Starting /dee2/code/volunteer_pipeline.sh SRR8474562 current disk space = 3050298265600 free memory = 1421366596 SRR8474562 SRAfilesize 4d907082e48431d45d0f3452bf683aa3 SRR8474562.sra SRR8474562.sra file validated SRR8474562 is paired end SRR8474562 is conventional basespace SRR8474562 read1 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474562_1.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.80375 6.0 6.0 6.0 6.0 6.0 4 5.95 6.0 6.0 6.0 6.0 6.0 5 5.98875 6.0 6.0 6.0 6.0 6.0 6 9.924 10.0 10.0 10.0 10.0 10.0 7 9.8605 10.0 10.0 10.0 10.0 10.0 8 9.94575 10.0 10.0 10.0 10.0 10.0 9 9.91275 10.0 10.0 10.0 10.0 10.0 10-14 9.96345 10.0 10.0 10.0 10.0 10.0 15-19 9.966249999999999 10.0 10.0 10.0 10.0 10.0 20-24 9.95515 10.0 10.0 10.0 10.0 10.0 25-29 9.95505 10.0 10.0 10.0 10.0 10.0 30-34 9.9384 10.0 10.0 10.0 10.0 10.0 35-39 9.9512 10.0 10.0 10.0 10.0 10.0 40-44 9.94765 10.0 10.0 10.0 10.0 10.0 45-49 9.92885 10.0 10.0 10.0 10.0 10.0 50-54 9.942849999999998 10.0 10.0 10.0 10.0 10.0 55-59 9.902849999999999 10.0 10.0 10.0 10.0 10.0 60-64 9.928299999999998 10.0 10.0 10.0 10.0 10.0 65-69 9.9315 10.0 10.0 10.0 10.0 10.0 70-74 9.854500000000002 10.0 10.0 10.0 10.0 10.0 75-79 9.843250000000001 10.0 10.0 10.0 10.0 10.0 80-84 9.904700000000002 10.0 10.0 10.0 10.0 10.0 85-89 9.9017 10.0 10.0 10.0 10.0 10.0 90-94 9.911150000000001 10.0 10.0 10.0 10.0 10.0 95-99 9.84715 10.0 10.0 10.0 10.0 10.0 100-104 9.864807053873374 10.0 10.0 10.0 10.0 10.0 105-109 9.857803047393192 10.0 10.0 10.0 10.0 10.0 110-114 9.87695620018707 10.0 10.0 10.0 10.0 10.0 115-119 9.87613852083347 10.0 10.0 10.0 10.0 10.0 120-124 9.844045517382877 10.0 10.0 10.0 10.0 10.0 125-129 9.843411380461959 10.0 10.0 10.0 10.0 10.0 130-134 9.769876122365147 10.0 10.0 10.0 10.0 10.0 135-139 9.753137070903453 10.0 10.0 10.0 10.0 10.0 140-144 9.712495464154946 10.0 10.0 10.0 10.0 10.0 145-149 9.652304900038894 10.0 10.0 10.0 10.0 10.0 150 9.614150255288111 10.0 10.0 10.0 10.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 9.0 9 3991.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.7 10.95 16.35 36.0 2 25.95 14.025000000000002 29.075 30.95 3 22.425 22.425 22.975 32.175 4 25.45 29.475 21.075 24.0 5 25.35 32.9 22.025 19.725 6 18.525 36.449999999999996 24.25 20.775 7 13.350000000000001 29.049999999999997 39.1 18.5 8 15.024999999999999 26.424999999999997 33.825 24.725 9 17.349999999999998 23.25 34.375 25.025 10-14 18.91 31.735000000000003 27.084999999999997 22.27 15-19 19.175 30.209999999999997 27.845 22.770000000000003 20-24 19.145 30.455 27.97 22.43 25-29 18.765 30.175 28.28 22.78 30-34 19.115 30.005 28.235 22.645 35-39 19.314999999999998 30.03 28.1 22.555 40-44 19.384999999999998 29.74 27.605 23.27 45-49 18.67 29.75 28.48 23.1 50-54 19.12 29.794999999999998 27.689999999999998 23.395 55-59 19.16 29.945 27.389999999999997 23.505000000000003 60-64 18.81 30.425 27.900000000000002 22.865 65-69 18.759999999999998 29.82 28.294999999999998 23.125 70-74 18.805 29.82 27.99 23.385 75-79 19.115 29.475 28.4 23.01 80-84 18.945 30.305 27.975 22.775000000000002 85-89 18.66 30.064999999999998 28.15 23.125 90-94 19.005 29.75 27.99 23.255 95-99 18.95 29.885 28.055000000000003 23.11 100-104 18.85134111228974 29.84795676112542 27.994140526342377 23.30656160024246 105-109 19.33020279684194 28.83017699571701 27.96841942308685 23.871200784354198 110-114 18.82390711113489 29.129434426668094 28.68532291722404 23.361335544972977 115-119 18.89510722003657 29.05746107386269 28.553222142184296 23.494209563916442 120-124 18.78717874675137 29.321397632110884 28.40311868322264 23.488304937915103 125-129 18.70481744729968 28.41261162748314 28.66776016037908 24.214810764838102 130-134 18.628571428571426 29.085714285714285 28.57142857142857 23.714285714285715 135-139 19.324990014645188 28.52483024896818 28.651311409932102 23.498868326454534 140-144 19.02411899631612 28.734273997358727 28.65086536456523 23.590741641759923 145-149 19.45030175234494 28.81553115683851 27.797571438958773 23.936595651857775 150 19.65718453683443 28.665207877461707 29.35813274981765 22.319474835886215 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 3.0 26 5.0 27 9.5 28 14.5 29 21.5 30 32.5 31 43.0 32 55.5 33 64.5 34 76.5 35 104.5 36 127.0 37 158.5 38 187.0 39 206.5 40 223.0 41 239.0 42 249.5 43 255.0 44 271.0 45 263.0 46 255.0 47 236.5 48 195.0 49 169.5 50 138.5 51 101.0 52 76.5 53 54.0 54 39.5 55 29.0 56 24.0 57 20.5 58 15.5 59 10.5 60 5.5 61 5.0 62 4.0 63 2.0 64 0.0 65 0.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 10.0 100-101 31.0 102-103 31.0 104-105 33.0 106-107 34.0 108-109 72.0 110-111 51.0 112-113 51.0 114-115 45.0 116-117 62.0 118-119 56.0 120-121 63.0 122-123 67.0 124-125 73.0 126-127 56.0 128-129 56.0 130-131 59.0 132-133 64.0 134-135 59.0 136-137 41.0 138-139 46.0 140-141 68.0 142-143 56.0 144-145 74.0 146-147 0.0 148-149 0.0 150-151 2742.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.08868501529052 96.22500000000001 2 1.8858307849133535 3.6999999999999997 3 0.025484199796126403 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0125 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.0 0.025 0.0 0.0 0.0 94-95 0.0 0.025 0.0 0.0 0.0 96-97 0.0 0.025 0.0 0.0 0.0 98-99 0.0 0.025 0.0 0.0 0.0 100-101 0.0 0.025 0.0 0.0 0.0 102-103 0.0 0.025 0.0 0.0 0.0 104-105 0.0 0.025 0.0 0.0 0.0 106-107 0.0 0.025 0.0 0.0 0.0 108-109 0.0 0.025 0.0 0.0 0.0 110-111 0.0 0.025 0.0 0.0 0.0 112-113 0.0 0.025 0.0 0.0 0.0 114-115 0.0 0.025 0.0 0.0 0.0 116-117 0.0 0.025 0.0 0.0 0.0 118-119 0.0 0.025 0.0 0.0 0.0 120-121 0.0 0.025 0.0 0.0 0.0 122-123 0.0 0.025 0.0 0.0 0.0 124-125 0.0 0.025 0.0 0.0 0.0 126-127 0.0 0.025 0.0 0.0 0.0 128-129 0.0 0.025 0.0 0.0 0.0 130-131 0.0 0.025 0.0 0.0 0.0 132-133 0.0 0.025 0.0 0.0 0.0 134-135 0.0 0.025 0.0 0.0 0.0 136-137 0.0 0.025 0.0 0.0 0.0 138 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAGGT 10 0.008583067 134.3375 9 >>END_MODULE SRR8474562 read2 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474562_2.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.44 6.0 6.0 6.0 1.0 6.0 4 5.86125 6.0 6.0 6.0 6.0 6.0 5 5.9 6.0 6.0 6.0 6.0 6.0 6 9.68175 10.0 10.0 10.0 10.0 10.0 7 9.652 10.0 10.0 10.0 10.0 10.0 8 9.8975 10.0 10.0 10.0 10.0 10.0 9 9.91175 10.0 10.0 10.0 10.0 10.0 10-14 9.912749999999999 10.0 10.0 10.0 10.0 10.0 15-19 9.9241 10.0 10.0 10.0 10.0 10.0 20-24 9.8611 10.0 10.0 10.0 10.0 10.0 25-29 9.8908 10.0 10.0 10.0 10.0 10.0 30-34 9.9238 10.0 10.0 10.0 10.0 10.0 35-39 9.913349999999998 10.0 10.0 10.0 10.0 10.0 40-44 9.9272 10.0 10.0 10.0 10.0 10.0 45-49 9.90205 10.0 10.0 10.0 10.0 10.0 50-54 9.88925 10.0 10.0 10.0 10.0 10.0 55-59 9.905899999999999 10.0 10.0 10.0 10.0 10.0 60-64 9.8884 10.0 10.0 10.0 10.0 10.0 65-69 9.8941 10.0 10.0 10.0 10.0 10.0 70-74 9.882249999999999 10.0 10.0 10.0 10.0 10.0 75-79 9.8205 10.0 10.0 10.0 10.0 10.0 80-84 9.83715 10.0 10.0 10.0 10.0 10.0 85-89 9.879 10.0 10.0 10.0 10.0 10.0 90-94 9.82175 10.0 10.0 10.0 10.0 10.0 95-99 9.84795 10.0 10.0 10.0 10.0 10.0 100-104 9.78102482283429 10.0 10.0 10.0 10.0 10.0 105-109 9.768087024522199 10.0 10.0 10.0 10.0 10.0 110-114 9.711225732236471 10.0 10.0 10.0 10.0 10.0 115-119 9.540568207149935 10.0 10.0 10.0 8.4 10.0 120-124 9.536361158122357 10.0 10.0 10.0 7.6 10.0 125-129 9.588263303815083 10.0 10.0 10.0 9.2 10.0 130-134 9.558542341276768 10.0 10.0 10.0 8.4 10.0 135-139 9.44483784539851 10.0 10.0 10.0 6.8 10.0 140-144 9.323714724265901 10.0 10.0 10.0 6.0 10.0 145-149 9.216522057966573 10.0 10.0 10.0 6.0 10.0 150 9.152078774617069 10.0 10.0 10.0 6.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 46.0 9 3954.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.8 18.65 20.4 29.15 2 25.3 31.1 28.175 15.425 3 23.375 33.25 25.825 17.549999999999997 4 26.6 35.55 20.724999999999998 17.125 5 25.775 38.175 21.5 14.549999999999999 6 18.4 41.325 24.6 15.675 7 20.75 20.05 40.65 18.55 8 22.15 24.05 30.075000000000003 23.724999999999998 9 24.0 24.625 30.475 20.9 10-14 24.03 28.815 26.939999999999998 20.215 15-19 23.605 27.965 28.845 19.585 20-24 23.369999999999997 28.985 28.63 19.015 25-29 23.515 28.470000000000002 28.749999999999996 19.265 30-34 23.68 28.225 28.915000000000003 19.18 35-39 23.595 28.244999999999997 29.310000000000002 18.85 40-44 23.54 28.575 28.970000000000002 18.915000000000003 45-49 23.79 27.744999999999997 29.349999999999998 19.115 50-54 23.625 28.335 28.904999999999998 19.134999999999998 55-59 23.04 28.08 29.81 19.07 60-64 23.580000000000002 27.63 29.525000000000002 19.265 65-69 23.435 27.950000000000003 29.57 19.045 70-74 23.5 28.060000000000002 29.304999999999996 19.134999999999998 75-79 22.939999999999998 28.634999999999998 28.910000000000004 19.515 80-84 23.73 27.935 29.175 19.16 85-89 23.015 28.595 29.325000000000003 19.064999999999998 90-94 23.635 27.505000000000003 29.82 19.040000000000003 95-99 23.56 28.16 29.695 18.584999999999997 100-104 23.478304793655607 28.206293882911552 29.84795676112542 18.46744456230742 105-109 23.917642809226482 27.41627534960524 29.655812993446514 19.01026884772176 110-114 22.954679223072397 28.032532505752044 29.760821873829524 19.25196639734603 115-119 23.865462403723612 27.45054579708539 29.982822629799966 18.701169169391036 120-124 23.551833670228124 28.177880450476465 29.07305804215998 19.19722783713543 125-129 22.84186865925521 28.351861976793636 29.797703663203933 19.00856570074722 130-134 22.6984126984127 27.44126984126984 31.396825396825395 18.463492063492062 135-139 22.966316069764346 27.99227799227799 29.623219278391694 19.41818665956597 140-144 22.687148119830404 28.0461527768124 30.138319316049213 19.128379787307985 145-149 23.093143314185998 28.902784846942488 29.2372573256744 18.76681451319712 150 22.830051057622175 28.847556528081693 29.61342086068563 18.708971553610503 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 1.0 25 2.0 26 2.5 27 6.0 28 12.0 29 19.0 30 23.5 31 22.0 32 36.0 33 61.5 34 79.0 35 96.5 36 119.5 37 137.5 38 167.0 39 190.0 40 219.5 41 272.5 42 291.5 43 291.5 44 304.5 45 291.5 46 246.5 47 221.5 48 202.0 49 166.0 50 129.0 51 103.0 52 80.5 53 57.5 54 41.5 55 30.0 56 21.5 57 13.0 58 8.5 59 9.5 60 7.5 61 4.0 62 2.5 63 2.0 64 1.5 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 10.0 100-101 31.0 102-103 31.0 104-105 33.0 106-107 34.0 108-109 72.0 110-111 51.0 112-113 51.0 114-115 45.0 116-117 62.0 118-119 56.0 120-121 63.0 122-123 67.0 124-125 73.0 126-127 56.0 128-129 56.0 130-131 59.0 132-133 64.0 134-135 59.0 136-137 41.0 138-139 46.0 140-141 68.0 142-143 56.0 144-145 74.0 146-147 0.0 148-149 0.0 150-151 2742.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.0 #Duplication Level Percentage of deduplicated Percentage of total 1 97.98469387755102 96.025 2 1.9897959183673468 3.9 3 0.025510204081632654 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096168 spots for SRR8474562.sra Written 1096168 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra Read 1096156 spots for SRR8474562.sra Written 1096156 spots for SRR8474562.sra SRR ids: ['SRR8474562.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bt7v85we SRR8474562.sra spots: 21923132 blocks: [[1, 1096156], [1096157, 2192312], [2192313, 3288468], [3288469, 4384624], [4384625, 5480780], [5480781, 6576936], [6576937, 7673092], [7673093, 8769248], [8769249, 9865404], [9865405, 10961560], [10961561, 12057716], [12057717, 13153872], [13153873, 14250028], [14250029, 15346184], [15346185, 16442340], [16442341, 17538496], [17538497, 18634652], [18634653, 19730808], [19730809, 20826964], [20826965, 21923132]] SRR8474562 file size 7892085 SRR8474562 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8474562 SRR8474562_1.fastq SRR8474562_2.fastq Input file: SRR8474562_1.fastq Paired file: SRR8474562_2.fastq trimmed: SRR8474562-trimmed-pair1.fastq, SRR8474562-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:29:26 2025 >> started Tue Feb 11 13:30:06 2025 >> done (40.372s) 21923132 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 197 ( 0.00%) empty read pairs filtered out after trimming by size control 21922934 (100.00%) read pairs available; of these: 1449583 ( 6.61%) trimmed read pairs available after processing 20473351 (93.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 0 0.00% 26 2 0.00% 27 3 0.00% 28 2 0.00% 29 1 0.00% 30 0 0.00% 31 2 0.00% 32 0 0.00% 33 2 0.00% 34 3 0.00% 35 1 0.00% 36 2 0.00% 37 2 0.00% 38 4 0.00% 39 4 0.00% 40 2 0.00% 41 3 0.00% 42 4 0.00% 43 0 0.00% 44 6 0.00% 45 2 0.00% 46 2 0.00% 47 2 0.00% 48 9 0.00% 49 4 0.00% 50 5 0.00% 51 4 0.00% 52 3 0.00% 53 6 0.00% 54 7 0.00% 55 9 0.00% 56 6 0.00% 57 8 0.00% 58 4 0.00% 59 3 0.00% 60 11 0.00% 61 6 0.00% 62 6 0.00% 63 10 0.00% 64 11 0.00% 65 3 0.00% 66 7 0.00% 67 6 0.00% 68 8 0.00% 69 9 0.00% 70 6 0.00% 71 7 0.00% 72 5 0.00% 73 12 0.00% 74 14 0.00% 75 9 0.00% 76 12 0.00% 77 12 0.00% 78 15 0.00% 79 13 0.00% 80 7 0.00% 81 11 0.00% 82 13 0.00% 83 23 0.00% 84 15 0.00% 85 17 0.00% 86 25 0.00% 87 23 0.00% 88 20 0.00% 89 20 0.00% 90 27 0.00% 91 32 0.00% 92 37 0.00% 93 41 0.00% 94 77 0.00% 95 82 0.00% 96 92 0.00% 97 101 0.00% 98 101 0.00% 99 22141 0.10% 100 22714 0.10% 101 24083 0.11% 102 24450 0.11% 103 26092 0.12% 104 27550 0.13% 105 29176 0.13% 106 30723 0.14% 107 33346 0.15% 108 35626 0.16% 109 36990 0.17% 110 38747 0.18% 111 38743 0.18% 112 38742 0.18% 113 40517 0.18% 114 42715 0.19% 115 44289 0.20% 116 45308 0.21% 117 48622 0.22% 118 51150 0.23% 119 53549 0.24% 120 55406 0.25% 121 56444 0.26% 122 56573 0.26% 123 57505 0.26% 124 58138 0.27% 125 60828 0.28% 126 62865 0.29% 127 65353 0.30% 128 68541 0.31% 129 72020 0.33% 130 73602 0.34% 131 75394 0.34% 132 75063 0.34% 133 75485 0.34% 134 75548 0.34% 135 77512 0.35% 136 78065 0.36% 137 4599 0.02% 138 83182 0.38% 139 86227 0.39% 140 89285 0.41% 141 92177 0.42% 142 95696 0.44% 143 98063 0.45% 144 103145 0.47% 145 138062 0.63% 146 96668 0.44% 147 112099 0.51% 148 190828 0.87% 149 974657 4.45% 150 17857564 81.46% 21922934 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=31.13 fanout-score-rank=12 prefix-density=0.21 prefix-fanout=10.5 sequence=ATTCTTGATAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=535.35 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=36.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=64.59 fanout-score-rank=8 prefix-density=0.35 prefix-fanout=15.5 sequence=CCAAGGAAGTTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=506.73 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=31.5 sequence=AAGAAGAAGAAA SRR8474562 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:31:52 Started mapping on | Feb 11 13:31:52 Finished on | Feb 11 13:38:23 Mapping speed, Million of reads per hour | 201.85 Number of input reads | 21922934 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 17298662 Uniquely mapped reads % | 78.91% Average mapped length | 280.25 Number of splices: Total | 14930004 Number of splices: Annotated (sjdb) | 14564257 Number of splices: GT/AG | 14603780 Number of splices: GC/AG | 209184 Number of splices: AT/AC | 14176 Number of splices: Non-canonical | 102864 Mismatch rate per base, % | 1.59% Deletion rate per base | 0.09% Deletion average length | 2.91 Insertion rate per base | 0.06% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 828472 % of reads mapped to multiple loci | 3.78% Number of reads mapped to too many loci | 282508 % of reads mapped to too many loci | 1.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 15.12% % of reads unmapped: other | 0.91% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3795800 3795800 3795800 N_multimapping 828472 828472 828472 N_noFeature 487908 17091561 603217 N_ambiguous 333214 3574 239423 UnstrandedReadsAssigned:16477540 PositiveStrandReadsAssigned:203527 NegativeStrandReadsAssigned:16456022 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=133 echo kmer=129 SRR8474562 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8474562-trimmed-pair1.fastq SRR8474562-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,922,934 reads, 18,649,993 reads pseudoaligned [quant] estimated average fragment length: 167.951 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,076 rounds 52401 SRR8474562.ke.tsv 34699 SRR8474562.se.tsv 87100 total ==> SRR8474562.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1851.05 949 31.2978 Potri.005G024800.1.v4.1 1035 868.049 263 18.4959 Potri.004G059700.1.v4.1 961 794.054 102 7.8418 Potri.007G009000.2.v4.1 1416 1249.05 0 0 Potri.003G141000.2.v4.1 2943 2776.05 677 14.8877 Potri.016G087400.1.v4.1 270 108.387 1137.85 640.877 Potri.015G069301.1.v4.1 564 397.092 0 0 Potri.010G195200.1.v4.1 1773 1606.05 20 0.760215 Potri.012G127500.1.v4.1 977 810.049 8195 617.593 ==> SRR8474562.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 127 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 48 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR8474562 completed mapping pipeline successfully