Starting /dee2/code/volunteer_pipeline.sh SRR8424226 current disk space = 3051311296512 free memory = 1433915304 SRR8424226 SRAfilesize 33d33c7f2c5add8a9f861631d6c7c113 SRR8424226.sra SRR8424226.sra file validated SRR8424226 is paired end SRR8424226 is conventional basespace SRR8424226 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424226_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.0 2.0 2.0 2.0 2.0 2.0 2 31.68875 32.0 32.0 32.0 32.0 32.0 3 31.7525 32.0 32.0 32.0 32.0 32.0 4 35.88625 37.0 37.0 37.0 32.0 37.0 5 36.38375 37.0 37.0 37.0 37.0 37.0 6 39.6845 41.0 41.0 41.0 37.0 41.0 7 39.7855 41.0 41.0 41.0 37.0 41.0 8 40.04 41.0 41.0 41.0 37.0 41.0 9 40.008 41.0 41.0 41.0 37.0 41.0 10-11 40.20625 41.0 41.0 41.0 37.0 41.0 12-13 40.1635 41.0 41.0 41.0 37.0 41.0 14-15 40.103375 41.0 41.0 41.0 37.0 41.0 16-17 40.110125 41.0 41.0 41.0 37.0 41.0 18-19 40.144875 41.0 41.0 41.0 37.0 41.0 20-21 40.143 41.0 41.0 41.0 37.0 41.0 22-23 40.070125000000004 41.0 41.0 41.0 37.0 41.0 24-25 40.143 41.0 41.0 41.0 37.0 41.0 26-27 39.988 41.0 41.0 41.0 37.0 41.0 28-29 39.954499999999996 41.0 41.0 41.0 37.0 41.0 30-31 39.9965 41.0 41.0 41.0 37.0 41.0 32-33 40.010125 41.0 41.0 41.0 37.0 41.0 34-35 39.928625 41.0 41.0 41.0 37.0 41.0 36-37 39.955125 41.0 41.0 41.0 37.0 41.0 38-39 39.873 41.0 41.0 41.0 37.0 41.0 40-41 39.927625 41.0 41.0 41.0 37.0 41.0 42-43 40.0235 41.0 41.0 41.0 37.0 41.0 44-45 39.889125 41.0 41.0 41.0 37.0 41.0 46-47 39.970124999999996 41.0 41.0 41.0 37.0 41.0 48-49 39.852625 41.0 41.0 41.0 37.0 41.0 50-51 39.82075 41.0 41.0 41.0 37.0 41.0 52-53 39.852000000000004 41.0 41.0 41.0 37.0 41.0 54-55 39.84162499999999 41.0 41.0 41.0 37.0 41.0 56-57 39.831375 41.0 41.0 41.0 37.0 41.0 58-59 39.8615 41.0 41.0 41.0 37.0 41.0 60-61 39.851749999999996 41.0 41.0 41.0 37.0 41.0 62-63 39.846125 41.0 41.0 41.0 37.0 41.0 64-65 39.863749999999996 41.0 41.0 41.0 37.0 41.0 66-67 39.769000000000005 41.0 41.0 41.0 37.0 41.0 68-69 39.691625 41.0 41.0 41.0 37.0 41.0 70-71 39.696625 41.0 41.0 41.0 37.0 41.0 72-73 39.787375 41.0 41.0 41.0 37.0 41.0 74-75 39.677375 41.0 41.0 41.0 37.0 41.0 76-77 39.03775 41.0 39.0 41.0 34.5 41.0 78-79 39.330124999999995 41.0 41.0 41.0 37.0 41.0 80-81 39.588375 41.0 41.0 41.0 37.0 41.0 82-83 39.639375 41.0 41.0 41.0 37.0 41.0 84-85 39.527375 41.0 41.0 41.0 37.0 41.0 86-87 39.60275 41.0 41.0 41.0 37.0 41.0 88-89 39.6335 41.0 41.0 41.0 37.0 41.0 90-91 39.550749999999994 41.0 41.0 41.0 37.0 41.0 92-93 39.548 41.0 41.0 41.0 37.0 41.0 94-95 39.596374999999995 41.0 41.0 41.0 37.0 41.0 96-97 39.18775 41.0 41.0 41.0 34.5 41.0 98-99 39.304625 41.0 41.0 41.0 37.0 41.0 100-101 39.406625000000005 41.0 41.0 41.0 37.0 41.0 102-103 39.477125 41.0 41.0 41.0 37.0 41.0 104-105 39.122625 41.0 41.0 41.0 34.5 41.0 106-107 39.138999999999996 41.0 41.0 41.0 37.0 41.0 108-109 39.307125 41.0 41.0 41.0 37.0 41.0 110-111 39.308499999999995 41.0 41.0 41.0 37.0 41.0 112-113 39.338875 41.0 41.0 41.0 37.0 41.0 114-115 39.21625 41.0 41.0 41.0 34.5 41.0 116-117 39.211 41.0 41.0 41.0 37.0 41.0 118-119 39.1605 41.0 41.0 41.0 34.5 41.0 120-121 38.907375 41.0 41.0 41.0 34.5 41.0 122-123 39.131625 41.0 41.0 41.0 37.0 41.0 124-125 39.123000000000005 41.0 41.0 41.0 37.0 41.0 126 37.99925 41.0 37.0 41.0 32.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 1.0 25 0.0 26 3.0 27 8.0 28 6.0 29 14.0 30 18.0 31 30.0 32 46.0 33 56.0 34 67.0 35 105.0 36 145.0 37 198.0 38 300.0 39 641.0 40 2360.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 NaN NaN NaN NaN 2 26.150000000000002 15.65 32.4 25.8 3 23.45 22.925 23.775 29.849999999999998 4 25.624999999999996 31.6 20.1 22.675 5 25.424999999999997 33.050000000000004 22.425 19.1 6 18.625 35.725 23.775 21.875 7 13.625000000000002 26.224999999999998 40.075 20.075000000000003 8 19.25 23.025000000000002 30.925000000000004 26.8 9 18.224999999999998 21.2 33.875 26.700000000000003 10-11 19.5625 33.1125 24.95 22.375 12-13 19.2 26.8375 29.175 24.7875 14-15 20.125 27.700000000000003 27.8375 24.337500000000002 16-17 20.625 28.012500000000003 27.525 23.8375 18-19 20.65 27.4125 27.537499999999998 24.4 20-21 20.875 28.0625 27.0125 24.05 22-23 20.5875 29.1375 27.1125 23.1625 24-25 20.549999999999997 28.4 28.0875 22.9625 26-27 20.0625 27.3625 27.925 24.65 28-29 20.849999999999998 29.275000000000002 26.325 23.549999999999997 30-31 19.3625 29.049999999999997 27.3125 24.275 32-33 21.05 26.7625 28.037499999999998 24.15 34-35 21.1125 28.549999999999997 27.1 23.2375 36-37 19.889986248281037 28.441055131891485 27.19089886235779 24.478059757469683 38-39 20.0875 27.675 27.537499999999998 24.7 40-41 19.8875 29.15 27.0125 23.95 42-43 19.9375 27.9125 28.475 23.674999999999997 44-45 20.8625 28.3875 26.987499999999997 23.7625 46-47 21.099999999999998 27.6375 27.800000000000004 23.4625 48-49 21.0625 26.9125 26.987499999999997 25.0375 50-51 20.474999999999998 28.275 26.6625 24.587500000000002 52-53 21.325 27.875 26.8625 23.9375 54-55 21.3875 27.6875 26.575 24.349999999999998 56-57 19.950000000000003 28.512500000000003 26.85 24.6875 58-59 21.175 27.8125 26.887499999999996 24.125 60-61 20.175 28.125 27.450000000000003 24.25 62-63 20.849999999999998 28.175 26.887499999999996 24.087500000000002 64-65 21.6625 27.474999999999998 26.887499999999996 23.974999999999998 66-67 20.1 27.8375 28.037499999999998 24.025 68-69 20.549999999999997 27.8625 27.224999999999998 24.3625 70-71 21.075 28.6375 26.950000000000003 23.3375 72-73 20.825 27.462500000000002 27.487499999999997 24.224999999999998 74-75 19.900000000000002 26.900000000000002 27.575 25.624999999999996 76-77 20.9375 27.9375 27.6 23.525 78-79 20.424999999999997 28.125 27.125 24.325 80-81 21.3125 27.437499999999996 27.0875 24.1625 82-83 21.2375 28.025 27.200000000000003 23.5375 84-85 20.7375 27.8625 26.337500000000002 25.0625 86-87 20.8125 27.487499999999997 26.937499999999996 24.762500000000003 88-89 20.6375 27.6 27.450000000000003 24.3125 90-91 21.337500000000002 28.625 27.224999999999998 22.8125 92-93 21.175 27.525 26.924999999999997 24.375 94-95 20.9375 28.199999999999996 27.275 23.5875 96-97 21.55 27.325 26.4125 24.712500000000002 98-99 20.5375 28.5625 26.687499999999996 24.212500000000002 100-101 20.974999999999998 27.737499999999997 27.1125 24.175 102-103 20.875 27.700000000000003 26.724999999999998 24.7 104-105 21.0375 26.8625 27.8375 24.2625 106-107 21.2375 28.000000000000004 27.575 23.1875 108-109 21.2625 28.1875 26.9625 23.5875 110-111 20.5625 27.6 27.025 24.8125 112-113 21.325 27.0875 26.887499999999996 24.7 114-115 21.075 27.85 26.325 24.75 116-117 22.14026753344168 27.303412926615827 27.028378547318415 23.527940992624078 118-119 20.96512064008001 27.790973871733964 27.29091136392049 23.952994124265533 120-121 21.212500000000002 26.974999999999998 27.3 24.5125 122-123 21.5375 27.8875 26.437500000000004 24.1375 124-125 21.375 27.625 26.9125 24.087500000000002 126 20.7 27.125 27.725 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 1.0 25 1.5 26 5.0 27 11.0 28 14.5 29 13.5 30 17.0 31 21.5 32 34.0 33 52.0 34 67.5 35 80.5 36 83.5 37 114.5 38 145.5 39 160.5 40 188.5 41 217.0 42 241.0 43 249.5 44 246.0 45 242.5 46 247.0 47 239.0 48 208.0 49 189.0 50 163.5 51 138.5 52 120.5 53 98.5 54 78.5 55 59.5 56 48.5 57 32.5 58 33.5 59 35.5 60 26.5 61 17.5 62 9.5 63 9.5 64 5.5 65 1.5 66 3.0 67 4.5 68 4.0 69 2.5 70 2.0 71 1.0 72 1.5 73 2.0 74 1.0 75 2.5 76 2.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 100.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0125 118-119 0.0125 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.98417963766268 96.0 2 1.964786935442715 3.85 3 0.05103342689461597 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.7749999999999999 0.0 0.0 0.0 0.0 114 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8424226 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424226_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.0 2.0 2.0 2.0 2.0 2.0 2 31.28875 32.0 32.0 32.0 32.0 32.0 3 31.08625 32.0 32.0 32.0 32.0 32.0 4 34.83125 37.0 32.0 37.0 32.0 37.0 5 35.1375 37.0 37.0 37.0 32.0 37.0 6 38.747 41.0 37.0 41.0 37.0 41.0 7 38.35625 41.0 37.0 41.0 32.0 41.0 8 38.845 41.0 37.0 41.0 37.0 41.0 9 39.08575 41.0 41.0 41.0 37.0 41.0 10-11 39.203875 41.0 41.0 41.0 37.0 41.0 12-13 39.50575 41.0 41.0 41.0 37.0 41.0 14-15 39.236625000000004 41.0 41.0 41.0 37.0 41.0 16-17 39.284125 41.0 41.0 41.0 37.0 41.0 18-19 39.41375 41.0 41.0 41.0 37.0 41.0 20-21 39.393249999999995 41.0 41.0 41.0 37.0 41.0 22-23 39.2415 41.0 41.0 41.0 37.0 41.0 24-25 39.129125 41.0 41.0 41.0 37.0 41.0 26-27 39.32 41.0 41.0 41.0 37.0 41.0 28-29 39.198499999999996 41.0 41.0 41.0 37.0 41.0 30-31 39.195750000000004 41.0 41.0 41.0 37.0 41.0 32-33 39.274 41.0 41.0 41.0 37.0 41.0 34-35 39.304500000000004 41.0 41.0 41.0 37.0 41.0 36-37 38.810125 41.0 41.0 41.0 34.5 41.0 38-39 38.812124999999995 41.0 41.0 41.0 32.0 41.0 40-41 38.892624999999995 41.0 41.0 41.0 34.5 41.0 42-43 38.988375000000005 41.0 41.0 41.0 37.0 41.0 44-45 38.893125 41.0 41.0 41.0 32.0 41.0 46-47 38.90625 41.0 41.0 41.0 34.5 41.0 48-49 38.85825 41.0 41.0 41.0 32.0 41.0 50-51 38.6755 41.0 41.0 41.0 32.0 41.0 52-53 38.815625 41.0 41.0 41.0 34.5 41.0 54-55 38.764875 41.0 41.0 41.0 32.0 41.0 56-57 38.87475 41.0 41.0 41.0 32.0 41.0 58-59 38.849000000000004 41.0 41.0 41.0 32.0 41.0 60-61 38.8395 41.0 41.0 41.0 32.0 41.0 62-63 38.8535 41.0 41.0 41.0 34.5 41.0 64-65 38.680499999999995 41.0 41.0 41.0 32.0 41.0 66-67 38.763625000000005 41.0 41.0 41.0 32.0 41.0 68-69 38.819874999999996 41.0 41.0 41.0 32.0 41.0 70-71 38.843875 41.0 41.0 41.0 32.0 41.0 72-73 38.533249999999995 41.0 39.0 41.0 32.0 41.0 74-75 38.696 41.0 41.0 41.0 32.0 41.0 76-77 37.408874999999995 39.0 37.0 41.0 29.5 41.0 78-79 38.051125 41.0 37.0 41.0 32.0 41.0 80-81 38.711875 41.0 41.0 41.0 32.0 41.0 82-83 38.820875 41.0 41.0 41.0 32.0 41.0 84-85 38.780249999999995 41.0 41.0 41.0 32.0 41.0 86-87 38.810625 41.0 41.0 41.0 32.0 41.0 88-89 38.559625 41.0 41.0 41.0 32.0 41.0 90-91 38.646625 41.0 41.0 41.0 32.0 41.0 92-93 38.460750000000004 41.0 39.0 41.0 32.0 41.0 94-95 38.38475 41.0 41.0 41.0 32.0 41.0 96-97 38.109375 41.0 37.0 41.0 32.0 41.0 98-99 38.4425 41.0 41.0 41.0 32.0 41.0 100-101 38.530625 41.0 41.0 41.0 32.0 41.0 102-103 38.639375 41.0 41.0 41.0 32.0 41.0 104-105 38.529250000000005 41.0 41.0 41.0 32.0 41.0 106-107 38.473375000000004 41.0 41.0 41.0 32.0 41.0 108-109 38.339 41.0 39.0 41.0 32.0 41.0 110-111 38.2735 41.0 37.0 41.0 32.0 41.0 112-113 38.216375 41.0 37.0 41.0 32.0 41.0 114-115 37.999750000000006 41.0 37.0 41.0 32.0 41.0 116-117 37.960625 41.0 37.0 41.0 32.0 41.0 118-119 37.938500000000005 41.0 37.0 41.0 29.5 41.0 120-121 37.543375 41.0 37.0 41.0 27.0 41.0 122-123 37.889875 41.0 37.0 41.0 32.0 41.0 124-125 37.969875 41.0 37.0 41.0 32.0 41.0 126 36.33575 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 3.0 19 1.0 20 2.0 21 8.0 22 10.0 23 9.0 24 19.0 25 18.0 26 12.0 27 11.0 28 31.0 29 25.0 30 44.0 31 51.0 32 70.0 33 83.0 34 127.0 35 128.0 36 169.0 37 260.0 38 419.0 39 1041.0 40 1458.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 NaN NaN NaN NaN 2 27.525 25.3 29.925 17.25 3 23.599999999999998 31.3 27.500000000000004 17.599999999999998 4 27.05 34.225 21.625 17.1 5 28.025 36.025 21.725 14.224999999999998 6 20.225 37.95 22.35 19.475 7 21.224999999999998 17.325 40.525 20.925 8 21.525 22.900000000000002 29.025000000000002 26.55 9 22.525000000000002 22.625 30.525000000000002 24.325 10-11 24.837500000000002 32.25 22.175 20.7375 12-13 23.400000000000002 24.2375 30.312499999999996 22.05 14-15 23.4125 26.950000000000003 28.5625 21.075 16-17 25.174999999999997 28.212500000000002 26.1125 20.5 18-19 24.712500000000002 25.8125 27.075 22.400000000000002 20-21 24.025 28.262500000000003 27.35 20.3625 22-23 24.025 28.1 26.6125 21.2625 24-25 23.0125 27.750000000000004 28.175 21.0625 26-27 24.587500000000002 26.687499999999996 27.375 21.349999999999998 28-29 24.075 27.450000000000003 26.137500000000003 22.3375 30-31 23.5875 27.325 27.400000000000002 21.6875 32-33 24.5 27.712500000000002 26.5625 21.224999999999998 34-35 25.090636329541194 26.490811351418923 26.990873859232405 21.427678459807474 36-37 23.8375 27.55 27.025 21.587500000000002 38-39 23.1875 27.925 28.449999999999996 20.4375 40-41 24.55 27.1625 26.8625 21.425 42-43 23.4125 28.299999999999997 26.4125 21.875 44-45 23.92799099887486 27.54094261782723 27.015876984623077 21.515189398674835 46-47 24.6625 27.1125 26.924999999999997 21.3 48-49 24.349999999999998 27.55 26.6 21.5 50-51 24.637500000000003 28.0875 26.9125 20.3625 52-53 24.875 27.0625 27.150000000000002 20.9125 54-55 23.775 27.6 27.762500000000003 20.8625 56-57 23.925 27.275 27.1 21.7 58-59 23.91548943617952 27.740967620952617 26.740842605325664 21.602700337542196 60-61 24.825 26.974999999999998 27.800000000000004 20.4 62-63 24.0375 27.3125 26.924999999999997 21.725 64-65 24.875 26.174999999999997 27.575 21.375 66-67 24.16552069008626 27.665958244780597 27.640955119389925 20.527565945743216 68-69 23.8875 26.5375 27.6375 21.9375 70-71 23.8375 28.0875 26.737499999999997 21.337500000000002 72-73 24.440555069383674 27.490936367045883 26.440805100637583 21.627703462932867 74-75 24.075 27.525 27.2625 21.1375 76-77 24.15 27.212500000000002 27.5625 21.075 78-79 23.95 27.212500000000002 27.275 21.5625 80-81 24.3 26.75 27.737499999999997 21.212500000000002 82-83 24.2625 26.8 26.987499999999997 21.95 84-85 23.875 27.250000000000004 27.212500000000002 21.6625 86-87 24.990623827978496 27.903487935992 26.540817602200274 20.56507063382923 88-89 24.52806600825103 27.665958244780597 26.378297287160894 21.427678459807474 90-91 24.115514439304913 27.21590198774847 27.365920740092513 21.302662832854107 92-93 24.428053506688336 27.91598949868734 26.978372296537067 20.677584698087262 94-95 24.32804100512564 28.178522315289413 26.22827853481685 21.265158144768094 96-97 24.625 27.325 27.425 20.625 98-99 24.0625 28.125 27.650000000000002 20.1625 100-101 24.575 25.7375 27.6375 22.05 102-103 23.849999999999998 27.575 26.974999999999998 21.6 104-105 23.724999999999998 27.875 27.0125 21.3875 106-107 24.3875 27.212500000000002 27.400000000000002 21.0 108-109 24.275 27.150000000000002 27.5875 20.9875 110-111 23.875 28.262500000000003 27.250000000000004 20.6125 112-113 25.0375 27.200000000000003 26.5 21.2625 114-115 24.3625 27.4125 27.037499999999998 21.1875 116-117 24.325 27.712500000000002 27.150000000000002 20.8125 118-119 24.425 27.6125 27.375 20.5875 120-121 23.527940992624078 27.378422302787847 27.590948868608578 21.502687835979497 122-123 24.8 27.2625 27.0 20.9375 124-125 24.9 27.987499999999997 27.175 19.9375 126 24.675 27.925 26.424999999999997 20.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.5 21 1.5 22 1.0 23 0.5 24 1.0 25 2.5 26 2.5 27 4.0 28 6.0 29 8.0 30 11.5 31 15.5 32 20.5 33 28.0 34 45.5 35 65.5 36 79.5 37 101.5 38 140.0 39 170.0 40 169.0 41 183.0 42 242.0 43 270.0 44 257.5 45 269.5 46 275.5 47 241.5 48 216.5 49 194.5 50 162.0 51 136.0 52 126.0 53 119.5 54 96.0 55 82.0 56 64.0 57 41.5 58 30.0 59 24.5 60 20.5 61 18.5 62 16.5 63 7.5 64 1.5 65 2.5 66 3.0 67 3.5 68 5.0 69 2.5 70 1.5 71 1.5 72 0.5 73 1.5 74 1.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 100.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0125 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0125 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0125 68-69 0.0 70-71 0.0 72-73 0.0125 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0125 90-91 0.0125 92-93 0.0125 94-95 0.0125 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0125 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.08722264728385 96.15 2 1.810762560571283 3.55 3 0.102014792144861 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.48750000000000004 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114 0.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893401 spots for SRR8424226.sra Written 4893401 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra Read 4893398 spots for SRR8424226.sra Written 4893398 spots for SRR8424226.sra SRR ids: ['SRR8424226.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pad6z8bs SRR8424226.sra spots: 97867963 blocks: [[1, 4893398], [4893399, 9786796], [9786797, 14680194], [14680195, 19573592], [19573593, 24466990], [24466991, 29360388], [29360389, 34253786], [34253787, 39147184], [39147185, 44040582], [44040583, 48933980], [48933981, 53827378], [53827379, 58720776], [58720777, 63614174], [63614175, 68507572], [68507573, 73400970], [73400971, 78294368], [78294369, 83187766], [83187767, 88081164], [88081165, 92974562], [92974563, 97867963]] SRR8424226 file size 28363831 SRR8424226 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8424226 SRR8424226_1.fastq SRR8424226_2.fastq Input file: SRR8424226_1.fastq Paired file: SRR8424226_2.fastq trimmed: SRR8424226-trimmed-pair1.fastq, SRR8424226-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:11:03 2025 >> started Tue Feb 11 12:12:41 2025 >> done (97.887s) 97867963 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 53951 ( 0.06%) empty read pairs filtered out after trimming by size control 97813917 (99.94%) read pairs available; of these: 2731920 ( 2.79%) trimmed read pairs available after processing 95081997 (97.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 22 0.00% 20 36 0.00% 21 46 0.00% 22 50 0.00% 23 82 0.00% 24 90 0.00% 25 89 0.00% 26 101 0.00% 27 106 0.00% 28 129 0.00% 29 111 0.00% 30 140 0.00% 31 126 0.00% 32 152 0.00% 33 148 0.00% 34 179 0.00% 35 161 0.00% 36 182 0.00% 37 234 0.00% 38 180 0.00% 39 212 0.00% 40 262 0.00% 41 254 0.00% 42 248 0.00% 43 246 0.00% 44 325 0.00% 45 271 0.00% 46 260 0.00% 47 326 0.00% 48 294 0.00% 49 327 0.00% 50 368 0.00% 51 373 0.00% 52 359 0.00% 53 387 0.00% 54 457 0.00% 55 451 0.00% 56 490 0.00% 57 517 0.00% 58 505 0.00% 59 490 0.00% 60 534 0.00% 61 560 0.00% 62 547 0.00% 63 651 0.00% 64 663 0.00% 65 641 0.00% 66 803 0.00% 67 836 0.00% 68 896 0.00% 69 935 0.00% 70 991 0.00% 71 1177 0.00% 72 1108 0.00% 73 1273 0.00% 74 1328 0.00% 75 1492 0.00% 76 1702 0.00% 77 1890 0.00% 78 2150 0.00% 79 2506 0.00% 80 2827 0.00% 81 2844 0.00% 82 3169 0.00% 83 3486 0.00% 84 3934 0.00% 85 4331 0.00% 86 4941 0.01% 87 5545 0.01% 88 6482 0.01% 89 7689 0.01% 90 8223 0.01% 91 9251 0.01% 92 10551 0.01% 93 11253 0.01% 94 12338 0.01% 95 13943 0.01% 96 15850 0.02% 97 17704 0.02% 98 20389 0.02% 99 22860 0.02% 100 26240 0.03% 101 29671 0.03% 102 32124 0.03% 103 35451 0.04% 104 38301 0.04% 105 41241 0.04% 106 45972 0.05% 107 51220 0.05% 108 56190 0.06% 109 62260 0.06% 110 70145 0.07% 111 76453 0.08% 112 83819 0.09% 113 89373 0.09% 114 94396 0.10% 115 101665 0.10% 116 108224 0.11% 117 115738 0.12% 118 126638 0.13% 119 136309 0.14% 120 148966 0.15% 121 161726 0.17% 122 171415 0.18% 123 182398 0.19% 124 191181 0.20% 125 234710 0.24% 126 95081997 97.21% 97813917 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=27 prefix-density=0.43 prefix-fanout=2.0 sequence=GTTAGGGTAAGCTTTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=34.70 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.9 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=26 prefix-density=0.42 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=21.87 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC SRR8424226 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:13:22 Started mapping on | Feb 11 12:13:23 Finished on | Feb 11 12:21:16 Mapping speed, Million of reads per hour | 744.46 Number of input reads | 97813917 Average input read length | 251 UNIQUE READS: Uniquely mapped reads number | 88569923 Uniquely mapped reads % | 90.55% Average mapped length | 250.18 Number of splices: Total | 73717942 Number of splices: Annotated (sjdb) | 72613646 Number of splices: GT/AG | 72289666 Number of splices: GC/AG | 1160159 Number of splices: AT/AC | 55628 Number of splices: Non-canonical | 212489 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2633919 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 3910180 % of reads mapped to too many loci | 4.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.21% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6610075 6610075 6610075 N_multimapping 2633919 2633919 2633919 N_noFeature 2701598 86090385 4386557 N_ambiguous 1309638 12559 503814 UnstrandedReadsAssigned:84558687 PositiveStrandReadsAssigned:2466979 NegativeStrandReadsAssigned:83679552 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR8424226 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8424226-trimmed-pair1.fastq SRR8424226-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 97,813,917 reads, 86,861,745 reads pseudoaligned [quant] estimated average fragment length: 213.295 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,227 rounds 52401 SRR8424226.ke.tsv 34699 SRR8424226.se.tsv 87100 total ==> SRR8424226.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.71 4511 25.2229 Potri.005G024800.1.v4.1 1035 822.705 1777 21.8078 Potri.004G059700.1.v4.1 961 748.705 93 1.25413 Potri.007G009000.2.v4.1 1416 1203.71 0 0 Potri.003G141000.2.v4.1 2943 2730.71 3773.96 13.9538 Potri.016G087400.1.v4.1 270 80.2286 2595 326.571 Potri.015G069301.1.v4.1 564 352.205 0 0 Potri.010G195200.1.v4.1 1773 1560.71 791 5.11711 Potri.012G127500.1.v4.1 977 764.705 1246 16.451 ==> SRR8424226.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2012 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1993 Potri.001G212900.v4.1 41 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1360 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR8424226 completed mapping pipeline successfully