Starting /dee2/code/volunteer_pipeline.sh SRR8424228 current disk space = 3050719502336 free memory = 1513436076 SRR8424228 SRAfilesize c7ae75d998c0a13ca7738144b72c5097 SRR8424228.sra SRR8424228.sra file validated SRR8424228 is paired end SRR8424228 is conventional basespace SRR8424228 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424228_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 13.55375 2.0 2.0 32.0 2.0 32.0 2 31.57125 32.0 32.0 32.0 32.0 32.0 3 33.2275 32.0 32.0 37.0 32.0 37.0 4 35.92875 37.0 37.0 37.0 32.0 37.0 5 36.28125 37.0 37.0 37.0 37.0 37.0 6 39.8365 41.0 41.0 41.0 37.0 41.0 7 39.86975 41.0 41.0 41.0 37.0 41.0 8 39.9125 41.0 41.0 41.0 37.0 41.0 9 39.991 41.0 41.0 41.0 37.0 41.0 10-11 40.03037500000001 41.0 41.0 41.0 37.0 41.0 12-13 39.988375000000005 41.0 41.0 41.0 37.0 41.0 14-15 39.968375 41.0 41.0 41.0 37.0 41.0 16-17 40.018 41.0 41.0 41.0 37.0 41.0 18-19 40.060625 41.0 41.0 41.0 37.0 41.0 20-21 39.94425 41.0 41.0 41.0 37.0 41.0 22-23 39.949 41.0 41.0 41.0 37.0 41.0 24-25 39.85525 41.0 41.0 41.0 37.0 41.0 26-27 39.8905 41.0 41.0 41.0 37.0 41.0 28-29 38.65675 41.0 41.0 41.0 32.0 41.0 30-31 38.4945 41.0 39.0 41.0 32.0 41.0 32-33 39.343125 41.0 41.0 41.0 37.0 41.0 34-35 39.8035 41.0 41.0 41.0 37.0 41.0 36-37 39.863 41.0 41.0 41.0 37.0 41.0 38-39 39.793625000000006 41.0 41.0 41.0 37.0 41.0 40-41 39.8585 41.0 41.0 41.0 37.0 41.0 42-43 39.8055 41.0 41.0 41.0 37.0 41.0 44-45 39.757875 41.0 41.0 41.0 37.0 41.0 46-47 39.84925 41.0 41.0 41.0 37.0 41.0 48-49 39.708124999999995 41.0 41.0 41.0 37.0 41.0 50-51 39.776624999999996 41.0 41.0 41.0 37.0 41.0 52-53 39.779125 41.0 41.0 41.0 37.0 41.0 54-55 39.66325 41.0 41.0 41.0 37.0 41.0 56-57 39.561125000000004 41.0 41.0 41.0 37.0 41.0 58-59 39.644999999999996 41.0 41.0 41.0 37.0 41.0 60-61 39.575 41.0 41.0 41.0 37.0 41.0 62-63 39.589875000000006 41.0 41.0 41.0 37.0 41.0 64-65 39.519499999999994 41.0 41.0 41.0 37.0 41.0 66-67 39.689750000000004 41.0 41.0 41.0 37.0 41.0 68-69 39.582875 41.0 41.0 41.0 37.0 41.0 70-71 39.597750000000005 41.0 41.0 41.0 37.0 41.0 72-73 39.529624999999996 41.0 41.0 41.0 37.0 41.0 74-75 39.456625 41.0 41.0 41.0 37.0 41.0 76-77 38.989125 41.0 39.0 41.0 34.5 41.0 78-79 38.987625 41.0 41.0 41.0 32.0 41.0 80-81 39.199625 41.0 41.0 41.0 34.5 41.0 82-83 39.19225 41.0 41.0 41.0 37.0 41.0 84-85 39.448499999999996 41.0 41.0 41.0 37.0 41.0 86-87 39.388999999999996 41.0 41.0 41.0 37.0 41.0 88-89 39.24625 41.0 41.0 41.0 37.0 41.0 90-91 39.22525 41.0 41.0 41.0 37.0 41.0 92-93 39.182249999999996 41.0 41.0 41.0 34.5 41.0 94-95 38.98125 41.0 41.0 41.0 34.5 41.0 96-97 39.23725 41.0 41.0 41.0 37.0 41.0 98-99 39.06925 41.0 41.0 41.0 34.5 41.0 100-101 39.13675 41.0 41.0 41.0 37.0 41.0 102-103 39.0075 41.0 41.0 41.0 34.5 41.0 104-105 38.871375 41.0 41.0 41.0 34.5 41.0 106-107 39.182625 41.0 41.0 41.0 37.0 41.0 108-109 38.995125 41.0 41.0 41.0 37.0 41.0 110-111 39.015875 41.0 41.0 41.0 34.5 41.0 112-113 38.914375 41.0 41.0 41.0 32.0 41.0 114-115 38.8605 41.0 41.0 41.0 32.0 41.0 116-117 38.686875 41.0 41.0 41.0 32.0 41.0 118-119 38.213375 41.0 39.0 41.0 29.5 41.0 120-121 37.728624999999994 41.0 39.0 41.0 29.5 41.0 122-123 38.30825 41.0 37.0 41.0 32.0 41.0 124-125 38.642875000000004 41.0 41.0 41.0 32.0 41.0 126 36.889 41.0 37.0 41.0 27.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 0.0 25 2.0 26 3.0 27 14.0 28 22.0 29 24.0 30 31.0 31 49.0 32 47.0 33 63.0 34 93.0 35 120.0 36 147.0 37 205.0 38 285.0 39 659.0 40 2235.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.4408945686901 10.60702875399361 14.696485623003195 40.2555910543131 2 26.450000000000003 16.55 32.05 24.95 3 24.675 22.5 23.925 28.9 4 26.674999999999997 31.35 18.825 23.150000000000002 5 26.075 34.849999999999994 21.325 17.75 6 19.0 37.15 23.3 20.549999999999997 7 13.3 24.85 39.35 22.5 8 17.1 24.0 32.4 26.5 9 17.05 21.7 35.099999999999994 26.150000000000002 10-11 20.2125 34.225 23.9125 21.65 12-13 19.775000000000002 27.125 28.675 24.425 14-15 20.225 28.225 27.950000000000003 23.599999999999998 16-17 20.1375 27.900000000000002 29.049999999999997 22.912499999999998 18-19 20.025000000000002 28.825 27.3375 23.8125 20-21 20.424999999999997 27.450000000000003 27.425 24.7 22-23 20.599999999999998 29.212500000000002 27.187499999999996 23.0 24-25 19.775000000000002 29.1375 26.8 24.2875 26-27 20.5875 28.762500000000003 26.974999999999998 23.674999999999997 28-29 20.939309997481743 27.965248048350546 25.78695542684462 25.308486527323094 30-31 18.725 28.6125 27.212500000000002 25.45 32-33 20.65067202612737 27.885943976887322 27.798015324707954 23.66536867227735 34-35 20.525 28.787499999999998 27.437499999999996 23.25 36-37 20.05 28.812500000000004 26.8625 24.275 38-39 20.4125 28.712500000000002 26.0625 24.8125 40-41 20.175 28.675 26.924999999999997 24.224999999999998 42-43 19.5 28.5625 27.462500000000002 24.474999999999998 44-45 21.5625 27.950000000000003 26.8 23.6875 46-47 20.424999999999997 27.925 28.1625 23.4875 48-49 20.4125 27.725 27.6 24.2625 50-51 20.8875 27.950000000000003 26.924999999999997 24.2375 52-53 20.549999999999997 28.8375 26.187500000000004 24.425 54-55 20.4375 28.425 27.05 24.087500000000002 56-57 19.9125 28.199999999999996 27.8625 24.025 58-59 20.525 28.9 26.7625 23.8125 60-61 21.525 28.125 26.9125 23.4375 62-63 20.7375 27.187499999999996 28.225 23.849999999999998 64-65 20.7125 28.037499999999998 26.924999999999997 24.325 66-67 20.5 27.6625 26.787499999999998 25.05 68-69 19.9125 28.537499999999998 27.375 24.175 70-71 20.0 27.875 27.3625 24.762500000000003 72-73 20.45 27.537499999999998 27.1625 24.85 74-75 20.424999999999997 27.575 28.249999999999996 23.75 76-77 21.2 28.262500000000003 27.025 23.5125 78-79 21.337500000000002 28.1875 27.1 23.375 80-81 21.0 28.975 26.9625 23.0625 82-83 20.8125 28.449999999999996 27.224999999999998 23.5125 84-85 21.0125 26.9625 27.125 24.9 86-87 21.2 27.025 27.5125 24.2625 88-89 20.974999999999998 28.275 26.8375 23.9125 90-91 22.475 27.250000000000004 27.0 23.275000000000002 92-93 20.5125 27.55 27.6125 24.325 94-95 20.424999999999997 27.6 28.000000000000004 23.974999999999998 96-97 20.5375 27.3875 27.200000000000003 24.875 98-99 20.974999999999998 27.775 27.3875 23.8625 100-101 21.4 28.6125 26.987499999999997 23.0 102-103 21.2625 28.9125 25.937500000000004 23.8875 104-105 21.2625 27.950000000000003 27.237499999999997 23.549999999999997 106-107 21.625 27.400000000000002 27.500000000000004 23.474999999999998 108-109 20.3625 27.950000000000003 27.575 24.1125 110-111 20.5375 27.712500000000002 27.825 23.925 112-113 21.712500000000002 28.287499999999998 26.75 23.25 114-115 21.8125 26.4625 27.400000000000002 24.325 116-117 20.3625 27.224999999999998 27.487499999999997 24.925 118-119 21.425 28.287499999999998 26.5125 23.775 120-121 22.05 27.737499999999997 25.75 24.462500000000002 122-123 21.837500000000002 27.275 26.8375 24.05 124-125 21.099999999999998 27.775 27.725 23.400000000000002 126 21.475 28.199999999999996 25.974999999999998 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 6.0 1 3.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 2.5 24 5.5 25 5.0 26 6.0 27 8.0 28 7.5 29 12.5 30 17.5 31 26.0 32 36.0 33 45.0 34 59.0 35 72.5 36 91.5 37 118.5 38 127.0 39 133.5 40 167.0 41 201.0 42 221.0 43 232.0 44 248.0 45 267.0 46 270.0 47 256.5 48 220.0 49 198.0 50 185.0 51 155.5 52 118.0 53 91.5 54 78.5 55 61.5 56 55.5 57 44.0 58 33.0 59 28.5 60 22.0 61 15.5 62 13.5 63 10.5 64 5.0 65 3.0 66 2.5 67 3.5 68 2.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.5 74 1.0 75 1.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 60.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.7250000000000001 30-31 0.0 32-33 0.4875 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.16091954022988 96.075 2 1.6347381864623245 3.2 3 0.1277139208173691 0.375 4 0.05108556832694764 0.2 5 0.0 0.0 6 0.02554278416347382 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 6 0.15 TruSeq Adapter, Index 2 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.38749999999999996 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8424228 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424228_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 13.265 2.0 2.0 32.0 2.0 32.0 2 30.9075 32.0 32.0 32.0 32.0 32.0 3 32.32875 32.0 32.0 32.0 32.0 37.0 4 34.9975 37.0 37.0 37.0 32.0 37.0 5 35.70125 37.0 37.0 37.0 32.0 37.0 6 38.89475 41.0 41.0 41.0 37.0 41.0 7 38.48675 41.0 37.0 41.0 32.0 41.0 8 38.9115 41.0 41.0 41.0 37.0 41.0 9 39.2815 41.0 41.0 41.0 37.0 41.0 10-11 39.11125 41.0 41.0 41.0 37.0 41.0 12-13 39.270624999999995 41.0 41.0 41.0 37.0 41.0 14-15 39.325874999999996 41.0 41.0 41.0 37.0 41.0 16-17 39.338375 41.0 41.0 41.0 37.0 41.0 18-19 39.140375 41.0 41.0 41.0 37.0 41.0 20-21 39.156875 41.0 41.0 41.0 37.0 41.0 22-23 39.13875 41.0 41.0 41.0 37.0 41.0 24-25 39.002250000000004 41.0 41.0 41.0 37.0 41.0 26-27 39.058875 41.0 41.0 41.0 37.0 41.0 28-29 39.0965 41.0 41.0 41.0 37.0 41.0 30-31 39.1715 41.0 41.0 41.0 37.0 41.0 32-33 39.28275 41.0 41.0 41.0 37.0 41.0 34-35 38.9705 41.0 41.0 41.0 37.0 41.0 36-37 38.836124999999996 41.0 41.0 41.0 37.0 41.0 38-39 38.8895 41.0 41.0 41.0 34.5 41.0 40-41 38.694 41.0 41.0 41.0 32.0 41.0 42-43 38.781875 41.0 41.0 41.0 32.0 41.0 44-45 38.735625 41.0 41.0 41.0 32.0 41.0 46-47 38.96725 41.0 41.0 41.0 34.5 41.0 48-49 38.018625 41.0 39.0 41.0 32.0 41.0 50-51 38.336875 41.0 39.0 41.0 32.0 41.0 52-53 38.742625000000004 41.0 41.0 41.0 32.0 41.0 54-55 37.343 41.0 37.0 41.0 29.5 41.0 56-57 38.53275 41.0 39.0 41.0 32.0 41.0 58-59 38.579375 41.0 41.0 41.0 32.0 41.0 60-61 38.490875 41.0 41.0 41.0 32.0 41.0 62-63 38.542125 41.0 41.0 41.0 32.0 41.0 64-65 38.07725 41.0 37.0 41.0 29.5 41.0 66-67 38.531875 41.0 41.0 41.0 32.0 41.0 68-69 38.448875 41.0 39.0 41.0 32.0 41.0 70-71 38.17375 41.0 39.0 41.0 32.0 41.0 72-73 38.20825 41.0 37.0 41.0 32.0 41.0 74-75 38.2685 41.0 39.0 41.0 32.0 41.0 76-77 37.3845 41.0 39.0 41.0 29.5 41.0 78-79 37.357124999999996 41.0 37.0 41.0 27.0 41.0 80-81 37.8615 41.0 37.0 41.0 29.5 41.0 82-83 38.08175 41.0 39.0 41.0 32.0 41.0 84-85 38.064375 41.0 37.0 41.0 32.0 41.0 86-87 36.267250000000004 41.0 34.5 41.0 24.5 41.0 88-89 37.935500000000005 41.0 37.0 41.0 32.0 41.0 90-91 38.095625 41.0 37.0 41.0 32.0 41.0 92-93 38.2235 41.0 37.0 41.0 32.0 41.0 94-95 38.182500000000005 41.0 37.0 41.0 32.0 41.0 96-97 38.100875 41.0 37.0 41.0 32.0 41.0 98-99 38.01925 41.0 37.0 41.0 32.0 41.0 100-101 37.149375000000006 41.0 37.0 41.0 27.0 41.0 102-103 37.7305 41.0 37.0 41.0 27.0 41.0 104-105 37.578125 41.0 37.0 41.0 29.5 41.0 106-107 37.61 41.0 37.0 41.0 29.5 41.0 108-109 36.43825 41.0 37.0 41.0 24.5 41.0 110-111 37.399249999999995 41.0 37.0 41.0 27.0 41.0 112-113 37.316 41.0 37.0 41.0 27.0 41.0 114-115 37.412125 41.0 37.0 41.0 27.0 41.0 116-117 37.2485 41.0 37.0 41.0 27.0 41.0 118-119 37.157875000000004 41.0 37.0 41.0 27.0 41.0 120-121 37.102375 41.0 37.0 41.0 27.0 41.0 122-123 37.152375 41.0 37.0 41.0 27.0 41.0 124-125 36.644 41.0 37.0 41.0 24.5 41.0 126 34.64475 37.0 32.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 2.0 18 3.0 19 6.0 20 3.0 21 7.0 22 15.0 23 13.0 24 17.0 25 24.0 26 27.0 27 31.0 28 38.0 29 40.0 30 64.0 31 71.0 32 86.0 33 104.0 34 145.0 35 142.0 36 161.0 37 241.0 38 349.0 39 894.0 40 1515.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.006439150032193 19.12427559562138 18.673535093367676 32.195750160978754 2 27.275 27.900000000000002 27.375 17.45 3 23.599999999999998 32.4 26.1 17.9 4 26.150000000000002 36.75 19.775000000000002 17.325 5 27.150000000000002 38.35 20.9 13.600000000000001 6 19.35 39.45 22.225 18.975 7 20.7 17.974999999999998 40.925 20.4 8 22.0 22.55 29.45 26.0 9 23.825 22.5 29.075 24.6 10-11 25.587500000000002 32.487500000000004 23.0125 18.912499999999998 12-13 24.275 25.137500000000003 28.425 22.162499999999998 14-15 22.475 28.025 28.625 20.875 16-17 24.1875 26.724999999999998 28.1375 20.95 18-19 22.9375 26.5875 27.962500000000002 22.5125 20-21 24.275 27.800000000000004 26.1 21.825 22-23 24.325 27.8125 27.3625 20.5 24-25 22.575 29.212500000000002 26.937499999999996 21.275 26-27 23.8625 27.8875 26.787499999999998 21.462500000000002 28-29 24.5125 27.5875 27.1375 20.7625 30-31 23.8125 27.762500000000003 27.487499999999997 20.9375 32-33 23.674999999999997 28.1 27.8875 20.3375 34-35 24.1125 28.249999999999996 26.700000000000003 20.9375 36-37 24.375 26.950000000000003 27.375 21.3 38-39 23.425 27.187499999999996 27.650000000000002 21.7375 40-41 24.0 27.55 27.437499999999996 21.0125 42-43 23.7125 27.762500000000003 26.737499999999997 21.7875 44-45 23.875 28.1625 26.974999999999998 20.9875 46-47 24.1375 27.275 27.187499999999996 21.4 48-49 23.724999999999998 27.625 26.674999999999997 21.975 50-51 23.8375 27.5125 27.187499999999996 21.462500000000002 52-53 23.275000000000002 27.3125 27.5875 21.825 54-55 24.5125 27.975 26.5625 20.95 56-57 23.3875 27.462500000000002 27.450000000000003 21.7 58-59 24.2875 26.625 27.0875 22.0 60-61 23.6125 27.787499999999998 26.987499999999997 21.6125 62-63 23.8125 28.349999999999998 26.150000000000002 21.6875 64-65 23.8125 28.349999999999998 26.937499999999996 20.9 66-67 22.787499999999998 27.537499999999998 28.487499999999997 21.1875 68-69 23.2625 26.400000000000002 28.275 22.0625 70-71 23.0875 26.950000000000003 27.8125 22.15 72-73 23.4875 27.0625 27.762500000000003 21.6875 74-75 23.575 27.712500000000002 26.924999999999997 21.7875 76-77 23.502824858757062 28.336472065285623 26.4030131826742 21.757689893283114 78-79 24.5625 27.700000000000003 26.775 20.962500000000002 80-81 24.875 27.500000000000004 26.787499999999998 20.837500000000002 82-83 23.974999999999998 27.224999999999998 27.6875 21.1125 84-85 23.9 27.125 27.250000000000004 21.725 86-87 23.5625 27.1 27.800000000000004 21.5375 88-89 23.674999999999997 26.987499999999997 27.325 22.0125 90-91 23.025000000000002 27.8625 27.5125 21.6 92-93 24.0 27.325 26.9125 21.762500000000003 94-95 24.125 27.325 27.05 21.5 96-97 24.2875 26.6125 27.525 21.575 98-99 23.799999999999997 27.325 27.725 21.15 100-101 24.0125 27.725 26.825 21.4375 102-103 23.799999999999997 27.3875 27.950000000000003 20.8625 104-105 24.1125 27.1375 26.775 21.975 106-107 23.5625 26.5375 28.8625 21.0375 108-109 24.349999999999998 27.3625 27.187499999999996 21.099999999999998 110-111 23.5375 27.5125 27.762500000000003 21.1875 112-113 24.5625 26.687499999999996 26.5375 22.2125 114-115 24.075 27.537499999999998 27.450000000000003 20.9375 116-117 24.4875 27.6875 27.3375 20.4875 118-119 25.081270317579396 27.219304826206553 27.094273568392097 20.605151287821954 120-121 24.0 27.037499999999998 26.8125 22.15 122-123 24.2625 28.3375 26.237500000000004 21.1625 124-125 25.4 27.150000000000002 26.325 21.125 126 24.7 27.224999999999998 27.6 20.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.5 5 1.0 6 0.0 7 0.0 8 0.5 9 0.5 10 1.0 11 1.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 2.0 19 1.0 20 2.0 21 3.5 22 2.0 23 1.0 24 1.0 25 2.0 26 2.5 27 3.0 28 4.5 29 6.5 30 10.0 31 14.5 32 25.5 33 35.0 34 40.5 35 65.0 36 90.5 37 111.0 38 127.0 39 138.5 40 176.5 41 216.0 42 243.5 43 250.0 44 241.0 45 260.0 46 272.5 47 241.0 48 211.5 49 206.0 50 181.0 51 143.5 52 130.5 53 111.5 54 80.5 55 72.0 56 65.0 57 46.0 58 33.0 59 27.0 60 20.5 61 16.5 62 12.5 63 7.5 64 6.5 65 4.5 66 4.0 67 2.5 68 1.0 69 3.5 70 4.0 71 2.0 72 1.0 73 0.5 74 1.5 75 2.0 76 2.0 77 1.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 61.175000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.43750000000000006 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.025 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.55 #Duplication Level Percentage of deduplicated Percentage of total 1 97.92414146591491 95.525 2 1.922091235263967 3.75 3 0.05125576627370579 0.15 4 0.0 0.0 5 0.05125576627370579 0.25 6 0.025627883136852894 0.15 7 0.025627883136852894 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 32bp) NAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATG 6 0.15 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) NACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0125 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.025 0.0 0.025 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.025 0.0 0.025 0.0 0.0 80-81 0.05 0.0 0.025 0.0 0.0 82-83 0.05 0.0 0.025 0.0 0.0 84-85 0.0625 0.0 0.025 0.0 0.0 86-87 0.1 0.0 0.025 0.0 0.0 88-89 0.1125 0.0 0.025 0.0 0.0 90-91 0.15 0.0 0.025 0.0 0.0 92-93 0.1875 0.0 0.025 0.0 0.0 94-95 0.225 0.0 0.025 0.0 0.0 96-97 0.275 0.0 0.025 0.0 0.0 98-99 0.3 0.0 0.025 0.0 0.0 100-101 0.3 0.0 0.025 0.0 0.0 102-103 0.38749999999999996 0.0 0.025 0.0 0.0 104-105 0.5 0.0 0.025 0.0 0.0 106-107 0.6 0.0 0.025 0.0 0.0 108-109 0.7 0.0 0.025 0.0 0.0 110-111 0.7875000000000001 0.0 0.025 0.0 0.0 112-113 0.9 0.0 0.025 0.0 0.0 114 0.975 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522515 spots for SRR8424228.sra Written 3522515 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra Read 3522509 spots for SRR8424228.sra Written 3522509 spots for SRR8424228.sra SRR ids: ['SRR8424228.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v421imtx SRR8424228.sra spots: 70450186 blocks: [[1, 3522509], [3522510, 7045018], [7045019, 10567527], [10567528, 14090036], [14090037, 17612545], [17612546, 21135054], [21135055, 24657563], [24657564, 28180072], [28180073, 31702581], [31702582, 35225090], [35225091, 38747599], [38747600, 42270108], [42270109, 45792617], [45792618, 49315126], [49315127, 52837635], [52837636, 56360144], [56360145, 59882653], [59882654, 63405162], [63405163, 66927671], [66927672, 70450186]] SRR8424228 file size 20411605 SRR8424228 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8424228 SRR8424228_1.fastq SRR8424228_2.fastq Input file: SRR8424228_1.fastq Paired file: SRR8424228_2.fastq trimmed: SRR8424228-trimmed-pair1.fastq, SRR8424228-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 12:48:01 2025 >> started Tue Feb 11 12:49:09 2025 >> done (67.923s) 70450186 read pairs processed; of these: 129 ( 0.00%) short read pairs filtered out after trimming by size control 214424 ( 0.30%) empty read pairs filtered out after trimming by size control 70235633 (99.70%) read pairs available; of these: 2333080 ( 3.32%) trimmed read pairs available after processing 67902553 (96.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 118 0.00% 20 35 0.00% 21 50 0.00% 22 42 0.00% 23 45 0.00% 24 75 0.00% 25 71 0.00% 26 76 0.00% 27 100 0.00% 28 113 0.00% 29 122 0.00% 30 112 0.00% 31 134 0.00% 32 139 0.00% 33 138 0.00% 34 139 0.00% 35 167 0.00% 36 189 0.00% 37 180 0.00% 38 198 0.00% 39 196 0.00% 40 195 0.00% 41 260 0.00% 42 228 0.00% 43 279 0.00% 44 314 0.00% 45 278 0.00% 46 302 0.00% 47 353 0.00% 48 339 0.00% 49 342 0.00% 50 375 0.00% 51 397 0.00% 52 433 0.00% 53 518 0.00% 54 524 0.00% 55 547 0.00% 56 536 0.00% 57 612 0.00% 58 713 0.00% 59 682 0.00% 60 727 0.00% 61 819 0.00% 62 893 0.00% 63 971 0.00% 64 1024 0.00% 65 1098 0.00% 66 1180 0.00% 67 1231 0.00% 68 1397 0.00% 69 1489 0.00% 70 1636 0.00% 71 1898 0.00% 72 1826 0.00% 73 1884 0.00% 74 2079 0.00% 75 2251 0.00% 76 2558 0.00% 77 2788 0.00% 78 3105 0.00% 79 3431 0.00% 80 3891 0.01% 81 4157 0.01% 82 4428 0.01% 83 4813 0.01% 84 5127 0.01% 85 5795 0.01% 86 6473 0.01% 87 7275 0.01% 88 8204 0.01% 89 9500 0.01% 90 10456 0.01% 91 11456 0.02% 92 12313 0.02% 93 13271 0.02% 94 14186 0.02% 95 15902 0.02% 96 17378 0.02% 97 19007 0.03% 98 21423 0.03% 99 24075 0.03% 100 27472 0.04% 101 29866 0.04% 102 32108 0.05% 103 34918 0.05% 104 37112 0.05% 105 39143 0.06% 106 42280 0.06% 107 45919 0.07% 108 51111 0.07% 109 56560 0.08% 110 61771 0.09% 111 67761 0.10% 112 72111 0.10% 113 76273 0.11% 114 79492 0.11% 115 83944 0.12% 116 87217 0.12% 117 92757 0.13% 118 100515 0.14% 119 107194 0.15% 120 115894 0.17% 121 124085 0.18% 122 132104 0.19% 123 138968 0.20% 124 146121 0.21% 125 186287 0.27% 126 67902553 96.68% 70235633 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=21 prefix-density=0.67 prefix-fanout=2.0 sequence=GTTAGGGTAAGCTTTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=25.09 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.7 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.64 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=23.17 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA SRR8424228 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 12:50:00 Started mapping on | Feb 11 12:50:00 Finished on | Feb 11 12:55:00 Mapping speed, Million of reads per hour | 842.83 Number of input reads | 70235633 Average input read length | 251 UNIQUE READS: Uniquely mapped reads number | 64794711 Uniquely mapped reads % | 92.25% Average mapped length | 249.96 Number of splices: Total | 53116922 Number of splices: Annotated (sjdb) | 52362642 Number of splices: GT/AG | 52022924 Number of splices: GC/AG | 905726 Number of splices: AT/AC | 42696 Number of splices: Non-canonical | 145576 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.02% Deletion average length | 2.40 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1908882 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 1614770 % of reads mapped to too many loci | 2.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3532040 3532040 3532040 N_multimapping 1908882 1908882 1908882 N_noFeature 1711373 62925161 2982125 N_ambiguous 994941 10228 386978 UnstrandedReadsAssigned:62088397 PositiveStrandReadsAssigned:1859322 NegativeStrandReadsAssigned:61425608 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR8424228 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8424228-trimmed-pair1.fastq SRR8424228-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 70,235,633 reads, 62,988,520 reads pseudoaligned [quant] estimated average fragment length: 213.473 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,315 rounds 52401 SRR8424228.ke.tsv 34699 SRR8424228.se.tsv 87100 total ==> SRR8424228.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.53 1905 15.0323 Potri.005G024800.1.v4.1 1035 822.527 862 14.9311 Potri.004G059700.1.v4.1 961 748.532 17 0.323574 Potri.007G009000.2.v4.1 1416 1203.53 0 0 Potri.003G141000.2.v4.1 2943 2730.53 3409.84 17.7919 Potri.016G087400.1.v4.1 270 81.3469 1862.93 326.281 Potri.015G069301.1.v4.1 564 351.959 0 0 Potri.010G195200.1.v4.1 1773 1560.53 78 0.712129 Potri.012G127500.1.v4.1 977 764.532 994 18.5236 ==> SRR8424228.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1207 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 984 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 27 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 0 SRR8424228 completed mapping pipeline successfully