Starting /dee2/code/volunteer_pipeline.sh SRR8424225 current disk space = 3050803150848 free memory = 1493477676 SRR8424225 SRAfilesize 3b7ee87106b6e91377834809687cee03 SRR8424225.sra SRR8424225.sra file validated SRR8424225 is paired end SRR8424225 is conventional basespace SRR8424225 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424225_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.3075 32.0 32.0 32.0 27.0 32.0 2 31.49125 32.0 32.0 32.0 32.0 32.0 3 35.13125 37.0 32.0 37.0 32.0 37.0 4 36.01125 37.0 37.0 37.0 32.0 37.0 5 36.2525 37.0 37.0 37.0 37.0 37.0 6 39.73525 41.0 41.0 41.0 37.0 41.0 7 39.79875 41.0 41.0 41.0 37.0 41.0 8 39.98175 41.0 41.0 41.0 37.0 41.0 9 39.86525 41.0 41.0 41.0 37.0 41.0 10-11 39.95525 41.0 41.0 41.0 37.0 41.0 12-13 39.899 41.0 41.0 41.0 37.0 41.0 14-15 39.93675 41.0 41.0 41.0 37.0 41.0 16-17 39.895125 41.0 41.0 41.0 37.0 41.0 18-19 39.82725 41.0 41.0 41.0 37.0 41.0 20-21 39.804375 41.0 41.0 41.0 37.0 41.0 22-23 39.768625 41.0 41.0 41.0 37.0 41.0 24-25 39.7275 41.0 41.0 41.0 37.0 41.0 26-27 39.70675 41.0 41.0 41.0 37.0 41.0 28-29 39.702625 41.0 41.0 41.0 37.0 41.0 30-31 39.575 41.0 41.0 41.0 37.0 41.0 32-33 39.581 41.0 41.0 41.0 37.0 41.0 34-35 39.485625 41.0 41.0 41.0 37.0 41.0 36-37 39.581999999999994 41.0 41.0 41.0 37.0 41.0 38-39 39.539125 41.0 41.0 41.0 37.0 41.0 40-41 39.463375 41.0 41.0 41.0 37.0 41.0 42-43 39.352125 41.0 41.0 41.0 37.0 41.0 44-45 39.527125 41.0 41.0 41.0 37.0 41.0 46-47 39.526125 41.0 41.0 41.0 37.0 41.0 48-49 39.516999999999996 41.0 41.0 41.0 37.0 41.0 50-51 39.4715 41.0 41.0 41.0 37.0 41.0 52-53 39.252875 41.0 41.0 41.0 37.0 41.0 54-55 39.339749999999995 41.0 41.0 41.0 37.0 41.0 56-57 39.253125 41.0 41.0 41.0 37.0 41.0 58-59 39.363375000000005 41.0 41.0 41.0 37.0 41.0 60-61 39.284 41.0 41.0 41.0 37.0 41.0 62-63 39.239375 41.0 41.0 41.0 37.0 41.0 64-65 39.269125 41.0 41.0 41.0 37.0 41.0 66-67 39.245000000000005 41.0 41.0 41.0 37.0 41.0 68-69 39.156375 41.0 41.0 41.0 37.0 41.0 70-71 39.039125 41.0 41.0 41.0 32.0 41.0 72-73 39.104875 41.0 41.0 41.0 37.0 41.0 74-75 38.958375000000004 41.0 41.0 41.0 32.0 41.0 76-77 38.08375 41.0 39.0 41.0 29.5 41.0 78-79 38.329375 41.0 39.0 41.0 32.0 41.0 80-81 38.89625 41.0 41.0 41.0 32.0 41.0 82-83 38.82 41.0 41.0 41.0 32.0 41.0 84-85 38.79325 41.0 41.0 41.0 32.0 41.0 86-87 38.781125 41.0 41.0 41.0 32.0 41.0 88-89 38.667 41.0 41.0 41.0 32.0 41.0 90-91 38.480125 41.0 37.0 41.0 32.0 41.0 92-93 38.44 41.0 37.0 41.0 32.0 41.0 94-95 38.33925 41.0 37.0 41.0 32.0 41.0 96-97 38.257374999999996 41.0 37.0 41.0 32.0 41.0 98-99 38.102875 41.0 37.0 41.0 32.0 41.0 100-101 38.0745 41.0 37.0 41.0 32.0 41.0 102-103 37.979875 41.0 37.0 41.0 32.0 41.0 104-105 37.807375 41.0 37.0 41.0 32.0 41.0 106-107 37.751875 41.0 37.0 41.0 29.5 41.0 108-109 37.3375 41.0 37.0 41.0 27.0 41.0 110-111 37.275875 41.0 37.0 41.0 27.0 41.0 112-113 36.902625 41.0 37.0 41.0 27.0 41.0 114-115 36.94125 41.0 37.0 41.0 27.0 41.0 116-117 36.431124999999994 41.0 34.5 41.0 24.5 41.0 118-119 36.145375 41.0 32.0 41.0 22.0 41.0 120-121 35.935125 41.0 32.0 41.0 22.0 41.0 122-123 35.686 41.0 32.0 41.0 22.0 41.0 124-125 35.78275 41.0 32.0 41.0 22.0 41.0 126 32.683 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 6.0 24 6.0 25 11.0 26 8.0 27 24.0 28 32.0 29 46.0 30 46.0 31 67.0 32 86.0 33 94.0 34 120.0 35 137.0 36 167.0 37 240.0 38 365.0 39 512.0 40 2029.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.55971960097062 11.431652736586681 14.397411701267188 37.61121596117552 2 27.025 15.950000000000001 30.775000000000002 26.25 3 22.675 23.95 23.025000000000002 30.349999999999998 4 25.924999999999997 30.75 19.900000000000002 23.425 5 24.85 34.425 22.025 18.7 6 17.9 35.975 25.8 20.325 7 13.850000000000001 24.8 40.075 21.275 8 18.3 22.6 32.125 26.974999999999998 9 17.224999999999998 20.1 34.8 27.875 10-11 20.1125 33.975 23.974999999999998 21.9375 12-13 19.3875 27.3875 27.900000000000002 25.324999999999996 14-15 20.940117514689334 27.715964495561945 27.84098012251531 23.502937867233403 16-17 20.7875 28.6375 26.924999999999997 23.65 18-19 20.200000000000003 27.750000000000004 27.187499999999996 24.8625 20-21 20.7625 27.287499999999998 28.212500000000002 23.7375 22-23 20.175 29.099999999999998 27.0875 23.6375 24-25 20.3375 28.125 27.450000000000003 24.087500000000002 26-27 19.527440930116263 28.96612076509564 27.790973871733964 23.71546443305413 28-29 20.6375 27.962500000000002 27.825 23.575 30-31 19.725 28.999999999999996 27.450000000000003 23.825 32-33 20.3625 28.925 26.487500000000004 24.224999999999998 34-35 20.95 27.775 27.474999999999998 23.799999999999997 36-37 20.1125 27.9125 28.012500000000003 23.962500000000002 38-39 20.3 28.549999999999997 27.3375 23.8125 40-41 21.4875 28.15 26.900000000000002 23.4625 42-43 20.75 28.3875 27.875 22.9875 44-45 20.6875 28.6125 27.1 23.599999999999998 46-47 20.474999999999998 28.1125 27.275 24.1375 48-49 19.8375 27.1375 27.950000000000003 25.074999999999996 50-51 20.515064383047882 28.141017627203404 27.340917614701837 24.00300037504688 52-53 20.5875 28.249999999999996 27.55 23.6125 54-55 20.4625 28.9875 27.1375 23.4125 56-57 20.4125 28.6875 27.55 23.35 58-59 21.15 28.012500000000003 27.575 23.2625 60-61 19.85 28.3875 27.0125 24.75 62-63 20.175 28.375 28.375 23.075000000000003 64-65 21.0 28.9125 26.437500000000004 23.65 66-67 19.6875 27.962500000000002 27.975 24.375 68-69 20.75 28.275 27.212500000000002 23.7625 70-71 20.7 28.999999999999996 26.0625 24.2375 72-73 19.37742217777222 28.166020752594072 27.665958244780597 24.79059882485311 74-75 21.3 27.6 26.8 24.3 76-77 20.549999999999997 28.225 27.55 23.674999999999997 78-79 20.65 28.050000000000004 27.437499999999996 23.8625 80-81 20.6875 27.700000000000003 27.05 24.5625 82-83 21.2 28.537499999999998 27.575 22.6875 84-85 20.9 26.937499999999996 27.175 24.9875 86-87 20.45 27.375 27.425 24.75 88-89 21.212500000000002 28.487499999999997 26.974999999999998 23.325000000000003 90-91 20.6625 27.750000000000004 27.237499999999997 24.349999999999998 92-93 20.2625 27.8875 27.625 24.224999999999998 94-95 20.2625 28.4 27.487499999999997 23.849999999999998 96-97 20.549999999999997 27.1375 27.55 24.762500000000003 98-99 21.175 27.3125 27.6375 23.875 100-101 20.3375 28.262500000000003 27.800000000000004 23.599999999999998 102-103 20.775 28.275 26.8625 24.087500000000002 104-105 20.95 27.275 26.887499999999996 24.887500000000003 106-107 20.1875 28.3125 27.125 24.375 108-109 21.6875 28.3125 27.250000000000004 22.75 110-111 21.55 27.975 27.187499999999996 23.2875 112-113 21.0625 28.000000000000004 26.875 24.0625 114-115 21.45 27.712500000000002 27.250000000000004 23.5875 116-117 21.6125 27.725 27.1375 23.525 118-119 20.6125 27.5625 27.3125 24.5125 120-121 21.4125 28.012500000000003 27.35 23.225 122-123 21.337500000000002 27.0625 27.075 24.525 124-125 21.1875 28.3125 26.474999999999998 24.025 126 20.75 28.15 26.275 24.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 2.0 22 2.5 23 2.0 24 1.5 25 3.0 26 7.0 27 8.5 28 12.5 29 15.0 30 16.5 31 22.5 32 30.5 33 44.5 34 56.0 35 66.5 36 84.0 37 104.5 38 118.5 39 160.0 40 191.0 41 195.0 42 223.5 43 230.0 44 238.0 45 273.0 46 260.5 47 228.0 48 218.0 49 210.5 50 187.5 51 152.5 52 123.5 53 92.5 54 77.0 55 62.5 56 55.5 57 56.0 58 37.5 59 22.0 60 21.5 61 18.5 62 11.5 63 11.0 64 8.0 65 4.0 66 3.5 67 3.0 68 1.5 69 3.0 70 3.0 71 1.0 72 2.5 73 3.0 74 1.5 75 2.5 76 4.0 77 2.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.2749999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0125 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0125 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.975 #Duplication Level Percentage of deduplicated Percentage of total 1 93.11642914762032 86.575 2 6.238236084969078 11.600000000000001 3 0.6184458187684861 1.725 4 0.026888948642108095 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.825 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCAGCA 15 1.8696113E-4 127.93333 1 GGAACAT 15 0.0039596157 59.968746 50-51 >>END_MODULE SRR8424225 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424225_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.5825 32.0 32.0 32.0 12.0 32.0 2 31.16 32.0 32.0 32.0 32.0 32.0 3 33.84125 37.0 32.0 37.0 32.0 37.0 4 35.06 37.0 37.0 37.0 32.0 37.0 5 35.435 37.0 37.0 37.0 32.0 37.0 6 38.688 41.0 37.0 41.0 32.0 41.0 7 38.84775 41.0 41.0 41.0 37.0 41.0 8 39.08075 41.0 41.0 41.0 37.0 41.0 9 39.30325 41.0 41.0 41.0 37.0 41.0 10-11 39.240875 41.0 41.0 41.0 37.0 41.0 12-13 39.31 41.0 41.0 41.0 37.0 41.0 14-15 39.21875 41.0 41.0 41.0 37.0 41.0 16-17 39.238875 41.0 41.0 41.0 37.0 41.0 18-19 38.821625 41.0 41.0 41.0 34.5 41.0 20-21 39.179249999999996 41.0 41.0 41.0 37.0 41.0 22-23 39.239000000000004 41.0 41.0 41.0 37.0 41.0 24-25 39.073 41.0 41.0 41.0 37.0 41.0 26-27 39.115750000000006 41.0 41.0 41.0 37.0 41.0 28-29 38.903499999999994 41.0 41.0 41.0 34.5 41.0 30-31 38.9995 41.0 41.0 41.0 37.0 41.0 32-33 39.055625 41.0 41.0 41.0 37.0 41.0 34-35 39.023875000000004 41.0 41.0 41.0 34.5 41.0 36-37 38.936499999999995 41.0 41.0 41.0 34.5 41.0 38-39 38.774375 41.0 41.0 41.0 32.0 41.0 40-41 38.899 41.0 41.0 41.0 32.0 41.0 42-43 38.813 41.0 41.0 41.0 32.0 41.0 44-45 38.757875 41.0 41.0 41.0 32.0 41.0 46-47 38.54975 41.0 41.0 41.0 32.0 41.0 48-49 38.272125 41.0 41.0 41.0 32.0 41.0 50-51 38.35475 41.0 39.0 41.0 32.0 41.0 52-53 38.3085 41.0 37.0 41.0 32.0 41.0 54-55 38.193625 41.0 37.0 41.0 32.0 41.0 56-57 38.161 41.0 37.0 41.0 32.0 41.0 58-59 38.079625 41.0 37.0 41.0 32.0 41.0 60-61 38.064 41.0 37.0 41.0 32.0 41.0 62-63 37.838625 41.0 37.0 41.0 27.0 41.0 64-65 37.622749999999996 41.0 37.0 41.0 27.0 41.0 66-67 37.287625000000006 41.0 37.0 41.0 27.0 41.0 68-69 37.36275 41.0 37.0 41.0 27.0 41.0 70-71 37.162125 41.0 37.0 41.0 27.0 41.0 72-73 37.038375 41.0 37.0 41.0 27.0 41.0 74-75 37.039125 41.0 37.0 41.0 27.0 41.0 76-77 35.302 39.0 34.5 41.0 24.5 41.0 78-79 35.78425 39.0 34.5 41.0 22.0 41.0 80-81 36.29025 41.0 37.0 41.0 22.0 41.0 82-83 36.566 41.0 37.0 41.0 24.5 41.0 84-85 36.495875 41.0 37.0 41.0 24.5 41.0 86-87 36.261875 41.0 37.0 41.0 22.0 41.0 88-89 35.984125 41.0 34.5 41.0 22.0 41.0 90-91 35.775125 41.0 32.0 41.0 22.0 41.0 92-93 35.7615 41.0 32.0 41.0 22.0 41.0 94-95 35.200625 41.0 32.0 41.0 22.0 41.0 96-97 35.02375 41.0 32.0 41.0 22.0 41.0 98-99 34.5095 41.0 32.0 41.0 17.0 41.0 100-101 34.411625 41.0 32.0 41.0 17.0 41.0 102-103 34.667125 41.0 32.0 41.0 17.0 41.0 104-105 34.28475 41.0 32.0 41.0 12.0 41.0 106-107 33.611875 37.0 27.0 41.0 12.0 41.0 108-109 33.325125 37.0 27.0 41.0 12.0 41.0 110-111 33.427499999999995 37.0 27.0 41.0 12.0 41.0 112-113 33.32575 37.0 27.0 41.0 12.0 41.0 114-115 33.042500000000004 37.0 27.0 41.0 12.0 41.0 116-117 32.76649999999999 37.0 27.0 41.0 12.0 41.0 118-119 32.672875 37.0 27.0 41.0 12.0 41.0 120-121 32.67775 37.0 27.0 41.0 12.0 41.0 122-123 32.50475 37.0 27.0 41.0 12.0 41.0 124-125 32.194125 37.0 27.0 41.0 12.0 41.0 126 28.47375 32.0 22.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 3.0 17 3.0 18 6.0 19 6.0 20 9.0 21 15.0 22 15.0 23 28.0 24 28.0 25 48.0 26 56.0 27 47.0 28 67.0 29 93.0 30 96.0 31 135.0 32 146.0 33 155.0 34 226.0 35 220.0 36 207.0 37 244.0 38 296.0 39 509.0 40 1340.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.9813647574678 19.59440942724034 17.37462318443409 31.04960263085777 2 28.525 26.3 28.95 16.225 3 24.25 31.724999999999998 27.250000000000004 16.775000000000002 4 27.675 34.925 21.0 16.400000000000002 5 27.3 36.425000000000004 20.875 15.4 6 20.3 39.45 22.375 17.875 7 20.599999999999998 18.45 40.825 20.125 8 23.724999999999998 22.7 28.775000000000002 24.8 9 23.974999999999998 22.775000000000002 30.7 22.55 10-11 24.8125 32.5625 23.4625 19.162499999999998 12-13 23.425 25.5125 29.062500000000004 22.0 14-15 23.0125 26.4625 29.762499999999996 20.7625 16-17 23.777972246530815 26.653331666458307 27.753469183647955 21.81522690336292 18-19 24.3125 26.150000000000002 27.8875 21.65 20-21 23.5625 27.6125 27.8375 20.9875 22-23 24.0125 27.762500000000003 26.9125 21.3125 24-25 23.799999999999997 28.537499999999998 27.400000000000002 20.2625 26-27 24.125 27.725 27.8125 20.3375 28-29 23.9875 27.5125 27.775 20.724999999999998 30-31 23.5125 28.675 27.575 20.2375 32-33 24.4375 28.3625 27.700000000000003 19.5 34-35 24.2 27.55 27.712500000000002 20.5375 36-37 23.8375 27.650000000000002 27.437499999999996 21.075 38-39 23.3625 28.812500000000004 26.9125 20.9125 40-41 24.212500000000002 26.8625 28.299999999999997 20.625 42-43 23.8375 27.3 27.450000000000003 21.4125 44-45 23.125 28.237499999999997 27.9125 20.724999999999998 46-47 23.724999999999998 28.275 27.750000000000004 20.25 48-49 23.1125 27.8125 27.762500000000003 21.3125 50-51 24.3625 27.762500000000003 27.187499999999996 20.6875 52-53 24.212500000000002 27.325 27.775 20.6875 54-55 23.95 26.5875 28.3875 21.075 56-57 24.712500000000002 27.0875 27.8375 20.3625 58-59 23.6875 26.387500000000003 28.1375 21.7875 60-61 24.3875 27.474999999999998 27.6 20.5375 62-63 23.0875 27.900000000000002 27.8375 21.175 64-65 24.3875 26.5625 28.175 20.875 66-67 24.65 27.275 27.975 20.1 68-69 23.4125 27.9375 27.437499999999996 21.212500000000002 70-71 24.2375 27.05 27.175 21.5375 72-73 23.7 27.987499999999997 27.675 20.6375 74-75 23.65 28.025 27.500000000000004 20.825 76-77 24.1125 27.750000000000004 27.1375 21.0 78-79 23.1375 27.800000000000004 28.225 20.837500000000002 80-81 24.4875 27.6125 26.937499999999996 20.962500000000002 82-83 24.7375 26.700000000000003 27.224999999999998 21.337500000000002 84-85 23.8875 27.2625 27.900000000000002 20.95 86-87 23.625 27.187499999999996 28.475 20.7125 88-89 24.325 27.5625 27.3625 20.75 90-91 24.5 28.349999999999998 26.150000000000002 21.0 92-93 23.925 27.55 27.224999999999998 21.3 94-95 23.9375 27.224999999999998 28.000000000000004 20.837500000000002 96-97 23.962500000000002 27.275 27.750000000000004 21.0125 98-99 23.2625 27.250000000000004 28.499999999999996 20.9875 100-101 23.7125 28.000000000000004 27.800000000000004 20.4875 102-103 23.575 27.625 28.299999999999997 20.5 104-105 24.625 26.674999999999997 27.6125 21.087500000000002 106-107 24.4875 25.55 27.875 22.0875 108-109 23.2875 27.700000000000003 27.9125 21.099999999999998 110-111 24.375 27.1125 26.8625 21.65 112-113 25.087500000000002 27.3875 26.887499999999996 20.6375 114-115 23.275000000000002 27.55 27.55 21.625 116-117 24.8125 27.1125 26.9625 21.1125 118-119 24.75 28.1 27.325 19.825 120-121 23.75 26.900000000000002 27.700000000000003 21.65 122-123 24.975 27.500000000000004 27.625 19.900000000000002 124-125 24.212500000000002 27.525 27.200000000000003 21.0625 126 24.175 27.200000000000003 27.400000000000002 21.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 4.0 26 5.0 27 4.5 28 7.0 29 10.5 30 13.0 31 20.5 32 26.0 33 33.0 34 52.0 35 62.0 36 82.0 37 110.0 38 132.5 39 155.5 40 174.5 41 209.5 42 235.0 43 260.0 44 283.5 45 269.0 46 244.5 47 233.5 48 217.0 49 179.0 50 166.0 51 149.0 52 123.5 53 106.5 54 79.5 55 71.0 56 71.5 57 56.5 58 32.0 59 22.5 60 18.5 61 13.5 62 10.0 63 8.0 64 6.0 65 5.0 66 4.5 67 2.0 68 3.5 69 4.0 70 2.0 71 1.0 72 2.0 73 2.5 74 1.5 75 1.5 76 1.5 77 2.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.774999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0125 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.13962873284906 86.55000000000001 2 6.160882432068872 11.450000000000001 3 0.645682001614205 1.7999999999999998 4 0.053806833467850416 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.2 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114 1.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGGGG 10 0.009907239 127.93334 1 >>END_MODULE Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048426 spots for SRR8424225.sra Written 3048426 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra Read 3048424 spots for SRR8424225.sra Written 3048424 spots for SRR8424225.sra SRR ids: ['SRR8424225.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nlphe8vb SRR8424225.sra spots: 60968482 blocks: [[1, 3048424], [3048425, 6096848], [6096849, 9145272], [9145273, 12193696], [12193697, 15242120], [15242121, 18290544], [18290545, 21338968], [21338969, 24387392], [24387393, 27435816], [27435817, 30484240], [30484241, 33532664], [33532665, 36581088], [36581089, 39629512], [39629513, 42677936], [42677937, 45726360], [45726361, 48774784], [48774785, 51823208], [51823209, 54871632], [54871633, 57920056], [57920057, 60968482]] SRR8424225 file size 17661540 SRR8424225 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8424225 SRR8424225_1.fastq SRR8424225_2.fastq Input file: SRR8424225_1.fastq Paired file: SRR8424225_2.fastq trimmed: SRR8424225-trimmed-pair1.fastq, SRR8424225-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:39:44 2025 >> started Tue Feb 11 12:40:42 2025 >> done (57.390s) 60968482 read pairs processed; of these: 58 ( 0.00%) short read pairs filtered out after trimming by size control 54806 ( 0.09%) empty read pairs filtered out after trimming by size control 60913618 (99.91%) read pairs available; of these: 3957848 ( 6.50%) trimmed read pairs available after processing 56955770 (93.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 21 0.00% 20 15 0.00% 21 18 0.00% 22 18 0.00% 23 34 0.00% 24 40 0.00% 25 42 0.00% 26 58 0.00% 27 56 0.00% 28 51 0.00% 29 63 0.00% 30 56 0.00% 31 61 0.00% 32 86 0.00% 33 85 0.00% 34 81 0.00% 35 77 0.00% 36 94 0.00% 37 87 0.00% 38 107 0.00% 39 97 0.00% 40 117 0.00% 41 105 0.00% 42 124 0.00% 43 139 0.00% 44 141 0.00% 45 145 0.00% 46 180 0.00% 47 170 0.00% 48 151 0.00% 49 223 0.00% 50 223 0.00% 51 180 0.00% 52 176 0.00% 53 233 0.00% 54 199 0.00% 55 266 0.00% 56 270 0.00% 57 251 0.00% 58 336 0.00% 59 305 0.00% 60 374 0.00% 61 346 0.00% 62 420 0.00% 63 423 0.00% 64 430 0.00% 65 512 0.00% 66 557 0.00% 67 593 0.00% 68 605 0.00% 69 692 0.00% 70 755 0.00% 71 890 0.00% 72 832 0.00% 73 904 0.00% 74 1041 0.00% 75 1112 0.00% 76 1239 0.00% 77 1378 0.00% 78 1609 0.00% 79 1885 0.00% 80 2062 0.00% 81 2245 0.00% 82 2458 0.00% 83 2580 0.00% 84 2981 0.00% 85 3233 0.01% 86 3691 0.01% 87 4371 0.01% 88 4939 0.01% 89 5773 0.01% 90 6390 0.01% 91 7121 0.01% 92 7565 0.01% 93 8244 0.01% 94 9361 0.02% 95 10274 0.02% 96 11748 0.02% 97 15694 0.03% 98 12113 0.02% 99 16500 0.03% 100 18998 0.03% 101 21117 0.03% 102 23024 0.04% 103 24877 0.04% 104 27315 0.04% 105 29044 0.05% 106 31986 0.05% 107 35641 0.06% 108 39280 0.06% 109 44440 0.07% 110 49422 0.08% 111 54594 0.09% 112 58848 0.10% 113 62489 0.10% 114 66028 0.11% 115 70410 0.12% 116 75497 0.12% 117 79930 0.13% 118 87288 0.14% 119 94416 0.15% 120 102244 0.17% 121 111381 0.18% 122 125580 0.21% 123 156197 0.26% 124 288028 0.47% 125 2018642 3.31% 126 56955770 93.50% 60913618 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=30 prefix-density=0.34 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=129.82 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.8 sequence=AAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=28 prefix-density=0.31 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=63.62 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=11.4 sequence=TCTTCTCTCTGTCTTCTTGATTCCTTGTTTTTCGTTCTGTTTATTACAGCAGCAATACCATAATCATGTCTCAGACTGTTGTCCTCAAGGTTGGTATGTCATGCGAAGGCTGTGTTGGGGCTGTGAAAAGGGTTTTGGGAAAAATGGAAGGTGTGGAATCATATGACATTGATTTGAAGGAGCAAAAAGTCACAGTGAAAGGAAATGTGCAGCCAGATGCTGTTCTTCAGACCGTCTCTAAGACCGGGAAGAAGACTGCCTTCTGGGAAGCAGAGGCACCAGCTGAACCCGCAA SRR8424225 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:41:23 Started mapping on | Feb 11 12:41:24 Finished on | Feb 11 12:46:32 Mapping speed, Million of reads per hour | 711.98 Number of input reads | 60913618 Average input read length | 251 UNIQUE READS: Uniquely mapped reads number | 54853479 Uniquely mapped reads % | 90.05% Average mapped length | 249.68 Number of splices: Total | 44997196 Number of splices: Annotated (sjdb) | 44269529 Number of splices: GT/AG | 44140216 Number of splices: GC/AG | 679756 Number of splices: AT/AC | 34296 Number of splices: Non-canonical | 142928 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1872153 % of reads mapped to multiple loci | 3.07% Number of reads mapped to too many loci | 2165016 % of reads mapped to too many loci | 3.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.54% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4187986 4187986 4187986 N_multimapping 1872153 1872153 1872153 N_noFeature 1463468 53193612 2660629 N_ambiguous 776900 8199 306867 UnstrandedReadsAssigned:52613111 PositiveStrandReadsAssigned:1651668 NegativeStrandReadsAssigned:51885983 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR8424225 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8424225-trimmed-pair1.fastq SRR8424225-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 60,913,618 reads, 54,229,362 reads pseudoaligned [quant] estimated average fragment length: 198.007 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,272 rounds 52401 SRR8424225.ke.tsv 34699 SRR8424225.se.tsv 87100 total ==> SRR8424225.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1820.99 2855 26.9212 Potri.005G024800.1.v4.1 1035 837.993 1000 20.4906 Potri.004G059700.1.v4.1 961 763.998 55 1.23614 Potri.007G009000.2.v4.1 1416 1218.99 0 0 Potri.003G141000.2.v4.1 2943 2745.99 1860.22 11.6322 Potri.016G087400.1.v4.1 270 88.4127 1747.64 339.416 Potri.015G069301.1.v4.1 564 367.198 0 0 Potri.010G195200.1.v4.1 1773 1575.99 323 3.5192 Potri.012G127500.1.v4.1 977 779.993 1395 30.71 ==> SRR8424225.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1569 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1073 Potri.001G212900.v4.1 1558 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 99 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR8424225 completed mapping pipeline successfully