Starting /dee2/code/volunteer_pipeline.sh SRR8424230 current disk space = 3050309263360 free memory = 1578551744 SRR8424230 SRAfilesize 8088caeb01f5fadc678dd6d96c66a8fc SRR8424230.sra SRR8424230.sra file validated SRR8424230 is paired end SRR8424230 is conventional basespace SRR8424230 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424230_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 17.82375 32.0 2.0 32.0 2.0 32.0 2 31.5525 32.0 32.0 32.0 32.0 32.0 3 33.60625 32.0 32.0 37.0 32.0 37.0 4 35.82375 37.0 37.0 37.0 32.0 37.0 5 36.225 37.0 37.0 37.0 37.0 37.0 6 39.5415 41.0 41.0 41.0 37.0 41.0 7 39.4695 41.0 41.0 41.0 37.0 41.0 8 39.74425 41.0 41.0 41.0 37.0 41.0 9 39.8335 41.0 41.0 41.0 37.0 41.0 10-11 39.847125000000005 41.0 41.0 41.0 37.0 41.0 12-13 39.8555 41.0 41.0 41.0 37.0 41.0 14-15 39.881 41.0 41.0 41.0 37.0 41.0 16-17 39.860749999999996 41.0 41.0 41.0 37.0 41.0 18-19 39.792249999999996 41.0 41.0 41.0 37.0 41.0 20-21 39.703125 41.0 41.0 41.0 37.0 41.0 22-23 39.684875 41.0 41.0 41.0 37.0 41.0 24-25 39.485875 41.0 41.0 41.0 37.0 41.0 26-27 39.375 41.0 41.0 41.0 37.0 41.0 28-29 39.443875 41.0 41.0 41.0 37.0 41.0 30-31 39.4445 41.0 41.0 41.0 37.0 41.0 32-33 39.5595 41.0 41.0 41.0 37.0 41.0 34-35 39.305375 41.0 41.0 41.0 37.0 41.0 36-37 39.265375 41.0 41.0 41.0 37.0 41.0 38-39 39.159625 41.0 41.0 41.0 37.0 41.0 40-41 39.083875 41.0 41.0 41.0 34.5 41.0 42-43 39.062875000000005 41.0 41.0 41.0 37.0 41.0 44-45 39.187125 41.0 41.0 41.0 37.0 41.0 46-47 39.155375 41.0 41.0 41.0 37.0 41.0 48-49 39.091750000000005 41.0 41.0 41.0 37.0 41.0 50-51 39.239125 41.0 41.0 41.0 37.0 41.0 52-53 39.170375 41.0 41.0 41.0 37.0 41.0 54-55 39.225375 41.0 41.0 41.0 37.0 41.0 56-57 39.184625 41.0 41.0 41.0 37.0 41.0 58-59 39.124125 41.0 41.0 41.0 37.0 41.0 60-61 39.110875 41.0 41.0 41.0 37.0 41.0 62-63 38.90025 41.0 41.0 41.0 32.0 41.0 64-65 39.119 41.0 41.0 41.0 37.0 41.0 66-67 39.095 41.0 41.0 41.0 37.0 41.0 68-69 39.006625 41.0 41.0 41.0 34.5 41.0 70-71 38.854375000000005 41.0 41.0 41.0 32.0 41.0 72-73 38.88975 41.0 41.0 41.0 32.0 41.0 74-75 38.892375 41.0 41.0 41.0 32.0 41.0 76-77 37.727875 41.0 39.0 41.0 29.5 41.0 78-79 38.171 41.0 37.0 41.0 32.0 41.0 80-81 38.83675 41.0 41.0 41.0 32.0 41.0 82-83 38.63075 41.0 41.0 41.0 32.0 41.0 84-85 38.64 41.0 41.0 41.0 32.0 41.0 86-87 38.60275 41.0 41.0 41.0 32.0 41.0 88-89 38.324124999999995 41.0 37.0 41.0 32.0 41.0 90-91 38.268375 41.0 37.0 41.0 32.0 41.0 92-93 38.163624999999996 41.0 37.0 41.0 32.0 41.0 94-95 38.138000000000005 41.0 37.0 41.0 32.0 41.0 96-97 37.945 41.0 37.0 41.0 29.5 41.0 98-99 37.72325 41.0 37.0 41.0 27.0 41.0 100-101 37.717875 41.0 37.0 41.0 29.5 41.0 102-103 37.665125 41.0 37.0 41.0 29.5 41.0 104-105 37.586875 41.0 37.0 41.0 29.5 41.0 106-107 37.448375 41.0 37.0 41.0 29.5 41.0 108-109 36.947625 41.0 37.0 41.0 27.0 41.0 110-111 36.858125 41.0 37.0 41.0 27.0 41.0 112-113 36.58925 41.0 37.0 41.0 27.0 41.0 114-115 36.462375 41.0 37.0 41.0 27.0 41.0 116-117 36.158249999999995 41.0 32.0 41.0 24.5 41.0 118-119 35.795249999999996 41.0 32.0 41.0 22.0 41.0 120-121 35.68825 41.0 32.0 41.0 22.0 41.0 122-123 34.991125 41.0 32.0 41.0 22.0 41.0 124-125 35.142875000000004 41.0 32.0 41.0 22.0 41.0 126 32.1935 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 2.0 24 10.0 25 10.0 26 15.0 27 30.0 28 28.0 29 28.0 30 65.0 31 70.0 32 98.0 33 107.0 34 103.0 35 172.0 36 237.0 37 285.0 38 486.0 39 650.0 40 1602.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.8104969809568 11.28657686948444 13.005109150023223 39.89781699953553 2 26.424999999999997 16.475 30.875000000000004 26.224999999999998 3 24.725 24.099999999999998 22.1 29.075 4 27.025 30.15 18.825 24.0 5 25.3 33.800000000000004 21.75 19.15 6 18.275 34.125 25.474999999999998 22.125 7 14.299999999999999 25.900000000000002 39.75 20.05 8 16.725 23.925 32.4 26.950000000000003 9 18.275 20.4 33.7 27.625 10-11 20.200000000000003 33.1625 23.775 22.8625 12-13 19.9375 27.05 28.1 24.9125 14-15 20.2125 27.375 28.712500000000002 23.7 16-17 21.087500000000002 27.1125 27.962500000000002 23.8375 18-19 20.5375 27.5875 27.6875 24.1875 20-21 21.05 27.0875 27.05 24.8125 22-23 20.075000000000003 27.787499999999998 26.8625 25.275 24-25 20.3625 27.712500000000002 27.750000000000004 24.175 26-27 20.2125 28.3625 27.224999999999998 24.2 28-29 20.6125 28.462500000000002 26.9125 24.0125 30-31 20.474999999999998 28.125 27.1625 24.2375 32-33 20.724999999999998 27.962500000000002 27.325 23.9875 34-35 21.4375 29.1125 26.900000000000002 22.55 36-37 21.05 28.212500000000002 27.1125 23.625 38-39 20.325 27.975 27.900000000000002 23.799999999999997 40-41 20.7375 28.4125 26.85 24.0 42-43 20.2375 29.7875 26.625 23.35 44-45 21.0375 28.4375 26.375 24.15 46-47 21.625 28.4 26.650000000000002 23.325000000000003 48-49 20.0875 28.212500000000002 27.5875 24.1125 50-51 21.4 28.725 26.150000000000002 23.724999999999998 52-53 20.674999999999997 27.725 28.299999999999997 23.3 54-55 20.4875 28.237499999999997 27.275 24.0 56-57 20.825 27.987499999999997 27.200000000000003 23.9875 58-59 20.4625 28.625 27.3125 23.599999999999998 60-61 21.2 28.0875 26.825 23.8875 62-63 21.2 27.8875 27.0625 23.849999999999998 64-65 21.075 28.512500000000003 26.724999999999998 23.6875 66-67 20.424999999999997 27.6875 27.575 24.3125 68-69 21.45 27.5625 26.787499999999998 24.2 70-71 21.275 28.1125 26.3 24.3125 72-73 20.5625 29.099999999999998 26.075 24.2625 74-75 21.125 28.225 26.6 24.05 76-77 20.45 27.85 28.5875 23.1125 78-79 20.837500000000002 27.650000000000002 26.950000000000003 24.5625 80-81 21.45 28.0625 27.1625 23.325000000000003 82-83 21.4125 28.9375 25.775 23.875 84-85 22.05 27.962500000000002 26.25 23.7375 86-87 21.6 27.537499999999998 26.637499999999996 24.224999999999998 88-89 20.9125 28.037499999999998 26.525 24.525 90-91 20.525 26.937499999999996 28.375 24.1625 92-93 20.9375 27.1375 27.900000000000002 24.025 94-95 22.125 28.1625 26.0125 23.7 96-97 20.65 27.5125 27.150000000000002 24.6875 98-99 20.5875 27.55 27.700000000000003 24.1625 100-101 21.3625 27.737499999999997 27.0625 23.8375 102-103 19.8375 29.299999999999997 26.575 24.2875 104-105 21.1625 27.35 27.6875 23.799999999999997 106-107 21.3875 27.287499999999998 28.299999999999997 23.025000000000002 108-109 20.8625 27.487499999999997 27.175 24.474999999999998 110-111 22.037499999999998 27.400000000000002 27.6125 22.95 112-113 21.525 27.450000000000003 26.7125 24.3125 114-115 19.950000000000003 26.9625 28.537499999999998 24.55 116-117 20.6125 26.875 27.625 24.887500000000003 118-119 21.125 28.1375 27.5125 23.225 120-121 20.5 27.35 27.3375 24.8125 122-123 21.9 28.449999999999996 26.0625 23.5875 124-125 21.375 27.9375 27.037499999999998 23.65 126 22.45 27.85 26.025 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 3.5 24 4.0 25 1.5 26 1.0 27 7.0 28 12.5 29 13.0 30 15.0 31 19.5 32 30.0 33 45.0 34 57.5 35 65.0 36 74.0 37 97.0 38 121.5 39 138.5 40 165.0 41 185.5 42 217.0 43 248.0 44 270.0 45 261.5 46 250.0 47 259.5 48 234.0 49 211.5 50 190.0 51 157.5 52 131.0 53 111.5 54 92.0 55 68.5 56 54.0 57 46.0 58 33.0 59 26.5 60 20.5 61 13.0 62 9.5 63 6.5 64 5.5 65 3.0 66 1.5 67 2.0 68 2.5 69 1.5 70 0.0 71 0.5 72 1.0 73 2.5 74 2.5 75 2.0 76 3.0 77 1.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 46.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 96.09679937548789 92.325 2 3.721051262034868 7.1499999999999995 3 0.18214936247723132 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.8375 0.0 0.0 0.0 0.0 114 1.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8424230 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8424230_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 45 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 14.295 2.0 2.0 32.0 2.0 32.0 2 31.1325 32.0 32.0 32.0 32.0 32.0 3 32.33375 32.0 32.0 37.0 32.0 37.0 4 35.13875 37.0 37.0 37.0 32.0 37.0 5 35.75375 37.0 37.0 37.0 32.0 37.0 6 38.62675 41.0 37.0 41.0 32.0 41.0 7 38.385 41.0 37.0 41.0 32.0 41.0 8 39.0185 41.0 41.0 41.0 37.0 41.0 9 39.487 41.0 41.0 41.0 37.0 41.0 10-11 39.008250000000004 41.0 41.0 41.0 34.5 41.0 12-13 39.092875 41.0 41.0 41.0 37.0 41.0 14-15 39.431 41.0 41.0 41.0 37.0 41.0 16-17 39.31625 41.0 41.0 41.0 37.0 41.0 18-19 39.085499999999996 41.0 41.0 41.0 37.0 41.0 20-21 39.141625 41.0 41.0 41.0 37.0 41.0 22-23 39.310125 41.0 41.0 41.0 37.0 41.0 24-25 39.2955 41.0 41.0 41.0 37.0 41.0 26-27 39.23425 41.0 41.0 41.0 37.0 41.0 28-29 38.887125 41.0 41.0 41.0 34.5 41.0 30-31 39.073750000000004 41.0 41.0 41.0 37.0 41.0 32-33 39.131125 41.0 41.0 41.0 37.0 41.0 34-35 39.072375 41.0 41.0 41.0 37.0 41.0 36-37 38.955125 41.0 41.0 41.0 34.5 41.0 38-39 38.973625 41.0 41.0 41.0 32.0 41.0 40-41 38.880250000000004 41.0 41.0 41.0 32.0 41.0 42-43 38.766625000000005 41.0 41.0 41.0 32.0 41.0 44-45 38.826125000000005 41.0 41.0 41.0 32.0 41.0 46-47 38.753375000000005 41.0 41.0 41.0 32.0 41.0 48-49 38.507625000000004 41.0 39.0 41.0 32.0 41.0 50-51 38.476124999999996 41.0 39.0 41.0 32.0 41.0 52-53 38.337125 41.0 37.0 41.0 32.0 41.0 54-55 38.30075 41.0 37.0 41.0 32.0 41.0 56-57 38.224125 41.0 37.0 41.0 32.0 41.0 58-59 38.049875 41.0 37.0 41.0 29.5 41.0 60-61 37.9745 41.0 37.0 41.0 32.0 41.0 62-63 37.84075 41.0 37.0 41.0 32.0 41.0 64-65 37.573375 41.0 37.0 41.0 27.0 41.0 66-67 37.446124999999995 41.0 37.0 41.0 27.0 41.0 68-69 37.424125000000004 41.0 37.0 41.0 27.0 41.0 70-71 37.244749999999996 41.0 37.0 41.0 27.0 41.0 72-73 37.162375 41.0 37.0 41.0 27.0 41.0 74-75 36.989625000000004 41.0 37.0 41.0 27.0 41.0 76-77 35.244749999999996 39.0 34.5 41.0 24.5 41.0 78-79 35.816874999999996 39.0 34.5 41.0 24.5 41.0 80-81 36.046875 41.0 37.0 41.0 24.5 41.0 82-83 36.469875 41.0 37.0 41.0 22.0 41.0 84-85 36.50425 41.0 37.0 41.0 27.0 41.0 86-87 36.091 41.0 34.5 41.0 22.0 41.0 88-89 35.83375 41.0 32.0 41.0 22.0 41.0 90-91 35.589124999999996 41.0 32.0 41.0 22.0 41.0 92-93 35.732 41.0 32.0 41.0 22.0 41.0 94-95 34.846375 41.0 32.0 41.0 22.0 41.0 96-97 34.454750000000004 41.0 32.0 41.0 17.0 41.0 98-99 34.112375 41.0 29.5 41.0 12.0 41.0 100-101 34.135374999999996 41.0 32.0 41.0 12.0 41.0 102-103 34.198125000000005 41.0 32.0 41.0 12.0 41.0 104-105 34.321 41.0 32.0 41.0 12.0 41.0 106-107 32.492374999999996 37.0 27.0 41.0 12.0 41.0 108-109 32.376125 37.0 27.0 41.0 12.0 41.0 110-111 32.805 37.0 27.0 41.0 12.0 41.0 112-113 32.525625 37.0 27.0 41.0 12.0 41.0 114-115 32.160250000000005 37.0 27.0 41.0 12.0 41.0 116-117 31.86225 37.0 27.0 41.0 12.0 41.0 118-119 32.051375 37.0 27.0 41.0 12.0 41.0 120-121 31.957749999999997 37.0 27.0 41.0 12.0 41.0 122-123 31.739375000000003 37.0 27.0 41.0 12.0 41.0 124-125 31.093125 34.5 24.5 41.0 12.0 41.0 126 27.175 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 5.0 19 5.0 20 10.0 21 7.0 22 18.0 23 23.0 24 34.0 25 41.0 26 32.0 27 60.0 28 80.0 29 95.0 30 120.0 31 138.0 32 161.0 33 203.0 34 201.0 35 255.0 36 257.0 37 287.0 38 375.0 39 708.0 40 884.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.15429917550059 19.49352179034158 16.607773851590103 32.744405182567725 2 26.3 28.249999999999996 28.475 16.975 3 23.95 31.474999999999998 26.3 18.275 4 26.125 35.55 21.275 17.05 5 27.800000000000004 37.075 20.75 14.374999999999998 6 20.549999999999997 38.4 22.6 18.45 7 21.075 17.25 40.575 21.099999999999998 8 23.25 22.125 29.125 25.5 9 23.200000000000003 23.5 28.925 24.375 10-11 24.837500000000002 32.300000000000004 23.1875 19.675 12-13 22.775000000000002 25.75 28.6375 22.8375 14-15 23.4625 26.8375 28.975 20.724999999999998 16-17 24.474999999999998 27.462500000000002 27.1375 20.925 18-19 23.0125 25.85 28.537499999999998 22.6 20-21 24.212500000000002 27.250000000000004 26.75 21.7875 22-23 24.65 28.5625 26.5375 20.25 24-25 23.5125 27.5625 27.6125 21.3125 26-27 22.8875 29.325000000000003 26.400000000000002 21.3875 28-29 24.9 26.0625 28.212500000000002 20.825 30-31 23.9375 27.900000000000002 26.950000000000003 21.212500000000002 32-33 23.5375 28.025 27.6875 20.75 34-35 24.6875 26.400000000000002 27.287499999999998 21.625 36-37 22.95 27.6625 27.712500000000002 21.675 38-39 24.1875 27.55 27.1 21.1625 40-41 24.65 26.700000000000003 27.224999999999998 21.425 42-43 23.5125 27.200000000000003 28.262500000000003 21.025 44-45 24.075 27.5125 26.625 21.7875 46-47 23.7125 27.8875 27.3 21.099999999999998 48-49 22.9625 28.012500000000003 28.849999999999998 20.175 50-51 23.8375 27.375 27.775 21.0125 52-53 23.025000000000002 27.075 27.212500000000002 22.6875 54-55 23.3625 27.35 28.037499999999998 21.25 56-57 23.8375 27.500000000000004 27.05 21.6125 58-59 24.4 26.625 27.712500000000002 21.2625 60-61 24.2 26.887499999999996 27.525 21.3875 62-63 22.725 27.762500000000003 27.900000000000002 21.6125 64-65 24.099999999999998 27.037499999999998 27.5125 21.349999999999998 66-67 23.799999999999997 27.85 27.287499999999998 21.0625 68-69 23.4125 27.9375 27.1125 21.5375 70-71 24.0 26.775 26.775 22.45 72-73 23.3125 27.3 26.7625 22.625 74-75 24.6875 27.1625 27.224999999999998 20.925 76-77 23.4875 27.825 26.650000000000002 22.037499999999998 78-79 24.625 26.6125 27.1 21.6625 80-81 23.4875 27.487499999999997 27.6 21.425 82-83 22.95 27.487499999999997 27.525 22.037499999999998 84-85 24.2 26.487500000000004 27.35 21.9625 86-87 24.9875 27.287499999999998 26.437500000000004 21.2875 88-89 24.0125 28.0875 26.687499999999996 21.212500000000002 90-91 23.474999999999998 27.0625 28.249999999999996 21.212500000000002 92-93 23.575 27.987499999999997 27.525 20.9125 94-95 23.575 26.7625 27.700000000000003 21.9625 96-97 23.1375 26.900000000000002 28.675 21.2875 98-99 24.925 26.687499999999996 27.212500000000002 21.175 100-101 24.65 26.85 27.712500000000002 20.7875 102-103 24.875 26.1625 28.4 20.5625 104-105 23.962500000000002 27.1375 27.537499999999998 21.3625 106-107 24.2375 27.525 26.637499999999996 21.6 108-109 23.7125 26.687499999999996 27.750000000000004 21.85 110-111 24.525 26.325 28.249999999999996 20.9 112-113 23.4125 27.3625 28.037499999999998 21.1875 114-115 24.474999999999998 27.275 27.150000000000002 21.099999999999998 116-117 23.625 27.462500000000002 26.900000000000002 22.0125 118-119 25.074999999999996 26.3125 27.3875 21.224999999999998 120-121 23.45 27.275 28.050000000000004 21.224999999999998 122-123 25.4375 27.175 26.75 20.6375 124-125 24.7375 27.35 26.5125 21.4 126 24.75 27.675 26.224999999999998 21.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.5 25 1.5 26 3.0 27 4.0 28 5.5 29 5.5 30 10.5 31 16.5 32 21.5 33 28.0 34 40.5 35 62.5 36 90.5 37 110.5 38 125.0 39 152.5 40 183.0 41 205.5 42 215.5 43 241.5 44 267.5 45 274.5 46 272.5 47 256.5 48 233.5 49 200.5 50 170.0 51 152.0 52 136.5 53 113.5 54 91.5 55 73.5 56 53.5 57 39.0 58 32.0 59 26.5 60 21.0 61 13.5 62 11.0 63 10.0 64 3.5 65 2.0 66 2.0 67 1.0 68 1.0 69 2.5 70 3.0 71 1.5 72 1.0 73 1.0 74 1.0 75 1.5 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 57.550000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.31551634665283 92.80000000000001 2 3.5806953814218994 6.9 3 0.10378827192527244 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.7749999999999999 0.0 0.0 0.0 0.0 114 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4776002 spots for SRR8424230.sra Written 4776002 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra Read 4775984 spots for SRR8424230.sra Written 4775984 spots for SRR8424230.sra SRR ids: ['SRR8424230.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_25rvaycu SRR8424230.sra spots: 95519698 blocks: [[1, 4775984], [4775985, 9551968], [9551969, 14327952], [14327953, 19103936], [19103937, 23879920], [23879921, 28655904], [28655905, 33431888], [33431889, 38207872], [38207873, 42983856], [42983857, 47759840], [47759841, 52535824], [52535825, 57311808], [57311809, 62087792], [62087793, 66863776], [66863777, 71639760], [71639761, 76415744], [76415745, 81191728], [81191729, 85967712], [85967713, 90743696], [90743697, 95519698]] SRR8424230 file size 27682743 SRR8424230 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8424230 SRR8424230_1.fastq SRR8424230_2.fastq Input file: SRR8424230_1.fastq Paired file: SRR8424230_2.fastq trimmed: SRR8424230-trimmed-pair1.fastq, SRR8424230-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:43:24 2025 >> started Tue Feb 11 13:44:56 2025 >> done (92.249s) 95519698 read pairs processed; of these: 112 ( 0.00%) short read pairs filtered out after trimming by size control 82691 ( 0.09%) empty read pairs filtered out after trimming by size control 95436895 (99.91%) read pairs available; of these: 10691925 (11.20%) trimmed read pairs available after processing 84744970 (88.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 33 0.00% 20 46 0.00% 21 54 0.00% 22 79 0.00% 23 79 0.00% 24 88 0.00% 25 96 0.00% 26 97 0.00% 27 122 0.00% 28 138 0.00% 29 103 0.00% 30 144 0.00% 31 186 0.00% 32 161 0.00% 33 153 0.00% 34 203 0.00% 35 175 0.00% 36 189 0.00% 37 202 0.00% 38 211 0.00% 39 200 0.00% 40 230 0.00% 41 249 0.00% 42 221 0.00% 43 253 0.00% 44 260 0.00% 45 235 0.00% 46 271 0.00% 47 285 0.00% 48 264 0.00% 49 342 0.00% 50 342 0.00% 51 357 0.00% 52 349 0.00% 53 391 0.00% 54 386 0.00% 55 405 0.00% 56 389 0.00% 57 449 0.00% 58 494 0.00% 59 444 0.00% 60 472 0.00% 61 525 0.00% 62 603 0.00% 63 593 0.00% 64 644 0.00% 65 731 0.00% 66 803 0.00% 67 798 0.00% 68 928 0.00% 69 992 0.00% 70 1024 0.00% 71 1246 0.00% 72 1189 0.00% 73 1321 0.00% 74 1402 0.00% 75 1603 0.00% 76 1782 0.00% 77 1976 0.00% 78 2268 0.00% 79 2488 0.00% 80 2896 0.00% 81 2979 0.00% 82 3297 0.00% 83 3723 0.00% 84 4135 0.00% 85 4598 0.00% 86 5309 0.01% 87 5896 0.01% 88 6819 0.01% 89 8124 0.01% 90 8832 0.01% 91 9987 0.01% 92 11016 0.01% 93 12103 0.01% 94 13185 0.01% 95 14603 0.02% 96 16523 0.02% 97 18520 0.02% 98 21079 0.02% 99 24092 0.03% 100 27563 0.03% 101 30501 0.03% 102 33902 0.04% 103 36443 0.04% 104 39310 0.04% 105 42431 0.04% 106 46841 0.05% 107 52382 0.05% 108 57815 0.06% 109 65017 0.07% 110 72035 0.08% 111 79378 0.08% 112 87758 0.09% 113 92325 0.10% 114 97929 0.10% 115 103398 0.11% 116 110935 0.12% 117 117352 0.12% 118 130448 0.14% 119 139944 0.15% 120 152138 0.16% 121 165731 0.17% 122 217436 0.23% 123 375455 0.39% 124 1053512 1.10% 125 7033447 7.37% 126 84744970 88.80% 95436895 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.59 prefix-fanout=2.0 sequence=GTTAGGGTAAGCTTTCTT criterion=fanout-score sequence-density=0.30 sequence-density-rank=9 fanout-score=7.39 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=4.5 sequence=CCAGCAGTGTCCCAGCCGTAGTCACCAGGGAACTCACCAGTCAAGTAGGATGGGGGCTCACCAGAGAACGGGCCCAAGTATTTAACACGGTCTGGTCCGTACCATGGGCTCCCGGAGGGAACAGGCTTGGTGGTTTTCCTCATGGAGACACGGCCATTGCCCATGATCTCAGAGGAGGAGGGGTTGAGCTTCACCGCCTTTCCGGCTAGCGAAGGGGACGAGAGGGCCATTGTTGCTGCTGCCATTG criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=26 prefix-density=0.56 prefix-fanout=2.0 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=13.09 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.3 sequence=ACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR8424230 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:45:38 Started mapping on | Feb 11 13:45:38 Finished on | Feb 11 13:54:16 Mapping speed, Million of reads per hour | 663.27 Number of input reads | 95436895 Average input read length | 251 UNIQUE READS: Uniquely mapped reads number | 87206702 Uniquely mapped reads % | 91.38% Average mapped length | 248.42 Number of splices: Total | 70263078 Number of splices: Annotated (sjdb) | 69269817 Number of splices: GT/AG | 68829860 Number of splices: GC/AG | 1176571 Number of splices: AT/AC | 54798 Number of splices: Non-canonical | 201849 Mismatch rate per base, % | 0.79% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.55 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2754199 % of reads mapped to multiple loci | 2.89% Number of reads mapped to too many loci | 2080402 % of reads mapped to too many loci | 2.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.06% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5475994 5475994 5475994 N_multimapping 2754199 2754199 2754199 N_noFeature 1999713 84788753 3751700 N_ambiguous 1194193 13097 516410 UnstrandedReadsAssigned:84012796 PositiveStrandReadsAssigned:2404852 NegativeStrandReadsAssigned:82938592 Dataset is classified negative stranded MeadianReadLen=126 20thPercentileLength=126 echo kmer=121 SRR8424230 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8424230-trimmed-pair1.fastq SRR8424230-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 95,436,895 reads, 85,643,937 reads pseudoaligned [quant] estimated average fragment length: 202.471 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,249 rounds 52401 SRR8424230.ke.tsv 34699 SRR8424230.se.tsv 87100 total ==> SRR8424230.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1816.53 3158 20.2926 Potri.005G024800.1.v4.1 1035 833.529 868 12.1553 Potri.004G059700.1.v4.1 961 759.538 166 2.55109 Potri.007G009000.2.v4.1 1416 1214.53 0 0 Potri.003G141000.2.v4.1 2943 2741.53 3225.62 13.7337 Potri.016G087400.1.v4.1 270 85.4186 2727 372.649 Potri.015G069301.1.v4.1 564 362.745 0 0 Potri.010G195200.1.v4.1 1773 1571.53 53 0.39366 Potri.012G127500.1.v4.1 977 775.538 1598 24.0514 ==> SRR8424230.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 733 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1200 Potri.001G212900.v4.1 83 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 27 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR8424230 completed mapping pipeline successfully