Starting /dee2/code/volunteer_pipeline.sh SRR8474560 current disk space = 3050293297152 free memory = 1500475176 SRR8474560 SRAfilesize 5b022171ddbd7b3159322e5bf2f21682 SRR8474560.sra SRR8474560.sra file validated SRR8474560 is paired end SRR8474560 is conventional basespace SRR8474560 read1 length is 93-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474560_1.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 93-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.805 6.0 6.0 6.0 6.0 6.0 4 5.95375 6.0 6.0 6.0 6.0 6.0 5 5.98875 6.0 6.0 6.0 6.0 6.0 6 9.926 10.0 10.0 10.0 10.0 10.0 7 9.86425 10.0 10.0 10.0 10.0 10.0 8 9.952 10.0 10.0 10.0 10.0 10.0 9 9.9065 10.0 10.0 10.0 10.0 10.0 10-14 9.962950000000001 10.0 10.0 10.0 10.0 10.0 15-19 9.9646 10.0 10.0 10.0 10.0 10.0 20-24 9.9553 10.0 10.0 10.0 10.0 10.0 25-29 9.96465 10.0 10.0 10.0 10.0 10.0 30-34 9.9321 10.0 10.0 10.0 10.0 10.0 35-39 9.9414 10.0 10.0 10.0 10.0 10.0 40-44 9.943650000000002 10.0 10.0 10.0 10.0 10.0 45-49 9.91805 10.0 10.0 10.0 10.0 10.0 50-54 9.94135 10.0 10.0 10.0 10.0 10.0 55-59 9.90485 10.0 10.0 10.0 10.0 10.0 60-64 9.920549999999999 10.0 10.0 10.0 10.0 10.0 65-69 9.9244 10.0 10.0 10.0 10.0 10.0 70-74 9.86025 10.0 10.0 10.0 10.0 10.0 75-79 9.84495 10.0 10.0 10.0 10.0 10.0 80-84 9.89485 10.0 10.0 10.0 10.0 10.0 85-89 9.891649999999998 10.0 10.0 10.0 10.0 10.0 90-94 9.901491420710354 10.0 10.0 10.0 10.0 10.0 95-99 9.838419209604803 10.0 10.0 10.0 10.0 10.0 100-104 9.863066635316628 10.0 10.0 10.0 10.0 10.0 105-109 9.847971494101648 10.0 10.0 10.0 10.0 10.0 110-114 9.880174707942992 10.0 10.0 10.0 10.0 10.0 115-119 9.86217829139469 10.0 10.0 10.0 10.0 10.0 120-124 9.855772239375746 10.0 10.0 10.0 10.0 10.0 125-129 9.828073341223474 10.0 10.0 10.0 10.0 10.0 130-134 9.755124358537984 10.0 10.0 10.0 10.0 10.0 135-139 9.769603315963423 10.0 10.0 10.0 10.0 10.0 140-144 9.692810747061584 10.0 10.0 10.0 10.0 10.0 145-149 9.61461540236987 10.0 10.0 10.0 9.2 10.0 150 9.642235609103079 10.0 10.0 10.0 10.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 8.0 9 3992.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.975 10.424999999999999 18.075 35.525 2 22.325 14.825 32.025 30.825000000000003 3 21.8 21.725 24.2 32.275 4 24.4 31.6 21.15 22.85 5 23.775 33.175 22.75 20.3 6 17.25 36.9 27.075 18.775 7 13.600000000000001 27.525 39.825 19.05 8 15.2 25.575 33.175 26.05 9 17.5 23.1 32.925 26.474999999999998 10-14 19.085 30.725 27.015 23.175 15-19 18.335 29.665000000000003 28.595 23.405 20-24 18.785 29.955 28.110000000000003 23.150000000000002 25-29 19.42 29.205 28.18 23.195 30-34 19.015 29.915000000000003 28.38 22.689999999999998 35-39 19.355 29.815 28.199999999999996 22.63 40-44 18.985 29.79 28.144999999999996 23.080000000000002 45-49 19.395 30.135 27.439999999999998 23.03 50-54 19.05 29.67 28.655 22.625 55-59 19.009999999999998 30.245 27.675 23.07 60-64 19.145 29.235 27.915 23.705000000000002 65-69 19.3 30.154999999999998 27.49 23.055 70-74 19.265 30.035 27.61 23.09 75-79 19.555 29.535 27.500000000000004 23.41 80-84 19.085 30.354999999999997 27.275 23.285 85-89 19.235 29.24 27.955000000000002 23.57 90-94 18.76687668766877 29.82298229822982 27.81278127812781 23.597359735973598 95-99 19.089544772386194 30.09004502251126 27.99899949974988 22.821410705352676 100-104 19.51268830249722 29.334748761500357 28.13163481953291 23.02092811646952 105-109 19.002570694087403 29.52185089974293 27.964010282776346 23.511568123393317 110-114 19.195372074677884 29.34525374704181 27.835919011306864 23.623455166973443 115-119 19.658998646820027 28.752368064952638 28.46549391069012 23.123139377537214 120-124 19.82797140303843 29.75871313672922 27.211796246648795 23.20151921358356 125-129 19.274677121771216 29.428044280442805 28.015452029520294 23.281826568265682 130-134 19.35135135135135 29.123123123123122 28.234234234234236 23.29129129129129 135-139 19.04287138584247 28.844715852442672 28.121884346959124 23.990528414755733 140-144 18.91699092088197 28.80025940337224 28.566796368352787 23.715953307392994 145-149 19.535008017103152 29.556386958845536 27.91956173169428 22.989043292357028 150 18.94243641231593 30.15394912985274 27.54350736278447 23.360107095046853 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 5.5 26 8.0 27 11.5 28 16.0 29 19.0 30 27.5 31 41.5 32 57.0 33 69.0 34 72.0 35 95.0 36 119.5 37 139.5 38 172.5 39 187.0 40 214.5 41 253.0 42 270.0 43 281.0 44 265.0 45 255.5 46 248.5 47 224.5 48 198.0 49 167.5 50 140.5 51 115.0 52 92.5 53 60.5 54 40.5 55 35.0 56 28.0 57 19.0 58 12.5 59 6.0 60 5.0 61 7.0 62 5.5 63 3.0 64 1.0 65 1.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 2.0 94-95 0.0 96-97 0.0 98-99 13.0 100-101 29.0 102-103 29.0 104-105 24.0 106-107 25.0 108-109 31.0 110-111 39.0 112-113 55.0 114-115 34.0 116-117 39.0 118-119 48.0 120-121 53.0 122-123 41.0 124-125 39.0 126-127 56.0 128-129 65.0 130-131 50.0 132-133 48.0 134-135 51.0 136-137 30.0 138-139 65.0 140-141 51.0 142-143 46.0 144-145 49.0 146-147 0.0 148-149 0.0 150-151 2988.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.3731570920183 96.75 2 1.5760040671072701 3.1 3 0.05083884087442806 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8474560 read2 length is 93-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474560_2.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 93-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.3975 6.0 6.0 6.0 1.0 6.0 4 5.82375 6.0 6.0 6.0 6.0 6.0 5 5.9175 6.0 6.0 6.0 6.0 6.0 6 9.6855 10.0 10.0 10.0 10.0 10.0 7 9.5705 10.0 10.0 10.0 10.0 10.0 8 9.8645 10.0 10.0 10.0 10.0 10.0 9 9.9075 10.0 10.0 10.0 10.0 10.0 10-14 9.912200000000002 10.0 10.0 10.0 10.0 10.0 15-19 9.92465 10.0 10.0 10.0 10.0 10.0 20-24 9.857 10.0 10.0 10.0 10.0 10.0 25-29 9.8973 10.0 10.0 10.0 10.0 10.0 30-34 9.9261 10.0 10.0 10.0 10.0 10.0 35-39 9.922250000000002 10.0 10.0 10.0 10.0 10.0 40-44 9.937949999999999 10.0 10.0 10.0 10.0 10.0 45-49 9.908649999999998 10.0 10.0 10.0 10.0 10.0 50-54 9.9055 10.0 10.0 10.0 10.0 10.0 55-59 9.907100000000002 10.0 10.0 10.0 10.0 10.0 60-64 9.88745 10.0 10.0 10.0 10.0 10.0 65-69 9.879000000000001 10.0 10.0 10.0 10.0 10.0 70-74 9.887150000000002 10.0 10.0 10.0 10.0 10.0 75-79 9.8132 10.0 10.0 10.0 10.0 10.0 80-84 9.82405 10.0 10.0 10.0 10.0 10.0 85-89 9.8756 10.0 10.0 10.0 10.0 10.0 90-94 9.822131865932967 10.0 10.0 10.0 10.0 10.0 95-99 9.85342671335668 10.0 10.0 10.0 10.0 10.0 100-104 9.80501250633461 10.0 10.0 10.0 10.0 10.0 105-109 9.782097241384143 10.0 10.0 10.0 10.0 10.0 110-114 9.71031044173894 10.0 10.0 10.0 10.0 10.0 115-119 9.57851212729282 10.0 10.0 10.0 9.2 10.0 120-124 9.542238162180563 10.0 10.0 10.0 7.6 10.0 125-129 9.598420808636488 10.0 10.0 10.0 9.2 10.0 130-134 9.566763598886642 10.0 10.0 10.0 9.2 10.0 135-139 9.427077322607563 10.0 10.0 10.0 6.8 10.0 140-144 9.2825767885071 10.0 10.0 10.0 6.0 10.0 145-149 9.190181947950954 10.0 10.0 10.0 6.0 10.0 150 9.177710843373495 10.0 10.0 10.0 6.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 49.0 9 3951.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.0 17.775 20.200000000000003 28.025 2 26.075 28.1 28.575 17.25 3 23.799999999999997 33.725 26.325 16.150000000000002 4 26.275 37.45 20.95 15.325 5 26.450000000000003 37.1 21.4 15.049999999999999 6 18.65 40.675 24.6 16.075 7 20.25 19.7 40.1 19.950000000000003 8 21.725 23.225 29.775000000000002 25.275 9 24.55 24.75 28.65 22.05 10-14 23.615 29.794999999999998 26.875 19.715 15-19 23.555 27.55 29.304999999999996 19.59 20-24 23.66 28.115000000000002 28.77 19.455 25-29 23.565 28.12 29.349999999999998 18.965 30-34 23.575 27.83 29.125 19.470000000000002 35-39 23.919999999999998 27.845 29.099999999999998 19.134999999999998 40-44 23.485 27.96 29.154999999999998 19.400000000000002 45-49 23.825 27.689999999999998 29.270000000000003 19.215 50-54 23.3 28.73 28.7 19.27 55-59 23.799999999999997 27.655 29.685 18.86 60-64 23.445 28.305000000000003 28.744999999999997 19.505 65-69 23.05 28.1 29.74 19.11 70-74 23.665 28.33 29.134999999999998 18.87 75-79 23.84 27.400000000000002 29.64 19.12 80-84 23.005 28.050000000000004 29.38 19.564999999999998 85-89 23.57 27.339999999999996 29.975 19.115 90-94 23.067306730673067 27.827782778277825 29.74797479747975 19.35693569356936 95-99 23.41670835417709 27.988994497248626 29.744872436218113 18.84942471235618 100-104 23.819634010716815 27.722171671216255 29.809928217571528 18.648266100495402 105-109 23.455012853470436 27.989717223650384 29.285347043701798 19.26992287917738 110-114 22.86615829608204 28.088351301603996 29.29266368656324 19.752826715750725 115-119 23.058186738836266 27.945872801082544 29.640054127198916 19.355886332882275 120-124 23.397006255585346 27.96023235031278 29.674932975871315 18.96782841823056 125-129 23.304889298892988 28.557426199261993 29.24930811808118 18.888376383763838 130-134 23.153153153153152 27.843843843843846 29.74774774774775 19.255255255255253 135-139 23.417248255234295 28.096959122632104 29.698404785643074 18.78738783649053 140-144 22.996108949416342 28.365758754863812 29.513618677042803 19.124513618677042 145-149 22.42116515232496 28.647781934794224 28.96846606092998 19.962586851950828 150 23.59437751004016 27.54350736278447 28.21285140562249 20.649263721552877 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 2.0 26 3.0 27 6.0 28 10.0 29 18.0 30 23.5 31 30.0 32 36.5 33 51.5 34 71.5 35 89.5 36 122.0 37 153.0 38 176.0 39 190.5 40 219.0 41 251.5 42 274.5 43 287.0 44 290.0 45 271.0 46 259.0 47 249.0 48 193.5 49 155.0 50 136.5 51 107.0 52 80.0 53 65.0 54 51.5 55 40.0 56 26.5 57 14.5 58 11.0 59 5.5 60 3.5 61 4.0 62 4.0 63 4.0 64 3.0 65 2.0 66 1.0 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 92-93 2.0 94-95 0.0 96-97 0.0 98-99 13.0 100-101 29.0 102-103 29.0 104-105 24.0 106-107 25.0 108-109 31.0 110-111 39.0 112-113 55.0 114-115 34.0 116-117 39.0 118-119 48.0 120-121 53.0 122-123 41.0 124-125 39.0 126-127 56.0 128-129 65.0 130-131 50.0 132-133 48.0 134-135 51.0 136-137 30.0 138-139 65.0 140-141 51.0 142-143 46.0 144-145 49.0 146-147 0.0 148-149 0.0 150-151 2988.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4759969519939 96.925 2 1.4478028956057911 2.85 3 0.0762001524003048 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259326 spots for SRR8474560.sra Written 1259326 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra Read 1259323 spots for SRR8474560.sra Written 1259323 spots for SRR8474560.sra SRR ids: ['SRR8474560.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q6mt8k8a SRR8474560.sra spots: 25186463 blocks: [[1, 1259323], [1259324, 2518646], [2518647, 3777969], [3777970, 5037292], [5037293, 6296615], [6296616, 7555938], [7555939, 8815261], [8815262, 10074584], [10074585, 11333907], [11333908, 12593230], [12593231, 13852553], [13852554, 15111876], [15111877, 16371199], [16371200, 17630522], [17630523, 18889845], [18889846, 20149168], [20149169, 21408491], [21408492, 22667814], [22667815, 23927137], [23927138, 25186463]] SRR8474560 file size 9100128 SRR8474560 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8474560 SRR8474560_1.fastq SRR8474560_2.fastq Input file: SRR8474560_1.fastq Paired file: SRR8474560_2.fastq trimmed: SRR8474560-trimmed-pair1.fastq, SRR8474560-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:58:32 2025 >> started Tue Feb 11 13:59:05 2025 >> done (32.752s) 25186463 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 341 ( 0.00%) empty read pairs filtered out after trimming by size control 25186120 (100.00%) read pairs available; of these: 1574651 ( 6.25%) trimmed read pairs available after processing 23611469 (93.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 0 0.00% 26 2 0.00% 27 0 0.00% 28 4 0.00% 29 2 0.00% 30 2 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 1 0.00% 35 0 0.00% 36 5 0.00% 37 3 0.00% 38 1 0.00% 39 3 0.00% 40 3 0.00% 41 3 0.00% 42 4 0.00% 43 6 0.00% 44 6 0.00% 45 3 0.00% 46 3 0.00% 47 7 0.00% 48 5 0.00% 49 3 0.00% 50 7 0.00% 51 4 0.00% 52 4 0.00% 53 1 0.00% 54 10 0.00% 55 2 0.00% 56 12 0.00% 57 4 0.00% 58 11 0.00% 59 12 0.00% 60 12 0.00% 61 10 0.00% 62 9 0.00% 63 8 0.00% 64 7 0.00% 65 10 0.00% 66 11 0.00% 67 12 0.00% 68 10 0.00% 69 12 0.00% 70 19 0.00% 71 15 0.00% 72 14 0.00% 73 18 0.00% 74 10 0.00% 75 21 0.00% 76 16 0.00% 77 11 0.00% 78 12 0.00% 79 15 0.00% 80 20 0.00% 81 16 0.00% 82 23 0.00% 83 19 0.00% 84 14 0.00% 85 23 0.00% 86 19 0.00% 87 24 0.00% 88 23 0.00% 89 28 0.00% 90 27 0.00% 91 32 0.00% 92 38 0.00% 93 47 0.00% 94 70 0.00% 95 72 0.00% 96 97 0.00% 97 97 0.00% 98 97 0.00% 99 18115 0.07% 100 19155 0.08% 101 19874 0.08% 102 20264 0.08% 103 21979 0.09% 104 23183 0.09% 105 24645 0.10% 106 26718 0.11% 107 27904 0.11% 108 29971 0.12% 109 31904 0.13% 110 32941 0.13% 111 33655 0.13% 112 34619 0.14% 113 35055 0.14% 114 36791 0.15% 115 38052 0.15% 116 39613 0.16% 117 42421 0.17% 118 44340 0.18% 119 46752 0.19% 120 48908 0.19% 121 49501 0.20% 122 50327 0.20% 123 51317 0.20% 124 52070 0.21% 125 53758 0.21% 126 56403 0.22% 127 58447 0.23% 128 61262 0.24% 129 63395 0.25% 130 66332 0.26% 131 68010 0.27% 132 68527 0.27% 133 67896 0.27% 134 68843 0.27% 135 70664 0.28% 136 71568 0.28% 137 3810 0.02% 138 75496 0.30% 139 79296 0.31% 140 81961 0.33% 141 84225 0.33% 142 88091 0.35% 143 90715 0.36% 144 96585 0.38% 145 137340 0.55% 146 90110 0.36% 147 106773 0.42% 148 197826 0.79% 149 1115244 4.43% 150 21262287 84.42% 25186120 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=12.53 fanout-score-rank=13 prefix-density=0.39 prefix-fanout=6.0 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=16 fanout-score=226.56 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=26.4 sequence=TCATCTTCATCA criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=30 prefix-density=0.27 prefix-fanout=2.0 sequence=CACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=10 fanout-score=233.23 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=30.3 sequence=TGATGAAGATGA SRR8474560 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Feb 11 14:15:19 Started mapping on | Feb 11 14:15:20 Finished on | Feb 11 14:21:12 Mapping speed, Million of reads per hour | 257.59 Number of input reads | 25186090 Average input read length | 275 UNIQUE READS: Uniquely mapped reads number | 19043396 Uniquely mapped reads % | 75.61% Average mapped length | 268.90 Number of splices: Total | 15740402 Number of splices: Annotated (sjdb) | 15331590 Number of splices: GT/AG | 15400219 Number of splices: GC/AG | 213393 Number of splices: AT/AC | 16499 Number of splices: Non-canonical | 110291 Mismatch rate per base, % | 1.61% Deletion rate per base | 0.09% Deletion average length | 2.89 Insertion rate per base | 0.06% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 810193 % of reads mapped to multiple loci | 3.22% Number of reads mapped to too many loci | 814622 % of reads mapped to too many loci | 3.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.78% % of reads unmapped: other | 2.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5332504 5332504 5332504 N_multimapping 810193 810193 810193 N_noFeature 648793 18781486 785692 N_ambiguous 405279 3777 277644 UnstrandedReadsAssigned:17989324 PositiveStrandReadsAssigned:258133 NegativeStrandReadsAssigned:17980060 Dataset is classified negative stranded MeadianReadLen=130 20thPercentileLength=122 echo kmer=117 SRR8474560 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8474560-trimmed-pair1.fastq SRR8474560-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,186,090 reads, 21,164,059 reads pseudoaligned [quant] estimated average fragment length: 164.66 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,223 rounds 52401 SRR8474560.ke.tsv 34699 SRR8474560.se.tsv 87100 total ==> SRR8474560.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1854.34 1064 31.7099 Potri.005G024800.1.v4.1 1035 871.34 785 49.788 Potri.004G059700.1.v4.1 961 797.353 15 1.03964 Potri.007G009000.2.v4.1 1416 1252.34 0 0 Potri.003G141000.2.v4.1 2943 2779.34 908.381 18.0621 Potri.016G087400.1.v4.1 270 111.856 1138.04 562.267 Potri.015G069301.1.v4.1 564 400.389 0 0 Potri.010G195200.1.v4.1 1773 1609.34 54 1.85434 Potri.012G127500.1.v4.1 977 813.345 8779 596.504 ==> SRR8474560.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 345 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 126 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 260 SRR8474560 completed mapping pipeline successfully