Starting /dee2/code/volunteer_pipeline.sh SRR8424227 current disk space = 3050623643648 free memory = 1578896848 SRR8424227 SRAfilesize b77938fb61f251a22902e13562e313f3 SRR8424227.sra SRR8424227.sra file validated SRR8424227 is paired end SRR8424227 is conventional basespace SRR8424227 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424227_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.55125 32.0 32.0 32.0 32.0 32.0 2 29.195 32.0 32.0 32.0 27.0 32.0 3 35.22125 37.0 32.0 37.0 32.0 37.0 4 36.245 37.0 37.0 37.0 32.0 37.0 5 36.4825 37.0 37.0 37.0 37.0 37.0 6 39.914 41.0 41.0 41.0 37.0 41.0 7 39.98525 41.0 41.0 41.0 37.0 41.0 8 40.074 41.0 41.0 41.0 37.0 41.0 9 40.11225 41.0 41.0 41.0 37.0 41.0 10-11 40.12125 41.0 41.0 41.0 37.0 41.0 12-13 40.216625 41.0 41.0 41.0 37.0 41.0 14-15 40.02975 41.0 41.0 41.0 37.0 41.0 16-17 40.03325 41.0 41.0 41.0 37.0 41.0 18-19 39.977125 41.0 41.0 41.0 37.0 41.0 20-21 40.02825 41.0 41.0 41.0 37.0 41.0 22-23 40.0845 41.0 41.0 41.0 37.0 41.0 24-25 39.940875000000005 41.0 41.0 41.0 37.0 41.0 26-27 39.914500000000004 41.0 41.0 41.0 37.0 41.0 28-29 39.894375 41.0 41.0 41.0 37.0 41.0 30-31 39.906125 41.0 41.0 41.0 37.0 41.0 32-33 39.970124999999996 41.0 41.0 41.0 37.0 41.0 34-35 39.897499999999994 41.0 41.0 41.0 37.0 41.0 36-37 39.862875 41.0 41.0 41.0 37.0 41.0 38-39 39.899875 41.0 41.0 41.0 37.0 41.0 40-41 39.990125 41.0 41.0 41.0 37.0 41.0 42-43 39.771125 41.0 41.0 41.0 37.0 41.0 44-45 39.766125 41.0 41.0 41.0 37.0 41.0 46-47 39.81325 41.0 41.0 41.0 37.0 41.0 48-49 39.846375 41.0 41.0 41.0 37.0 41.0 50-51 39.925875000000005 41.0 41.0 41.0 37.0 41.0 52-53 39.891625000000005 41.0 41.0 41.0 37.0 41.0 54-55 39.727999999999994 41.0 41.0 41.0 37.0 41.0 56-57 39.70625 41.0 41.0 41.0 37.0 41.0 58-59 39.626625000000004 41.0 41.0 41.0 37.0 41.0 60-61 39.599125 41.0 41.0 41.0 37.0 41.0 62-63 39.829875 41.0 41.0 41.0 37.0 41.0 64-65 39.635 41.0 41.0 41.0 37.0 41.0 66-67 39.01075 41.0 41.0 41.0 34.5 41.0 68-69 39.44525 41.0 41.0 41.0 37.0 41.0 70-71 39.621375 41.0 41.0 41.0 37.0 41.0 72-73 39.481875 41.0 41.0 41.0 37.0 41.0 74-75 39.469625 41.0 41.0 41.0 37.0 41.0 76-77 38.77975 41.0 39.0 41.0 34.5 41.0 78-79 39.027875 41.0 41.0 41.0 34.5 41.0 80-81 39.440875000000005 41.0 41.0 41.0 37.0 41.0 82-83 39.548500000000004 41.0 41.0 41.0 37.0 41.0 84-85 39.482 41.0 41.0 41.0 37.0 41.0 86-87 39.59925 41.0 41.0 41.0 37.0 41.0 88-89 39.548 41.0 41.0 41.0 37.0 41.0 90-91 39.504875 41.0 41.0 41.0 37.0 41.0 92-93 39.320750000000004 41.0 41.0 41.0 37.0 41.0 94-95 37.191625 41.0 34.5 41.0 27.0 41.0 96-97 38.90975 41.0 41.0 41.0 34.5 41.0 98-99 39.314750000000004 41.0 41.0 41.0 37.0 41.0 100-101 39.22 41.0 41.0 41.0 37.0 41.0 102-103 38.849625 41.0 41.0 41.0 32.0 41.0 104-105 38.96525 41.0 41.0 41.0 34.5 41.0 106-107 39.2705 41.0 41.0 41.0 37.0 41.0 108-109 39.04025 41.0 41.0 41.0 34.5 41.0 110-111 39.190125 41.0 41.0 41.0 37.0 41.0 112-113 39.048875 41.0 41.0 41.0 34.5 41.0 114-115 38.781125 41.0 41.0 41.0 32.0 41.0 116-117 38.67825 41.0 39.0 41.0 32.0 41.0 118-119 38.785125 41.0 41.0 41.0 32.0 41.0 120-121 38.479124999999996 41.0 39.0 41.0 32.0 41.0 122-123 38.009625 41.0 37.0 41.0 32.0 41.0 124-125 38.581625 41.0 39.0 41.0 32.0 41.0 126 37.00275 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 2.0 25 1.0 26 8.0 27 10.0 28 18.0 29 23.0 30 36.0 31 37.0 32 50.0 33 63.0 34 85.0 35 94.0 36 130.0 37 179.0 38 233.0 39 464.0 40 2564.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.425 10.925 14.224999999999998 40.425 2 26.191124421453853 15.627552409474543 32.4802613667302 25.701061802341414 3 24.15 22.375 23.1 30.375000000000004 4 27.725 29.175 18.775 24.325 5 25.2 33.85 22.975 17.974999999999998 6 18.425 36.25 24.0 21.325 7 14.475 25.5 38.574999999999996 21.45 8 17.474999999999998 24.099999999999998 31.525 26.900000000000002 9 18.7 20.424999999999997 34.0 26.875 10-11 19.6125 34.4375 23.7875 22.162499999999998 12-13 20.1625 26.4625 27.8875 25.4875 14-15 19.900000000000002 27.987499999999997 28.575 23.5375 16-17 20.1125 27.2625 27.900000000000002 24.725 18-19 20.2125 26.775 27.825 25.1875 20-21 20.837500000000002 27.3375 27.450000000000003 24.375 22-23 20.3375 28.349999999999998 27.4125 23.9 24-25 20.724999999999998 28.8375 26.987499999999997 23.45 26-27 20.2125 27.900000000000002 27.650000000000002 24.2375 28-29 21.125 27.8625 26.6625 24.349999999999998 30-31 20.7 28.499999999999996 27.05 23.75 32-33 19.675 28.125 28.249999999999996 23.95 34-35 20.8125 27.9375 27.150000000000002 24.099999999999998 36-37 19.75 29.262500000000003 26.7625 24.224999999999998 38-39 20.674999999999997 28.499999999999996 26.25 24.575 40-41 20.9 29.7125 25.937500000000004 23.45 42-43 20.5125 28.262500000000003 27.6 23.625 44-45 20.9 28.525 26.900000000000002 23.674999999999997 46-47 21.3625 28.537499999999998 27.250000000000004 22.85 48-49 20.225 27.987499999999997 27.3 24.4875 50-51 20.5375 28.4125 27.2625 23.7875 52-53 21.8875 27.975 26.875 23.2625 54-55 20.075000000000003 27.525 27.825 24.575 56-57 20.9 27.9375 27.0875 24.075 58-59 20.8125 27.037499999999998 28.625 23.525 60-61 20.8 27.8625 26.8625 24.474999999999998 62-63 20.375 27.975 27.925 23.724999999999998 64-65 20.8875 28.487499999999997 26.974999999999998 23.65 66-67 20.7875 28.9125 26.3625 23.9375 68-69 20.7625 26.575 27.950000000000003 24.712500000000002 70-71 20.837500000000002 28.712500000000002 27.125 23.325000000000003 72-73 21.3 27.8125 26.224999999999998 24.6625 74-75 20.4375 27.8875 27.450000000000003 24.224999999999998 76-77 20.8875 28.0875 27.275 23.75 78-79 20.65 28.525 27.425 23.400000000000002 80-81 21.1125 28.037499999999998 27.0875 23.7625 82-83 20.150000000000002 28.249999999999996 26.974999999999998 24.625 84-85 19.75 28.125 26.8625 25.2625 86-87 21.7375 27.35 27.250000000000004 23.6625 88-89 20.4625 28.625 26.674999999999997 24.2375 90-91 20.925 28.712500000000002 26.35 24.0125 92-93 20.3375 29.1375 26.650000000000002 23.875 94-95 21.25 27.712500000000002 27.0875 23.95 96-97 20.025000000000002 27.537499999999998 27.700000000000003 24.7375 98-99 21.15 28.15 26.825 23.875 100-101 20.8125 27.237499999999997 27.825 24.125 102-103 21.1625 27.85 27.287499999999998 23.7 104-105 22.0625 26.637499999999996 27.9375 23.3625 106-107 21.3125 27.8125 26.974999999999998 23.9 108-109 20.8875 27.787499999999998 27.037499999999998 24.2875 110-111 21.15 26.8375 27.375 24.637500000000003 112-113 21.2 27.900000000000002 27.35 23.549999999999997 114-115 20.3375 28.287499999999998 26.937499999999996 24.4375 116-117 21.2375 28.0875 27.175 23.5 118-119 21.025 27.425 27.6375 23.9125 120-121 20.974999999999998 26.950000000000003 27.537499999999998 24.5375 122-123 20.1625 28.225 26.775 24.837500000000002 124-125 20.849999999999998 28.199999999999996 26.950000000000003 24.0 126 21.425 27.700000000000003 26.900000000000002 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.5 23 2.5 24 3.0 25 3.0 26 3.5 27 5.0 28 6.5 29 9.5 30 17.5 31 22.5 32 28.0 33 39.5 34 49.0 35 56.0 36 71.5 37 100.5 38 137.5 39 158.5 40 167.0 41 184.5 42 210.0 43 242.0 44 253.5 45 244.5 46 251.5 47 245.0 48 228.5 49 215.0 50 185.5 51 155.5 52 133.5 53 112.0 54 89.5 55 73.0 56 62.0 57 57.0 58 43.0 59 33.0 60 26.0 61 16.5 62 11.0 63 8.5 64 9.0 65 7.0 66 4.0 67 2.5 68 2.0 69 1.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 1.5 77 2.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 8.175 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.97986577181209 93.925 2 2.839442436757873 5.5 3 0.15487867836861124 0.44999999999999996 4 0.0 0.0 5 0.02581311306143521 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGCGACATGAGCATAGTCTTTTATGAATTTCTCAATTTGTTCATCAGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114 0.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8424227 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424227_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 2.1975 2.0 2.0 2.0 2.0 2.0 2 31.3225 32.0 32.0 32.0 32.0 32.0 3 31.09875 32.0 32.0 32.0 32.0 32.0 4 35.06125 37.0 32.0 37.0 32.0 37.0 5 35.8025 37.0 37.0 37.0 32.0 37.0 6 39.15425 41.0 41.0 41.0 37.0 41.0 7 38.856 41.0 41.0 41.0 37.0 41.0 8 38.95275 41.0 41.0 41.0 37.0 41.0 9 38.93875 41.0 41.0 41.0 37.0 41.0 10-11 39.267625 41.0 41.0 41.0 37.0 41.0 12-13 39.263875 41.0 41.0 41.0 37.0 41.0 14-15 39.32025 41.0 41.0 41.0 37.0 41.0 16-17 39.345375000000004 41.0 41.0 41.0 37.0 41.0 18-19 39.33675 41.0 41.0 41.0 37.0 41.0 20-21 39.405874999999995 41.0 41.0 41.0 37.0 41.0 22-23 39.431 41.0 41.0 41.0 37.0 41.0 24-25 37.61175 41.0 39.0 41.0 29.5 41.0 26-27 37.435625 41.0 37.0 41.0 29.5 41.0 28-29 38.505375 41.0 37.0 41.0 32.0 41.0 30-31 38.66825 41.0 41.0 41.0 34.5 41.0 32-33 39.069375 41.0 41.0 41.0 37.0 41.0 34-35 38.820625 41.0 41.0 41.0 34.5 41.0 36-37 38.824625 41.0 41.0 41.0 34.5 41.0 38-39 38.451499999999996 41.0 39.0 41.0 32.0 41.0 40-41 38.631875 41.0 39.0 41.0 34.5 41.0 42-43 38.716125 41.0 41.0 41.0 32.0 41.0 44-45 38.545125 41.0 37.0 41.0 32.0 41.0 46-47 38.7085 41.0 41.0 41.0 32.0 41.0 48-49 38.835625 41.0 41.0 41.0 32.0 41.0 50-51 38.80425 41.0 41.0 41.0 32.0 41.0 52-53 38.440875000000005 41.0 39.0 41.0 32.0 41.0 54-55 38.566375 41.0 39.0 41.0 32.0 41.0 56-57 38.48075 41.0 39.0 41.0 32.0 41.0 58-59 38.6595 41.0 41.0 41.0 32.0 41.0 60-61 38.86 41.0 41.0 41.0 34.5 41.0 62-63 38.546375 41.0 39.0 41.0 32.0 41.0 64-65 38.602625 41.0 41.0 41.0 32.0 41.0 66-67 38.721875 41.0 41.0 41.0 32.0 41.0 68-69 38.696875 41.0 41.0 41.0 32.0 41.0 70-71 38.841125000000005 41.0 41.0 41.0 34.5 41.0 72-73 38.587375 41.0 41.0 41.0 32.0 41.0 74-75 38.68625 41.0 41.0 41.0 32.0 41.0 76-77 37.554375 41.0 39.0 41.0 29.5 41.0 78-79 38.075874999999996 41.0 37.0 41.0 32.0 41.0 80-81 38.538875000000004 41.0 41.0 41.0 32.0 41.0 82-83 38.505250000000004 41.0 41.0 41.0 32.0 41.0 84-85 37.323750000000004 41.0 37.0 41.0 27.0 41.0 86-87 38.411375 41.0 41.0 41.0 32.0 41.0 88-89 38.378625 41.0 39.0 41.0 32.0 41.0 90-91 38.666875000000005 41.0 41.0 41.0 32.0 41.0 92-93 38.034125 41.0 39.0 41.0 29.5 41.0 94-95 38.44 41.0 39.0 41.0 32.0 41.0 96-97 37.641875 41.0 37.0 41.0 29.5 41.0 98-99 37.409375 41.0 37.0 41.0 27.0 41.0 100-101 37.55225 41.0 37.0 41.0 29.5 41.0 102-103 37.95 41.0 37.0 41.0 32.0 41.0 104-105 35.794624999999996 41.0 34.5 41.0 19.5 41.0 106-107 37.593875 41.0 37.0 41.0 27.0 41.0 108-109 36.866749999999996 41.0 37.0 41.0 24.5 41.0 110-111 37.523375 41.0 37.0 41.0 29.5 41.0 112-113 37.684625 41.0 37.0 41.0 29.5 41.0 114-115 35.754374999999996 41.0 37.0 41.0 22.0 41.0 116-117 36.0285 41.0 34.5 41.0 22.0 41.0 118-119 36.219125000000005 41.0 37.0 41.0 22.0 41.0 120-121 37.07625 41.0 37.0 41.0 27.0 41.0 122-123 37.35725 41.0 37.0 41.0 27.0 41.0 124-125 36.446 41.0 37.0 41.0 24.5 41.0 126 33.42275 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 5.0 20 6.0 21 6.0 22 14.0 23 12.0 24 13.0 25 16.0 26 29.0 27 31.0 28 44.0 29 42.0 30 65.0 31 86.0 32 96.0 33 101.0 34 108.0 35 154.0 36 200.0 37 272.0 38 405.0 39 1039.0 40 1254.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.629629629629626 11.11111111111111 25.925925925925924 33.33333333333333 2 26.974999999999998 26.375 29.675 16.975 3 23.275000000000002 32.625 26.950000000000003 17.150000000000002 4 27.950000000000003 34.475 19.975 17.599999999999998 5 27.425 36.35 21.0 15.225 6 18.95 39.2 22.900000000000002 18.95 7 21.349999999999998 18.325 39.45 20.875 8 21.65 23.075000000000003 29.575000000000003 25.7 9 23.925 21.95 31.025000000000002 23.1 10-11 24.6125 32.487500000000004 22.412499999999998 20.4875 12-13 23.25 24.2625 30.55 21.9375 14-15 22.537499999999998 27.85 29.4125 20.200000000000003 16-17 24.462500000000002 26.950000000000003 28.575 20.0125 18-19 23.849999999999998 26.125 28.0625 21.9625 20-21 24.349999999999998 26.875 26.974999999999998 21.8 22-23 24.474999999999998 27.4125 27.474999999999998 20.6375 24-25 23.8625 27.950000000000003 27.4125 20.775 26-27 23.4875 28.6875 26.9125 20.9125 28-29 23.6625 27.737499999999997 27.212500000000002 21.3875 30-31 23.4875 27.3 27.787499999999998 21.425 32-33 22.787499999999998 29.349999999999998 26.2125 21.65 34-35 23.625 27.237499999999997 27.900000000000002 21.2375 36-37 23.1375 27.6875 27.6 21.575 38-39 23.875 27.4125 28.175 20.5375 40-41 24.25 27.8625 27.0125 20.875 42-43 22.2125 27.950000000000003 27.8875 21.95 44-45 23.4125 27.85 27.900000000000002 20.837500000000002 46-47 23.75 27.037499999999998 27.437499999999996 21.775 48-49 23.7375 27.5125 28.262500000000003 20.4875 50-51 23.6875 27.474999999999998 27.474999999999998 21.3625 52-53 24.0375 27.3625 27.450000000000003 21.15 54-55 23.95 27.625 27.474999999999998 20.95 56-57 24.212500000000002 27.200000000000003 28.050000000000004 20.5375 58-59 24.525 27.6 26.5625 21.3125 60-61 23.825 27.224999999999998 27.5875 21.3625 62-63 23.9375 28.175 26.8 21.087500000000002 64-65 23.9125 28.225 26.6 21.2625 66-67 23.9375 26.5375 27.8625 21.6625 68-69 23.799999999999997 27.3875 27.975 20.837500000000002 70-71 23.6625 27.1375 27.5125 21.6875 72-73 23.9875 26.2875 27.6875 22.037499999999998 74-75 23.375 27.275 27.675 21.675 76-77 23.6625 27.187499999999996 28.0875 21.0625 78-79 23.1 27.712500000000002 27.962500000000002 21.224999999999998 80-81 23.724999999999998 27.8625 26.775 21.637500000000003 82-83 24.0625 27.625 26.775 21.5375 84-85 23.625 28.212500000000002 26.5375 21.625 86-87 23.0375 28.287499999999998 27.175 21.5 88-89 24.3875 27.3375 27.700000000000003 20.575 90-91 23.9125 27.287499999999998 27.85 20.95 92-93 24.637500000000003 27.05 27.1 21.212500000000002 94-95 24.3875 27.275 27.6375 20.7 96-97 24.125 26.6 27.675 21.6 98-99 23.925 28.025 26.825 21.224999999999998 100-101 24.1375 27.6375 27.425 20.8 102-103 23.45 27.375 28.65 20.525 104-105 23.95 27.987499999999997 27.0 21.0625 106-107 23.9375 27.525 27.437499999999996 21.099999999999998 108-109 24.1125 27.05 27.450000000000003 21.3875 110-111 24.1625 27.3875 27.0 21.45 112-113 24.775 26.737499999999997 27.5875 20.9 114-115 24.15 26.637499999999996 27.9375 21.275 116-117 24.6 28.275 27.150000000000002 19.975 118-119 23.599999999999998 27.487499999999997 27.150000000000002 21.762500000000003 120-121 24.4 27.875 27.6625 20.0625 122-123 24.7875 26.900000000000002 27.075 21.2375 124-125 24.34054256782098 26.8533566695837 26.903362920365048 21.90273784223028 126 24.325 29.099999999999998 26.575 20.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 1.0 19 2.0 20 1.5 21 1.5 22 2.0 23 2.5 24 2.5 25 7.0 26 9.0 27 5.0 28 7.0 29 8.0 30 11.0 31 17.0 32 21.5 33 30.0 34 43.0 35 59.5 36 81.5 37 105.0 38 127.5 39 165.5 40 199.0 41 221.5 42 254.0 43 276.5 44 282.0 45 264.0 46 264.0 47 264.0 48 217.0 49 174.0 50 149.5 51 130.5 52 110.5 53 97.0 54 83.5 55 72.0 56 52.0 57 33.5 58 33.0 59 29.0 60 22.0 61 16.0 62 11.5 63 5.5 64 3.5 65 4.5 66 3.5 67 1.5 68 1.5 69 2.0 70 1.0 71 1.0 72 1.0 73 0.5 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 99.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0125 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.3 #Duplication Level Percentage of deduplicated Percentage of total 1 97.327852004111 94.69999999999999 2 2.5950668036998974 5.050000000000001 3 0.051387461459403906 0.15 4 0.025693730729701953 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTGA 10 0.0 4760.5 1 >>END_MODULE Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546903 spots for SRR8424227.sra Written 3546903 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra Read 3546884 spots for SRR8424227.sra Written 3546884 spots for SRR8424227.sra SRR ids: ['SRR8424227.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gk8hoddg SRR8424227.sra spots: 70937699 blocks: [[1, 3546884], [3546885, 7093768], [7093769, 10640652], [10640653, 14187536], [14187537, 17734420], [17734421, 21281304], [21281305, 24828188], [24828189, 28375072], [28375073, 31921956], [31921957, 35468840], [35468841, 39015724], [39015725, 42562608], [42562609, 46109492], [46109493, 49656376], [49656377, 53203260], [53203261, 56750144], [56750145, 60297028], [60297029, 63843912], [63843913, 67390796], [67390797, 70937699]] SRR8424227 file size 20553003 SRR8424227 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8424227 SRR8424227_1.fastq SRR8424227_2.fastq Input file: SRR8424227_1.fastq Paired file: SRR8424227_2.fastq trimmed: SRR8424227-trimmed-pair1.fastq, SRR8424227-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:09:04 2025 >> started Tue Feb 11 13:10:38 2025 >> done (94.739s) 70937699 read pairs processed; of these: 55 ( 0.00%) short read pairs filtered out after trimming by size control 119887 ( 0.17%) empty read pairs filtered out after trimming by size control 70817757 (99.83%) read pairs available; of these: 2429702 ( 3.43%) trimmed read pairs available after processing 68388055 (96.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 14 0.00% 20 24 0.00% 21 27 0.00% 22 29 0.00% 23 34 0.00% 24 38 0.00% 25 48 0.00% 26 45 0.00% 27 74 0.00% 28 86 0.00% 29 61 0.00% 30 69 0.00% 31 81 0.00% 32 64 0.00% 33 102 0.00% 34 112 0.00% 35 94 0.00% 36 89 0.00% 37 103 0.00% 38 117 0.00% 39 117 0.00% 40 136 0.00% 41 131 0.00% 42 116 0.00% 43 134 0.00% 44 170 0.00% 45 147 0.00% 46 171 0.00% 47 190 0.00% 48 198 0.00% 49 237 0.00% 50 210 0.00% 51 221 0.00% 52 218 0.00% 53 212 0.00% 54 275 0.00% 55 321 0.00% 56 301 0.00% 57 329 0.00% 58 287 0.00% 59 314 0.00% 60 323 0.00% 61 360 0.00% 62 375 0.00% 63 424 0.00% 64 431 0.00% 65 430 0.00% 66 424 0.00% 67 485 0.00% 68 532 0.00% 69 583 0.00% 70 648 0.00% 71 661 0.00% 72 774 0.00% 73 798 0.00% 74 906 0.00% 75 918 0.00% 76 982 0.00% 77 1126 0.00% 78 1274 0.00% 79 1495 0.00% 80 1614 0.00% 81 1717 0.00% 82 1935 0.00% 83 2163 0.00% 84 2264 0.00% 85 2591 0.00% 86 2854 0.00% 87 3396 0.00% 88 3990 0.01% 89 4493 0.01% 90 4898 0.01% 91 5587 0.01% 92 6168 0.01% 93 6493 0.01% 94 7500 0.01% 95 8253 0.01% 96 9415 0.01% 97 11666 0.02% 98 10703 0.02% 99 13475 0.02% 100 15536 0.02% 101 17594 0.02% 102 19123 0.03% 103 21276 0.03% 104 22988 0.03% 105 24967 0.04% 106 27329 0.04% 107 30229 0.04% 108 33963 0.05% 109 38453 0.05% 110 42825 0.06% 111 48015 0.07% 112 52279 0.07% 113 55291 0.08% 114 59308 0.08% 115 64268 0.09% 116 67859 0.10% 117 73421 0.10% 118 80397 0.11% 119 87033 0.12% 120 95672 0.14% 121 104236 0.15% 122 113371 0.16% 123 124071 0.18% 124 157909 0.22% 125 821404 1.16% 126 68388055 96.57% 70817757 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.42 prefix-fanout=2.0 sequence=GTTAGGGTAAGCTTTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=17.13 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.40 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=66.47 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.6 sequence=AGAGAGGAGATAAGATATAGACACTTGTTATAGGCTATCTTGCACTGGCAGTGTAGTCTCCTATCAGCAAAAACAGAAAAAAGAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCC SRR8424227 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:11:18 Started mapping on | Feb 11 13:11:19 Finished on | Feb 11 13:17:25 Mapping speed, Million of reads per hour | 696.57 Number of input reads | 70817757 Average input read length | 251 UNIQUE READS: Uniquely mapped reads number | 64572019 Uniquely mapped reads % | 91.18% Average mapped length | 250.06 Number of splices: Total | 51672325 Number of splices: Annotated (sjdb) | 50883523 Number of splices: GT/AG | 50669880 Number of splices: GC/AG | 802900 Number of splices: AT/AC | 38913 Number of splices: Non-canonical | 160632 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.02% Deletion average length | 2.47 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2762043 % of reads mapped to multiple loci | 3.90% Number of reads mapped to too many loci | 1175732 % of reads mapped to too many loci | 1.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.86% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3483695 3483695 3483695 N_multimapping 2762043 2762043 2762043 N_noFeature 1502547 62729190 2845349 N_ambiguous 889063 10648 379389 UnstrandedReadsAssigned:62180409 PositiveStrandReadsAssigned:1832181 NegativeStrandReadsAssigned:61347281 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR8424227 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8424227-trimmed-pair1.fastq SRR8424227-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 70,817,757 reads, 63,650,229 reads pseudoaligned [quant] estimated average fragment length: 220.637 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,227 rounds 52401 SRR8424227.ke.tsv 34699 SRR8424227.se.tsv 87100 total ==> SRR8424227.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.36 3740 31.1998 Potri.005G024800.1.v4.1 1035 815.363 891 16.394 Potri.004G059700.1.v4.1 961 741.363 69 1.39629 Potri.007G009000.2.v4.1 1416 1196.36 0 0 Potri.003G141000.2.v4.1 2943 2723.36 3006.29 16.5609 Potri.016G087400.1.v4.1 270 79.1892 2214.68 419.569 Potri.015G069301.1.v4.1 564 345.403 0 0 Potri.010G195200.1.v4.1 1773 1553.36 180 1.73843 Potri.012G127500.1.v4.1 977 757.363 698 13.8264 ==> SRR8424227.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 881 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 958 Potri.001G212900.v4.1 424 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 67 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR8424227 completed mapping pipeline successfully