC 5 0.009913621 866.4545 1 GGGCCAG 5 0.009913621 866.4545 1 >>END_MODULE SRR8424224 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424224_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.09 2.0 2.0 2.0 2.0 2.0 2 31.2425 32.0 32.0 32.0 32.0 32.0 3 31.27125 32.0 32.0 32.0 32.0 32.0 4 34.685 37.0 32.0 37.0 32.0 37.0 5 35.41625 37.0 37.0 37.0 32.0 37.0 6 38.812 41.0 37.0 41.0 37.0 41.0 7 38.7955 41.0 37.0 41.0 32.0 41.0 8 39.11475 41.0 41.0 41.0 37.0 41.0 9 39.39475 41.0 41.0 41.0 37.0 41.0 10-11 39.333625 41.0 41.0 41.0 37.0 41.0 12-13 39.466125 41.0 41.0 41.0 37.0 41.0 14-15 39.267624999999995 41.0 41.0 41.0 37.0 41.0 16-17 39.331875 41.0 41.0 41.0 37.0 41.0 18-19 39.34462499999999 41.0 41.0 41.0 37.0 41.0 20-21 39.151624999999996 41.0 41.0 41.0 37.0 41.0 22-23 39.095 41.0 41.0 41.0 37.0 41.0 24-25 39.122749999999996 41.0 41.0 41.0 37.0 41.0 26-27 39.04925 41.0 41.0 41.0 37.0 41.0 28-29 39.039500000000004 41.0 41.0 41.0 37.0 41.0 30-31 39.200625 41.0 41.0 41.0 37.0 41.0 32-33 39.248999999999995 41.0 41.0 41.0 37.0 41.0 34-35 39.114000000000004 41.0 41.0 41.0 37.0 41.0 36-37 39.034125 41.0 41.0 41.0 37.0 41.0 38-39 39.1135 41.0 41.0 41.0 37.0 41.0 40-41 39.117875 41.0 41.0 41.0 37.0 41.0 42-43 39.074124999999995 41.0 41.0 41.0 37.0 41.0 44-45 39.148875000000004 41.0 41.0 41.0 37.0 41.0 46-47 39.145125 41.0 41.0 41.0 37.0 41.0 48-49 39.166 41.0 41.0 41.0 37.0 41.0 50-51 38.9765 41.0 41.0 41.0 34.5 41.0 52-53 38.999 41.0 41.0 41.0 34.5 41.0 54-55 39.0925 41.0 41.0 41.0 37.0 41.0 56-57 39.0225 41.0 41.0 41.0 34.5 41.0 58-59 39.078875 41.0 41.0 41.0 37.0 41.0 60-61 38.91825 41.0 41.0 41.0 32.0 41.0 62-63 38.866125 41.0 41.0 41.0 32.0 41.0 64-65 38.89025 41.0 41.0 41.0 32.0 41.0 66-67 38.878875 41.0 41.0 41.0 34.5 41.0 68-69 38.9415 41.0 41.0 41.0 34.5 41.0 70-71 38.998999999999995 41.0 41.0 41.0 34.5 41.0 72-73 38.538124999999994 41.0 41.0 41.0 32.0 41.0 74-75 38.628375 41.0 41.0 41.0 32.0 41.0 76-77 37.733374999999995 41.0 39.0 41.0 29.5 41.0 78-79 38.239000000000004 41.0 39.0 41.0 32.0 41.0 80-81 38.759125 41.0 41.0 41.0 32.0 41.0 82-83 38.924625 41.0 41.0 41.0 32.0 41.0 84-85 38.966750000000005 41.0 41.0 41.0 34.5 41.0 86-87 38.86125 41.0 41.0 41.0 32.0 41.0 88-89 38.733875 41.0 41.0 41.0 32.0 41.0 90-91 38.70825000000001 41.0 41.0 41.0 32.0 41.0 92-93 38.631 41.0 41.0 41.0 32.0 41.0 94-95 38.5265 41.0 41.0 41.0 32.0 41.0 96-97 37.996125 41.0 37.0 41.0 29.5 41.0 98-99 38.475750000000005 41.0 41.0 41.0 32.0 41.0 100-101 38.560874999999996 41.0 41.0 41.0 32.0 41.0 102-103 38.54275 41.0 41.0 41.0 32.0 41.0 104-105 38.531125 41.0 41.0 41.0 32.0 41.0 106-107 38.446749999999994 41.0 41.0 41.0 32.0 41.0 108-109 38.263625 41.0 39.0 41.0 32.0 41.0 110-111 38.318875 41.0 39.0 41.0 32.0 41.0 112-113 38.107625 41.0 37.0 41.0 32.0 41.0 114-115 37.947 41.0 37.0 41.0 32.0 41.0 116-117 38.008875 41.0 37.0 41.0 32.0 41.0 118-119 37.86175 41.0 37.0 41.0 29.5 41.0 120-121 37.55175 41.0 37.0 41.0 27.0 41.0 122-123 37.816375 41.0 37.0 41.0 29.5 41.0 124-125 37.961 41.0 37.0 41.0 32.0 41.0 126 36.27625 41.0 37.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 1.0 18 1.0 19 7.0 20 3.0 21 4.0 22 6.0 23 11.0 24 12.0 25 11.0 26 21.0 27 21.0 28 30.0 29 37.0 30 56.0 31 60.0 32 55.0 33 93.0 34 96.0 35 121.0 36 159.0 37 233.0 38 368.0 39 875.0 40 1717.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.76923076923077 23.076923076923077 7.6923076923076925 38.46153846153847 2 27.975 26.85 28.4 16.775000000000002 3 24.349999999999998 31.95 26.075 17.625 4 26.724999999999998 35.475 20.325 17.474999999999998 5 28.125 36.575 20.875 14.424999999999999 6 19.375 40.825 20.974999999999998 18.825 7 19.475 18.15 41.8 20.575 8 22.3 22.625 29.625 25.45 9 22.35 22.900000000000002 29.575000000000003 25.174999999999997 10-11 23.799999999999997 32.875 23.075000000000003 20.25 12-13 23.150000000000002 25.7 28.3625 22.787499999999998 14-15 22.7625 28.425 28.6125 20.200000000000003 16-17 23.962500000000002 26.174999999999997 28.249999999999996 21.6125 18-19 23.2125 27.224999999999998 27.787499999999998 21.775 20-21 25.324999999999996 27.325 25.825 21.525 22-23 23.400000000000002 28.000000000000004 27.3125 21.2875 24-25 23.474999999999998 28.449999999999996 26.900000000000002 21.175 26-27 24.025 27.8875 27.437499999999996 20.65 28-29 23.425 28.012500000000003 27.650000000000002 20.9125 30-31 23.4375 27.3375 27.5125 21.712500000000002 32-33 23.1125 28.487499999999997 27.212500000000002 21.1875 34-35 23.849999999999998 27.3875 28.425 20.3375 36-37 23.3 27.85 27.4125 21.4375 38-39 23.974999999999998 27.224999999999998 27.150000000000002 21.65 40-41 24.125 27.85 26.687499999999996 21.337500000000002 42-43 22.975 28.4375 27.150000000000002 21.4375 44-45 23.5375 27.787499999999998 27.700000000000003 20.974999999999998 46-47 23.5 27.3875 28.3625 20.75 48-49 23.5125 27.6 27.237499999999997 21.65 50-51 23.4375 26.3625 28.775000000000002 21.425 52-53 24.2875 27.125 26.6125 21.975 54-55 23.35 28.15 27.375 21.125 56-57 23.6625 27.3125 27.650000000000002 21.375 58-59 23.6375 26.937499999999996 27.9125 21.512500000000003 60-61 23.5875 26.525 28.1625 21.725 62-63 23.7875 28.262500000000003 26.450000000000003 21.5 64-65 23.5125 28.025 27.037499999999998 21.425 66-67 23.425 27.975 26.1125 22.4875 68-69 23.575 27.6 27.375 21.45 70-71 24.587500000000002 26.900000000000002 27.0625 21.45 72-73 23.05 27.275 27.200000000000003 22.475 74-75 23.45 28.3125 27.0625 21.175 76-77 23.45 26.487500000000004 28.462500000000002 21.6 78-79 23.95 26.8 27.8625 21.3875 80-81 24.175 27.0 27.712500000000002 21.1125 82-83 22.912499999999998 27.1625 28.037499999999998 21.8875 84-85 23.3875 27.474999999999998 27.650000000000002 21.4875 86-87 23.875 27.8875 26.9125 21.325 88-89 24.887500000000003 27.3 26.6125 21.2 90-91 23.474999999999998 28.025 27.0625 21.4375 92-93 23.75 27.175 27.825 21.25 94-95 23.6125 27.037499999999998 27.437499999999996 21.912499999999998 96-97 23.35 26.787499999999998 28.875 20.9875 98-99 23.625 27.8875 27.224999999999998 21.2625 100-101 23.974999999999998 26.487500000000004 27.9125 21.625 102-103 23.625 27.3125 27.5875 21.475 104-105 23.875 27.0 27.250000000000004 21.875 106-107 23.474999999999998 27.400000000000002 28.212500000000002 20.9125 108-109 23.474999999999998 26.974999999999998 27.950000000000003 21.6 110-111 24.4375 26.6125 27.537499999999998 21.4125 112-113 24.325 26.8 27.175 21.7 114-115 23.75 27.55 26.950000000000003 21.75 116-117 24.15 26.8125 27.3125 21.725 118-119 24.65 27.775 26.987499999999997 20.5875 120-121 24.1625 26.7125 27.3125 21.8125 122-123 25.162499999999998 27.3125 26.724999999999998 20.8 124-125 24.65 27.6125 26.637499999999996 21.099999999999998 126 25.724999999999998 28.000000000000004 25.424999999999997 20.849999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 1.5 24 2.5 25 4.0 26 2.5 27 2.5 28 4.0 29 6.0 30 12.5 31 19.5 32 21.5 33 33.5 34 57.5 35 69.0 36 89.0 37 118.0 38 135.5 39 173.5 40 215.0 41 232.0 42 236.5 43 254.5 44 265.5 45 252.5 46 247.5 47 242.5 48 226.5 49 187.5 50 155.0 51 137.0 52 118.0 53 96.0 54 76.5 55 71.0 56 59.5 57 45.0 58 34.5 59 21.0 60 15.5 61 14.5 62 8.0 63 4.5 64 3.0 65 3.0 66 4.0 67 3.0 68 0.5 69 0.5 70 1.0 71 1.5 72 1.0 73 0.0 74 1.5 75 4.0 76 3.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 99.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.89999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.93156281920326 95.875 2 1.9918283963227785 3.9 3 0.07660878447395301 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.07500000000000001 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114 1.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108676 spots for SRR8424224.sra Written 4108676 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra Read 4108657 spots for SRR8424224.sra Written 4108657 spots for SRR8424224.sra SRR ids: ['SRR8424224.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_txnh6ldu SRR8424224.sra spots: 82173159 blocks: [[1, 4108657], [4108658, 8217314], [8217315, 12325971], [12325972, 16434628], [16434629, 20543285], [20543286, 24651942], [24651943, 28760599], [28760600, 32869256], [32869257, 36977913], [36977914, 41086570], [41086571, 45195227], [45195228, 49303884], [49303885, 53412541], [53412542, 57521198], [57521199, 61629855], [61629856, 65738512], [65738513, 69847169], [69847170, 73955826], [73955827, 78064483], [78064484, 82173159]] SRR8424224 file size 23811725 SRR8424224 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8424224 SRR8424224_1.fastq SRR8424224_2.fastq Input file: SRR8424224_1.fastq Paired file: SRR8424224_2.fastq trimmed: SRR8424224-trimmed-pair1.fastq, SRR8424224-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:50:46 2025 >> started Tue Feb 11 12:52:12 2025 >> done (85.443s) 82173159 read pairs processed; of these: 69 ( 0.00%) short read pairs filtered out after trimming by size control 43414 ( 0.05%) empty read pairs filtered out after trimming by size control 82129676 (99.95%) read pairs available; of these: 5100334 ( 6.21%) trimmed read pairs available after processing 77029342 (93.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 22 0.00% 20 153 0.00% 21 50 0.00% 22 52 0.00% 23 61 0.00% 24 101 0.00% 25 77 0.00% 26 89 0.00% 27 136 0.00% 28 113 0.00% 29 137 0.00% 30 135 0.00% 31 144 0.00% 32 135 0.00% 33 168 0.00% 34 180 0.00% 35 177 0.00% 36 195 0.00% 37 170 0.00% 38 251 0.00% 39 277 0.00% 40 253 0.00% 41 224 0.00% 42 249 0.00% 43 262 0.00% 44 261 0.00% 45 322 0.00% 46 349 0.00% 47 375 0.00% 48 354 0.00% 49 383 0.00% 50 440 0.00% 51 426 0.00% 52 472 0.00% 53 515 0.00% 54 528 0.00% 55 653 0.00% 56 538 0.00% 57 716 0.00% 58 760 0.00% 59 729 0.00% 60 878 0.00% 61 934 0.00% 62 928 0.00% 63 1070 0.00% 64 1168 0.00% 65 1271 0.00% 66 1372 0.00% 67 1584 0.00% 68 1647 0.00% 69 1771 0.00% 70 2156 0.00% 71 2425 0.00% 72 2301 0.00% 73 2575 0.00% 74 2874 0.00% 75 3215 0.00% 76 3811 0.00% 77 4090 0.00% 78 4767 0.01% 79 5399 0.01% 80 6291 0.01% 81 6595 0.01% 82 7229 0.01% 83 8073 0.01% 84 9068 0.01% 85 10185 0.01% 86 11256 0.01% 87 12862 0.02% 88 14992 0.02% 89 17546 0.02% 90 19630 0.02% 91 21961 0.03% 92 23844 0.03% 93 25535 0.03% 94 28793 0.04% 95 32017 0.04% 96 35799 0.04% 97 40150 0.05% 98 45109 0.05% 99 51143 0.06% 100 57922 0.07% 101 64213 0.08% 102 70580 0.09% 103 75325 0.09% 104 80675 0.10% 105 87550 0.11% 106 94223 0.11% 107 103808 0.13% 108 115703 0.14% 109 128571 0.16% 110 140467 0.17% 111 152791 0.19% 112 166819 0.20% 113 174913 0.21% 114 181296 0.22% 115 191369 0.23% 116 201816 0.25% 117 212451 0.26% 118 228760 0.28% 119 246071 0.30% 120 262253 0.32% 121 283252 0.34% 122 298056 0.36% 123 314577 0.38% 124 324670 0.40% 125 356238 0.43% 126 77029342 93.79% 82129676 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.57 prefix-fanout=2.0 sequence=GTTAGGGTAAGCTTTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=18.95 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.0 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=26 prefix-density=0.53 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=23.24 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACA SRR8424224 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:52:49 Started mapping on | Feb 11 12:52:49 Finished on | Feb 11 12:59:26 Mapping speed, Million of reads per hour | 744.75 Number of input reads | 82129676 Average input read length | 250 UNIQUE READS: Uniquely mapped reads number | 76268346 Uniquely mapped reads % | 92.86% Average mapped length | 249.38 Number of splices: Total | 63524811 Number of splices: Annotated (sjdb) | 62591361 Number of splices: GT/AG | 62234291 Number of splices: GC/AG | 1062114 Number of splices: AT/AC | 47761 Number of splices: Non-canonical | 180645 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2110949 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 1792801 % of reads mapped to too many loci | 2.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.10% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3750381 3750381 3750381 N_multimapping 2110949 2110949 2110949 N_noFeature 1927258 73875079 3672226 N_ambiguous 1086659 12419 427231 UnstrandedReadsAssigned:73254429 PositiveStrandReadsAssigned:2380848 NegativeStrandReadsAssigned:72168889 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR8424224 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8424224-trimmed-pair1.fastq SRR8424224-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 82,129,676 reads, 73,728,370 reads pseudoaligned [quant] estimated average fragment length: 196.752 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52401 SRR8424224.ke.tsv 34699 SRR8424224.se.tsv 87100 total ==> SRR8424224.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1822.25 3072 21.736 Potri.005G024800.1.v4.1 1035 839.248 693 10.6465 Potri.004G059700.1.v4.1 961 765.254 103 1.73539 Potri.007G009000.2.v4.1 1416 1220.25 0 0 Potri.003G141000.2.v4.1 2943 2747.25 3232.35 15.17 Potri.016G087400.1.v4.1 270 91.5637 1871 263.461 Potri.015G069301.1.v4.1 564 368.63 0 0 Potri.010G195200.1.v4.1 1773 1577.25 185 1.5123 Potri.012G127500.1.v4.1 977 781.248 1004 16.5696 ==> SRR8424224.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1049 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1307 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 51 Potri.001G416900.v4.1 97 Potri.001G452600.v4.1 8 SRR8424224 completed mapping pipeline successfully