Starting /dee2/code/volunteer_pipeline.sh SRR8424229 current disk space = 3050420199424 free memory = 1573861904 SRR8424229 SRAfilesize 001c3de676700e228bc35822089f7be0 SRR8424229.sra SRR8424229.sra file validated SRR8424229 is paired end SRR8424229 is conventional basespace SRR8424229 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424229_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.15625 32.0 32.0 32.0 32.0 32.0 2 31.20375 32.0 32.0 32.0 32.0 32.0 3 34.66125 37.0 32.0 37.0 32.0 37.0 4 35.58625 37.0 37.0 37.0 32.0 37.0 5 35.78875 37.0 37.0 37.0 32.0 37.0 6 39.00875 41.0 37.0 41.0 32.0 41.0 7 39.079 41.0 41.0 41.0 37.0 41.0 8 39.15 41.0 41.0 41.0 37.0 41.0 9 39.17925 41.0 41.0 41.0 37.0 41.0 10-11 39.2885 41.0 41.0 41.0 37.0 41.0 12-13 39.225624999999994 41.0 41.0 41.0 37.0 41.0 14-15 39.361875 41.0 41.0 41.0 37.0 41.0 16-17 39.22325 41.0 41.0 41.0 37.0 41.0 18-19 39.03475 41.0 41.0 41.0 32.0 41.0 20-21 38.051625 41.0 39.0 41.0 32.0 41.0 22-23 39.113875 41.0 41.0 41.0 34.5 41.0 24-25 39.072125 41.0 41.0 41.0 34.5 41.0 26-27 39.01375 41.0 41.0 41.0 34.5 41.0 28-29 38.419624999999996 41.0 41.0 41.0 32.0 41.0 30-31 38.670500000000004 41.0 39.0 41.0 32.0 41.0 32-33 38.884625 41.0 41.0 41.0 34.5 41.0 34-35 38.80975 41.0 41.0 41.0 32.0 41.0 36-37 38.787125 41.0 41.0 41.0 32.0 41.0 38-39 39.062749999999994 41.0 41.0 41.0 37.0 41.0 40-41 38.80025 41.0 41.0 41.0 32.0 41.0 42-43 38.805 41.0 39.0 41.0 34.5 41.0 44-45 38.913875000000004 41.0 41.0 41.0 32.0 41.0 46-47 38.63525 41.0 39.0 41.0 32.0 41.0 48-49 38.8085 41.0 41.0 41.0 32.0 41.0 50-51 38.736625000000004 41.0 41.0 41.0 32.0 41.0 52-53 38.682500000000005 41.0 41.0 41.0 32.0 41.0 54-55 38.602625 41.0 39.0 41.0 32.0 41.0 56-57 38.756875 41.0 41.0 41.0 32.0 41.0 58-59 38.706875 41.0 41.0 41.0 32.0 41.0 60-61 38.458875 41.0 37.0 41.0 32.0 41.0 62-63 38.609875 41.0 39.0 41.0 32.0 41.0 64-65 38.464625 41.0 37.0 41.0 32.0 41.0 66-67 38.690375 41.0 41.0 41.0 32.0 41.0 68-69 38.657 41.0 39.0 41.0 32.0 41.0 70-71 38.594125000000005 41.0 39.0 41.0 32.0 41.0 72-73 38.548375 41.0 37.0 41.0 32.0 41.0 74-75 38.4465 41.0 37.0 41.0 32.0 41.0 76-77 37.900125 41.0 37.0 41.0 29.5 41.0 78-79 38.190125 41.0 37.0 41.0 32.0 41.0 80-81 38.38225 41.0 37.0 41.0 32.0 41.0 82-83 38.59275 41.0 41.0 41.0 32.0 41.0 84-85 38.565125 41.0 39.0 41.0 32.0 41.0 86-87 38.45525 41.0 37.0 41.0 32.0 41.0 88-89 38.41825 41.0 37.0 41.0 32.0 41.0 90-91 38.436 41.0 39.0 41.0 32.0 41.0 92-93 38.454375 41.0 39.0 41.0 32.0 41.0 94-95 38.39 41.0 37.0 41.0 32.0 41.0 96-97 38.284 41.0 39.0 41.0 32.0 41.0 98-99 38.106375 41.0 37.0 41.0 32.0 41.0 100-101 38.307500000000005 41.0 37.0 41.0 32.0 41.0 102-103 38.2325 41.0 37.0 41.0 32.0 41.0 104-105 38.034625 41.0 37.0 41.0 32.0 41.0 106-107 37.866125 41.0 37.0 41.0 32.0 41.0 108-109 37.964875 41.0 37.0 41.0 32.0 41.0 110-111 38.13475 41.0 37.0 41.0 32.0 41.0 112-113 38.021 41.0 37.0 41.0 32.0 41.0 114-115 37.844125 41.0 37.0 41.0 32.0 41.0 116-117 37.890125 41.0 37.0 41.0 32.0 41.0 118-119 37.963125 41.0 37.0 41.0 32.0 41.0 120-121 38.027125 41.0 37.0 41.0 32.0 41.0 122-123 37.902125 41.0 37.0 41.0 32.0 41.0 124-125 37.749125 41.0 37.0 41.0 29.5 41.0 126 36.1625 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 2.0 24 3.0 25 5.0 26 11.0 27 18.0 28 27.0 29 47.0 30 57.0 31 73.0 32 99.0 33 120.0 34 135.0 35 178.0 36 196.0 37 257.0 38 330.0 39 606.0 40 1833.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.60277427490542 11.172761664564943 14.754098360655737 39.470365699873895 2 25.275 16.025 31.275 27.425 3 25.0 22.825 23.200000000000003 28.975 4 26.200000000000003 31.825 19.25 22.725 5 24.474999999999998 35.199999999999996 21.325 19.0 6 18.75 36.675000000000004 24.224999999999998 20.349999999999998 7 13.5 26.0 40.425 20.075000000000003 8 17.825 24.65 31.95 25.575 9 16.825000000000003 21.099999999999998 34.2 27.875 10-11 20.4125 33.0875 23.45 23.05 12-13 20.125 26.1125 28.1125 25.650000000000002 14-15 20.825 27.3375 28.1 23.7375 16-17 20.5125 27.55 27.875 24.0625 18-19 19.7625 28.425 28.050000000000004 23.7625 20-21 21.118971061093248 28.012861736334404 26.636655948553056 24.231511254019292 22-23 19.9375 28.6875 27.2625 24.1125 24-25 19.8875 28.8625 27.55 23.7 26-27 21.4 27.725 27.325 23.549999999999997 28-29 20.729390907939724 27.997973914144612 27.263517791566414 24.009117386349246 30-31 20.1875 28.050000000000004 27.712500000000002 24.05 32-33 19.925 28.6125 27.224999999999998 24.2375 34-35 20.625 28.3625 27.175 23.8375 36-37 20.724999999999998 28.3125 27.1 23.8625 38-39 20.45 28.237499999999997 27.3625 23.95 40-41 21.462500000000002 28.875 26.6625 23.0 42-43 20.875 27.8875 27.2625 23.974999999999998 44-45 21.15 27.55 27.487499999999997 23.8125 46-47 20.6875 28.925 26.0125 24.375 48-49 20.837500000000002 29.099999999999998 26.25 23.8125 50-51 21.212500000000002 27.775 27.625 23.3875 52-53 21.15 28.449999999999996 27.1 23.3 54-55 19.8 28.6375 27.325 24.2375 56-57 20.0625 27.825 27.650000000000002 24.462500000000002 58-59 21.5625 27.8875 26.5875 23.962500000000002 60-61 21.075 27.975 26.75 24.2 62-63 21.05 27.150000000000002 27.3375 24.462500000000002 64-65 21.1375 28.537499999999998 26.8625 23.4625 66-67 21.15 27.962500000000002 25.900000000000002 24.9875 68-69 20.7125 27.325 27.725 24.2375 70-71 20.2375 27.525 27.275 24.962500000000002 72-73 20.599999999999998 27.9375 27.450000000000003 24.0125 74-75 20.7 27.750000000000004 27.725 23.825 76-77 20.4875 28.3125 27.187499999999996 24.0125 78-79 20.1875 27.787499999999998 26.924999999999997 25.1 80-81 21.075 28.1625 26.737499999999997 24.025 82-83 21.175 28.3375 26.4125 24.075 84-85 20.5625 28.725 27.0625 23.65 86-87 21.087500000000002 27.487499999999997 27.8125 23.6125 88-89 20.8 28.025 26.775 24.4 90-91 20.7375 27.474999999999998 27.0875 24.7 92-93 20.7625 27.5125 27.150000000000002 24.575 94-95 20.575 28.0625 27.0625 24.3 96-97 20.724999999999998 27.150000000000002 26.5875 25.5375 98-99 20.962500000000002 26.474999999999998 28.4125 24.15 100-101 21.9375 26.787499999999998 27.450000000000003 23.825 102-103 21.2625 27.175 26.9625 24.6 104-105 20.6875 28.3875 26.3125 24.6125 106-107 21.1125 27.05 28.075 23.7625 108-109 21.475 26.825 27.487499999999997 24.212500000000002 110-111 21.5375 27.762500000000003 26.7125 23.9875 112-113 21.7 28.462500000000002 25.662499999999998 24.175 114-115 20.825 28.7 26.525 23.95 116-117 21.212500000000002 27.212500000000002 27.1375 24.4375 118-119 20.925 27.825 26.8125 24.4375 120-121 21.0 26.7125 28.025 24.2625 122-123 21.1625 27.35 27.3625 24.125 124-125 23.075000000000003 27.1625 25.9625 23.799999999999997 126 21.3 27.85 26.650000000000002 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 3.0 22 3.0 23 0.5 24 2.5 25 4.0 26 4.0 27 6.0 28 8.0 29 13.5 30 17.5 31 17.0 32 33.0 33 43.5 34 45.5 35 56.5 36 79.0 37 98.5 38 108.5 39 139.5 40 175.0 41 199.5 42 231.5 43 239.5 44 235.5 45 244.5 46 254.0 47 254.5 48 230.0 49 204.5 50 179.5 51 144.5 52 120.0 53 112.0 54 97.0 55 76.5 56 67.5 57 60.0 58 43.5 59 31.5 60 23.0 61 17.0 62 15.5 63 10.0 64 6.5 65 7.0 66 4.0 67 1.0 68 2.5 69 5.5 70 4.0 71 2.0 72 2.5 73 2.0 74 2.5 75 2.0 76 1.0 77 0.5 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 2.8125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 1.2874999999999999 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83544303797468 97.6 2 1.0632911392405064 2.1 3 0.10126582278481014 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.7124999999999999 0.0 0.0 0.0 0.0 114 0.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCAAC 15 0.004010696 59.774998 118-119 >>END_MODULE SRR8424229 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424229_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 11.41625 2.0 2.0 32.0 2.0 32.0 2 30.2225 32.0 32.0 32.0 27.0 32.0 3 30.3175 32.0 32.0 32.0 12.0 37.0 4 32.61875 37.0 32.0 37.0 22.0 37.0 5 33.35875 37.0 32.0 37.0 27.0 37.0 6 35.9375 41.0 37.0 41.0 22.0 41.0 7 35.864 41.0 37.0 41.0 22.0 41.0 8 36.2415 41.0 37.0 41.0 27.0 41.0 9 36.76225 41.0 37.0 41.0 27.0 41.0 10-11 36.697375 41.0 37.0 41.0 27.0 41.0 12-13 36.755875 41.0 37.0 41.0 27.0 41.0 14-15 36.658874999999995 41.0 37.0 41.0 24.5 41.0 16-17 36.685 41.0 37.0 41.0 27.0 41.0 18-19 36.71875 41.0 37.0 41.0 27.0 41.0 20-21 36.584875 41.0 37.0 41.0 24.5 41.0 22-23 36.575874999999996 41.0 37.0 41.0 27.0 41.0 24-25 36.609125 41.0 37.0 41.0 27.0 41.0 26-27 35.621875 41.0 34.5 41.0 22.0 41.0 28-29 36.34225 41.0 37.0 41.0 22.0 41.0 30-31 36.22687500000001 41.0 37.0 41.0 22.0 41.0 32-33 36.584375 41.0 37.0 41.0 27.0 41.0 34-35 36.34425 41.0 37.0 41.0 24.5 41.0 36-37 36.299125000000004 41.0 37.0 41.0 22.0 41.0 38-39 35.704625 41.0 34.5 41.0 22.0 41.0 40-41 35.916624999999996 41.0 37.0 41.0 22.0 41.0 42-43 36.123000000000005 41.0 37.0 41.0 22.0 41.0 44-45 36.173 41.0 37.0 41.0 22.0 41.0 46-47 36.26375 41.0 37.0 41.0 22.0 41.0 48-49 36.21225 41.0 37.0 41.0 22.0 41.0 50-51 36.119 41.0 37.0 41.0 22.0 41.0 52-53 36.012874999999994 41.0 37.0 41.0 22.0 41.0 54-55 36.093125 41.0 37.0 41.0 24.5 41.0 56-57 36.066 41.0 37.0 41.0 22.0 41.0 58-59 36.15275 41.0 37.0 41.0 22.0 41.0 60-61 35.961625 41.0 32.0 41.0 22.0 41.0 62-63 35.809 41.0 32.0 41.0 22.0 41.0 64-65 35.889250000000004 41.0 34.5 41.0 22.0 41.0 66-67 35.73925 41.0 34.5 41.0 22.0 41.0 68-69 35.70025 41.0 32.0 41.0 22.0 41.0 70-71 35.725375 41.0 32.0 41.0 22.0 41.0 72-73 35.5775 41.0 32.0 41.0 22.0 41.0 74-75 35.669624999999996 41.0 32.0 41.0 22.0 41.0 76-77 34.524 39.0 29.5 41.0 22.0 41.0 78-79 34.566375 39.0 32.0 41.0 22.0 41.0 80-81 35.066375 41.0 32.0 41.0 22.0 41.0 82-83 35.064875 41.0 32.0 41.0 17.0 41.0 84-85 35.066625 41.0 32.0 41.0 17.0 41.0 86-87 34.865125000000006 41.0 32.0 41.0 17.0 41.0 88-89 35.446125 41.0 32.0 41.0 22.0 41.0 90-91 35.35125 41.0 32.0 41.0 22.0 41.0 92-93 35.298874999999995 41.0 32.0 41.0 17.0 41.0 94-95 34.46175 41.0 32.0 41.0 17.0 41.0 96-97 34.613 41.0 32.0 41.0 17.0 41.0 98-99 35.254875 41.0 32.0 41.0 22.0 41.0 100-101 34.942 41.0 32.0 41.0 17.0 41.0 102-103 35.514624999999995 41.0 32.0 41.0 22.0 41.0 104-105 35.39675 41.0 32.0 41.0 22.0 41.0 106-107 35.17275 41.0 32.0 41.0 22.0 41.0 108-109 34.96625 41.0 32.0 41.0 17.0 41.0 110-111 33.43025 37.0 27.0 41.0 12.0 41.0 112-113 34.468 39.0 32.0 41.0 17.0 41.0 114-115 34.083375000000004 39.0 32.0 41.0 12.0 41.0 116-117 34.541875000000005 39.0 32.0 41.0 17.0 41.0 118-119 32.929625 37.0 24.5 41.0 12.0 41.0 120-121 34.185249999999996 37.0 32.0 41.0 17.0 41.0 122-123 34.61775 37.0 32.0 41.0 22.0 41.0 124-125 34.24275 37.0 32.0 41.0 12.0 41.0 126 32.28175 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 7.0 18 12.0 19 21.0 20 33.0 21 38.0 22 47.0 23 60.0 24 56.0 25 57.0 26 88.0 27 80.0 28 98.0 29 97.0 30 142.0 31 118.0 32 162.0 33 168.0 34 191.0 35 220.0 36 233.0 37 315.0 38 420.0 39 726.0 40 609.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.96309963099631 18.37638376383764 18.081180811808117 33.579335793357934 2 26.700000000000003 26.6 28.725 17.974999999999998 3 25.224999999999998 30.975 26.424999999999997 17.375 4 27.05 34.325 20.65 17.974999999999998 5 26.224999999999998 36.475 21.7 15.6 6 18.85 39.050000000000004 23.775 18.325 7 21.875 17.525 39.875 20.724999999999998 8 21.975 24.3 30.075000000000003 23.65 9 23.95 22.25 29.349999999999998 24.45 10-11 24.1875 32.300000000000004 23.1 20.4125 12-13 23.5125 24.837500000000002 28.425 23.225 14-15 23.599999999999998 27.05 28.325 21.025 16-17 24.0 26.787499999999998 27.3 21.912499999999998 18-19 24.2375 27.0125 26.8 21.95 20-21 23.7125 27.35 27.1125 21.825 22-23 24.4375 27.775 26.8 20.9875 24-25 23.7375 27.5125 28.000000000000004 20.75 26-27 23.825 27.2625 26.937499999999996 21.975 28-29 24.7875 27.3625 27.025 20.825 30-31 24.087500000000002 27.075 27.1625 21.675 32-33 22.875 27.9375 27.1625 22.025 34-35 23.425 28.1875 27.575 20.8125 36-37 24.3125 27.55 27.0875 21.05 38-39 23.575 27.1625 27.962500000000002 21.3 40-41 24.725 28.1 26.237500000000004 20.9375 42-43 23.799999999999997 26.325 28.037499999999998 21.837500000000002 44-45 23.8625 26.6 28.762500000000003 20.775 46-47 23.599999999999998 28.0625 27.175 21.1625 48-49 24.175 26.775 27.725 21.325 50-51 24.825 27.35 26.275 21.55 52-53 23.925 28.025 26.950000000000003 21.099999999999998 54-55 24.15 27.250000000000004 27.1125 21.4875 56-57 23.225 27.0 27.525 22.25 58-59 23.8375 27.2625 26.687499999999996 22.2125 60-61 23.775 27.1 27.237499999999997 21.8875 62-63 23.875 26.9125 27.400000000000002 21.8125 64-65 24.675 26.525 27.725 21.075 66-67 24.125 27.1 27.275 21.5 68-69 24.2 27.6875 26.8 21.3125 70-71 23.825 27.474999999999998 27.950000000000003 20.75 72-73 24.375 27.1125 27.1375 21.375 74-75 24.2375 26.5625 27.500000000000004 21.7 76-77 24.224999999999998 27.075 27.4125 21.2875 78-79 24.762500000000003 27.725 26.9125 20.599999999999998 80-81 23.875 27.3625 27.025 21.7375 82-83 23.625 26.775 27.224999999999998 22.375 84-85 23.66116116116116 27.75275275275275 27.014514514514516 21.57157157157157 86-87 23.5 27.9375 26.6 21.9625 88-89 23.762251822065846 27.607439055038956 27.318421713998493 21.311887408896705 90-91 23.1375 27.750000000000004 26.9625 22.15 92-93 24.45 27.762500000000003 26.625 21.1625 94-95 22.5125 28.9375 27.237499999999997 21.3125 96-97 24.701295434536537 27.417934850962144 27.443088919632753 20.43768079486857 98-99 24.625 26.650000000000002 27.5625 21.1625 100-101 24.0 27.187499999999996 27.3125 21.5 102-103 23.9125 26.950000000000003 27.474999999999998 21.6625 104-105 24.325 27.450000000000003 26.987499999999997 21.2375 106-107 23.9125 27.3875 27.400000000000002 21.3 108-109 24.5125 27.237499999999997 27.575 20.674999999999997 110-111 24.275 27.125 27.0 21.6 112-113 24.2 26.7125 26.8625 22.225 114-115 23.663640948058497 27.09278870398386 27.634896621280884 21.608673726676752 116-117 23.6375 27.275 27.675 21.4125 118-119 24.087500000000002 27.3125 27.1125 21.4875 120-121 25.0 26.637499999999996 26.687499999999996 21.675 122-123 24.675 26.525 26.974999999999998 21.825 124-125 24.775 27.500000000000004 26.0375 21.6875 126 23.925 27.224999999999998 27.1 21.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 2.0 19 1.5 20 0.0 21 0.5 22 1.0 23 1.5 24 2.5 25 2.0 26 1.5 27 4.0 28 7.0 29 8.0 30 8.5 31 9.5 32 19.0 33 27.0 34 37.5 35 62.0 36 89.5 37 105.0 38 120.0 39 154.0 40 187.0 41 213.0 42 236.0 43 255.0 44 274.0 45 268.0 46 259.5 47 248.0 48 225.0 49 201.0 50 162.0 51 140.5 52 129.5 53 105.5 54 81.5 55 65.0 56 57.0 57 48.5 58 38.5 59 32.0 60 25.0 61 16.0 62 9.0 63 9.5 64 9.0 65 5.5 66 5.5 67 4.5 68 2.0 69 3.5 70 3.0 71 1.5 72 2.0 73 2.5 74 3.0 75 3.0 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 66.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.1 86-87 0.0 88-89 0.525 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.6125 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.8500000000000001 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1625 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.36250000000000004 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114 0.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225280 spots for SRR8424229.sra Written 4225280 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra Read 4225267 spots for SRR8424229.sra Written 4225267 spots for SRR8424229.sra SRR ids: ['SRR8424229.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_td8d257n SRR8424229.sra spots: 84505353 blocks: [[1, 4225267], [4225268, 8450534], [8450535, 12675801], [12675802, 16901068], [16901069, 21126335], [21126336, 25351602], [25351603, 29576869], [29576870, 33802136], [33802137, 38027403], [38027404, 42252670], [42252671, 46477937], [46477938, 50703204], [50703205, 54928471], [54928472, 59153738], [59153739, 63379005], [63379006, 67604272], [67604273, 71829539], [71829540, 76054806], [76054807, 80280073], [80280074, 84505353]] SRR8424229 file size 24488152 SRR8424229 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8424229 SRR8424229_1.fastq SRR8424229_2.fastq Input file: SRR8424229_1.fastq Paired file: SRR8424229_2.fastq trimmed: SRR8424229-trimmed-pair1.fastq, SRR8424229-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:48:13 2025 >> started Tue Feb 11 13:49:31 2025 >> done (78.111s) 84505353 read pairs processed; of these: 57 ( 0.00%) short read pairs filtered out after trimming by size control 47481 ( 0.06%) empty read pairs filtered out after trimming by size control 84457815 (99.94%) read pairs available; of these: 2539347 ( 3.01%) trimmed read pairs available after processing 81918468 (96.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 14 0.00% 20 24 0.00% 21 28 0.00% 22 22 0.00% 23 47 0.00% 24 49 0.00% 25 54 0.00% 26 74 0.00% 27 80 0.00% 28 92 0.00% 29 91 0.00% 30 103 0.00% 31 108 0.00% 32 106 0.00% 33 121 0.00% 34 121 0.00% 35 130 0.00% 36 149 0.00% 37 149 0.00% 38 157 0.00% 39 176 0.00% 40 156 0.00% 41 169 0.00% 42 197 0.00% 43 216 0.00% 44 236 0.00% 45 232 0.00% 46 256 0.00% 47 241 0.00% 48 254 0.00% 49 286 0.00% 50 252 0.00% 51 304 0.00% 52 345 0.00% 53 304 0.00% 54 317 0.00% 55 404 0.00% 56 399 0.00% 57 475 0.00% 58 435 0.00% 59 468 0.00% 60 512 0.00% 61 566 0.00% 62 549 0.00% 63 614 0.00% 64 696 0.00% 65 749 0.00% 66 740 0.00% 67 846 0.00% 68 895 0.00% 69 1004 0.00% 70 1102 0.00% 71 1249 0.00% 72 1234 0.00% 73 1366 0.00% 74 1444 0.00% 75 1599 0.00% 76 1813 0.00% 77 2007 0.00% 78 2201 0.00% 79 2561 0.00% 80 2776 0.00% 81 3004 0.00% 82 3267 0.00% 83 3618 0.00% 84 3971 0.00% 85 4469 0.01% 86 4982 0.01% 87 5790 0.01% 88 6579 0.01% 89 7625 0.01% 90 8364 0.01% 91 9322 0.01% 92 10462 0.01% 93 11116 0.01% 94 12216 0.01% 95 13247 0.02% 96 15204 0.02% 97 17304 0.02% 98 19118 0.02% 99 21819 0.03% 100 25125 0.03% 101 28058 0.03% 102 30501 0.04% 103 33419 0.04% 104 35248 0.04% 105 38620 0.05% 106 42212 0.05% 107 47318 0.06% 108 52576 0.06% 109 58900 0.07% 110 65664 0.08% 111 72519 0.09% 112 78723 0.09% 113 83637 0.10% 114 87877 0.10% 115 94114 0.11% 116 98913 0.12% 117 106889 0.13% 118 116286 0.14% 119 124133 0.15% 120 136641 0.16% 121 148503 0.18% 122 157428 0.19% 123 167980 0.20% 124 177229 0.21% 125 214980 0.25% 126 81918468 96.99% 84457815 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=24 prefix-density=0.46 prefix-fanout=2.0 sequence=GTTAGGGTAAGCTTTCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=39.79 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=2.3 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCTTG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=29 prefix-density=0.42 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=69.81 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.4 sequence=GAGAGGAGATAAGATATAGACACTTGTTATAGGCTATCTTGCACTGGCAGTGTAGTCTCCTATCAGCAAAAACAGAAAAAAGAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAACAATTGCATCTCCTGGCCGAGGTATTTTGGCCATGGATGAGTCTAACGCTACCTGTGGAAAACGTCTCGCCTCAATCGGGCTAGAGAACACCGAGGCTAACCGCCAGGCATACCGTACCCTTCTTGTGACAGTCCCTGGCCTTGGTGATTAC SRR8424229 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:51:26 Started mapping on | Feb 11 13:51:27 Finished on | Feb 11 13:59:53 Mapping speed, Million of reads per hour | 600.89 Number of input reads | 84457815 Average input read length | 239 UNIQUE READS: Uniquely mapped reads number | 72058437 Uniquely mapped reads % | 85.32% Average mapped length | 237.70 Number of splices: Total | 54122953 Number of splices: Annotated (sjdb) | 53342827 Number of splices: GT/AG | 53050564 Number of splices: GC/AG | 831230 Number of splices: AT/AC | 51472 Number of splices: Non-canonical | 189687 Mismatch rate per base, % | 0.60% Deletion rate per base | 0.02% Deletion average length | 2.37 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3232160 % of reads mapped to multiple loci | 3.83% Number of reads mapped to too many loci | 2843620 % of reads mapped to too many loci | 3.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.71% % of reads unmapped: other | 0.78% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 9167338 9167338 9167338 N_multimapping 3232160 3232160 3232160 N_noFeature 1876032 69931707 3507630 N_ambiguous 1091624 22165 575465 UnstrandedReadsAssigned:69090781 PositiveStrandReadsAssigned:2104565 NegativeStrandReadsAssigned:67975342 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR8424229 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8424229-trimmed-pair1.fastq SRR8424229-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 84,457,815 reads, 75,203,680 reads pseudoaligned [quant] estimated average fragment length: 195.102 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52401 SRR8424229.ke.tsv 34699 SRR8424229.se.tsv 87100 total ==> SRR8424229.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1823.9 4171 30.3339 Potri.005G024800.1.v4.1 1035 840.898 2245 35.4129 Potri.004G059700.1.v4.1 961 766.902 137 2.36957 Potri.007G009000.2.v4.1 1416 1221.9 3 0.0325668 Potri.003G141000.2.v4.1 2943 2748.9 2425.79 11.7053 Potri.016G087400.1.v4.1 270 91.8399 2714 391.983 Potri.015G069301.1.v4.1 564 370.06 0 0 Potri.010G195200.1.v4.1 1773 1578.9 190 1.5962 Potri.012G127500.1.v4.1 977 782.898 3430 58.1136 ==> SRR8424229.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 180 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 831 Potri.001G212900.v4.1 5784 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 98 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 8 SRR8424229 completed mapping pipeline successfully