Starting /dee2/code/volunteer_pipeline.sh SRR8474563 current disk space = 3050104860672 free memory = 1579150532 SRR8474563 SRAfilesize 5b23bacdd1ae2ebcb441eed14e5f5fa9 SRR8474563.sra SRR8474563.sra file validated SRR8474563 is paired end SRR8474563 is conventional basespace SRR8474563 read1 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474563_1.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.78625 6.0 6.0 6.0 6.0 6.0 4 5.9475 6.0 6.0 6.0 6.0 6.0 5 5.995 6.0 6.0 6.0 6.0 6.0 6 9.939 10.0 10.0 10.0 10.0 10.0 7 9.8385 10.0 10.0 10.0 10.0 10.0 8 9.945 10.0 10.0 10.0 10.0 10.0 9 9.9025 10.0 10.0 10.0 10.0 10.0 10-14 9.96535 10.0 10.0 10.0 10.0 10.0 15-19 9.965700000000002 10.0 10.0 10.0 10.0 10.0 20-24 9.9525 10.0 10.0 10.0 10.0 10.0 25-29 9.9626 10.0 10.0 10.0 10.0 10.0 30-34 9.93495 10.0 10.0 10.0 10.0 10.0 35-39 9.9506 10.0 10.0 10.0 10.0 10.0 40-44 9.950549999999998 10.0 10.0 10.0 10.0 10.0 45-49 9.9219 10.0 10.0 10.0 10.0 10.0 50-54 9.9319 10.0 10.0 10.0 10.0 10.0 55-59 9.8986 10.0 10.0 10.0 10.0 10.0 60-64 9.926449999999999 10.0 10.0 10.0 10.0 10.0 65-69 9.92595 10.0 10.0 10.0 10.0 10.0 70-74 9.846100000000002 10.0 10.0 10.0 10.0 10.0 75-79 9.840250000000001 10.0 10.0 10.0 10.0 10.0 80-84 9.894900000000002 10.0 10.0 10.0 10.0 10.0 85-89 9.88735 10.0 10.0 10.0 10.0 10.0 90-94 9.903949999999998 10.0 10.0 10.0 10.0 10.0 95-99 9.82765 10.0 10.0 10.0 10.0 10.0 100-104 9.851458251810389 10.0 10.0 10.0 10.0 10.0 105-109 9.83166993742332 10.0 10.0 10.0 10.0 10.0 110-114 9.880122263781825 10.0 10.0 10.0 10.0 10.0 115-119 9.872169732636962 10.0 10.0 10.0 10.0 10.0 120-124 9.835488791383138 10.0 10.0 10.0 10.0 10.0 125-129 9.824650164757985 10.0 10.0 10.0 10.0 10.0 130-134 9.767226679754042 10.0 10.0 10.0 10.0 10.0 135-139 9.770452323453876 10.0 10.0 10.0 10.0 10.0 140-144 9.671273697840313 10.0 10.0 10.0 10.0 10.0 145-149 9.633793300342598 10.0 10.0 10.0 9.2 10.0 150 9.624666920441568 10.0 10.0 10.0 10.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 9.0 9 3991.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.625 10.45 17.675 33.25 2 24.125 15.525 30.925000000000004 29.425 3 22.75 21.95 23.075000000000003 32.225 4 24.2 30.45 20.4 24.95 5 23.125 33.6 22.5 20.775 6 17.925 36.5 24.925 20.65 7 13.25 29.325000000000003 39.225 18.2 8 16.0 26.025 34.175 23.799999999999997 9 16.85 22.35 34.825 25.974999999999998 10-14 18.855 30.79 28.244999999999997 22.11 15-19 19.38 29.49 28.395 22.735 20-24 18.61 30.659999999999997 28.42 22.31 25-29 18.82 29.385 29.125 22.67 30-34 19.46 29.945 28.01 22.585 35-39 19.015 30.485 28.02 22.48 40-44 19.064999999999998 30.659999999999997 28.134999999999998 22.14 45-49 18.705 30.130000000000003 28.050000000000004 23.115 50-54 19.205 30.37 27.839999999999996 22.585 55-59 18.790000000000003 29.555 28.525 23.13 60-64 18.705 30.625000000000004 27.965 22.705000000000002 65-69 18.63 30.220000000000002 28.255000000000003 22.895 70-74 18.65 29.604999999999997 28.299999999999997 23.445 75-79 19.139999999999997 29.945 28.389999999999997 22.525000000000002 80-84 18.145 30.595 28.110000000000003 23.150000000000002 85-89 18.54 30.075000000000003 28.384999999999998 23.0 90-94 18.83 30.014999999999997 27.85 23.305 95-99 18.355 30.06 28.199999999999996 23.385 100-104 19.300911854103344 29.6403242147923 28.17629179331307 22.88247213779129 105-109 18.906380316930775 29.279608006672227 28.21622185154295 23.597789824854047 110-114 18.699713807441007 29.985420379070142 28.505858847669963 22.809006965818888 115-119 18.64539602574867 30.058774139378674 28.250769661349008 23.045060173523648 120-124 19.188950925653835 29.20952101087276 28.427857772553626 23.173670290919777 125-129 18.928460823784455 29.54475069681016 28.832455868689998 22.694332610715392 130-134 19.27569331158238 30.094616639477977 27.719412724306686 22.91027732463295 135-139 18.873375060182955 29.52747781828186 28.076208817662838 23.522938303872344 140-144 18.72729914281563 29.231439779166063 28.628505012349265 23.41275606566904 145-149 18.97206194959004 29.160340115396295 27.991193440631644 23.876404494382022 150 20.47963456414161 29.501332318233725 28.05481537875904 21.964217738865628 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 2.0 24 1.5 25 3.5 26 8.0 27 9.5 28 16.5 29 26.5 30 33.0 31 41.0 32 58.5 33 81.5 34 90.5 35 107.0 36 132.0 37 147.5 38 169.5 39 217.0 40 248.0 41 262.0 42 264.5 43 268.5 44 270.5 45 255.5 46 247.0 47 219.0 48 185.0 49 160.5 50 131.0 51 92.5 52 74.5 53 53.0 54 29.0 55 28.5 56 22.0 57 13.5 58 9.0 59 6.5 60 4.0 61 1.5 62 2.0 63 1.5 64 1.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 14.0 100-101 41.0 102-103 39.0 104-105 38.0 106-107 59.0 108-109 58.0 110-111 48.0 112-113 47.0 114-115 54.0 116-117 58.0 118-119 66.0 120-121 79.0 122-123 75.0 124-125 69.0 126-127 52.0 128-129 69.0 130-131 76.0 132-133 63.0 134-135 67.0 136-137 32.0 138-139 79.0 140-141 64.0 142-143 61.0 144-145 65.0 146-147 0.0 148-149 0.0 150-151 2627.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.42559674961909 96.89999999999999 2 1.5744032503809042 3.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAGCA 10 0.008266405 136.03749 9 >>END_MODULE SRR8474563 read2 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474563_2.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.28125 6.0 6.0 6.0 1.0 6.0 4 5.76875 6.0 6.0 6.0 6.0 6.0 5 5.8875 6.0 6.0 6.0 6.0 6.0 6 9.56975 10.0 10.0 10.0 10.0 10.0 7 9.55625 10.0 10.0 10.0 10.0 10.0 8 9.90975 10.0 10.0 10.0 10.0 10.0 9 9.9065 10.0 10.0 10.0 10.0 10.0 10-14 9.90375 10.0 10.0 10.0 10.0 10.0 15-19 9.916400000000001 10.0 10.0 10.0 10.0 10.0 20-24 9.840100000000001 10.0 10.0 10.0 10.0 10.0 25-29 9.883550000000001 10.0 10.0 10.0 10.0 10.0 30-34 9.912700000000001 10.0 10.0 10.0 10.0 10.0 35-39 9.913250000000001 10.0 10.0 10.0 10.0 10.0 40-44 9.9322 10.0 10.0 10.0 10.0 10.0 45-49 9.90865 10.0 10.0 10.0 10.0 10.0 50-54 9.882850000000001 10.0 10.0 10.0 10.0 10.0 55-59 9.895050000000001 10.0 10.0 10.0 10.0 10.0 60-64 9.8707 10.0 10.0 10.0 10.0 10.0 65-69 9.869049999999998 10.0 10.0 10.0 10.0 10.0 70-74 9.8823 10.0 10.0 10.0 10.0 10.0 75-79 9.8083 10.0 10.0 10.0 10.0 10.0 80-84 9.8039 10.0 10.0 10.0 10.0 10.0 85-89 9.8713 10.0 10.0 10.0 10.0 10.0 90-94 9.806450000000002 10.0 10.0 10.0 10.0 10.0 95-99 9.836250000000001 10.0 10.0 10.0 10.0 10.0 100-104 9.76223449842704 10.0 10.0 10.0 10.0 10.0 105-109 9.731421587086908 10.0 10.0 10.0 10.0 10.0 110-114 9.689849624130748 10.0 10.0 10.0 10.0 10.0 115-119 9.554268944929843 10.0 10.0 10.0 8.4 10.0 120-124 9.512674766429345 10.0 10.0 10.0 7.6 10.0 125-129 9.556850015279903 10.0 10.0 10.0 9.2 10.0 130-134 9.541226142224179 10.0 10.0 10.0 8.4 10.0 135-139 9.392222230186752 10.0 10.0 10.0 6.8 10.0 140-144 9.300931489575635 10.0 10.0 10.0 6.0 10.0 145-149 9.180006767330712 10.0 10.0 10.0 6.0 10.0 150 9.06395127521888 10.0 10.0 10.0 6.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 42.0 9 3958.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.85 18.075 20.375 28.7 2 25.35 30.0 28.749999999999996 15.9 3 23.225 35.0 24.975 16.8 4 27.075 35.525 21.025 16.375 5 26.05 36.975 22.575 14.399999999999999 6 19.35 39.925 24.875 15.85 7 20.175 19.175 42.275 18.375 8 20.225 24.099999999999998 32.300000000000004 23.375 9 24.8 23.25 29.299999999999997 22.650000000000002 10-14 24.185000000000002 29.304999999999996 26.540000000000003 19.97 15-19 23.494999999999997 28.15 29.330000000000002 19.025 20-24 23.7 28.275 29.304999999999996 18.72 25-29 23.43 28.804999999999996 28.715000000000003 19.05 30-34 23.235 28.499999999999996 29.365000000000002 18.9 35-39 23.625 28.110000000000003 29.29 18.975 40-44 23.775 28.105000000000004 29.385 18.735 45-49 22.99 28.46 29.555 18.995 50-54 23.255 28.475 29.625 18.645 55-59 23.22 28.42 29.580000000000002 18.78 60-64 23.555 27.97 29.81 18.665000000000003 65-69 23.405 27.77 29.78 19.045 70-74 23.465 27.175 30.28 19.08 75-79 23.14 27.725 30.345 18.790000000000003 80-84 23.27 28.26 29.770000000000003 18.7 85-89 22.985 27.985 30.185000000000002 18.845 90-94 23.465 28.015 29.765000000000004 18.755 95-99 22.205 28.93 30.3 18.565 100-104 23.383991894630192 28.58662613981763 29.574468085106382 18.454913880445794 105-109 23.488323603002502 27.94516263552961 30.071934945788158 18.494578815679734 110-114 22.787407527404287 28.878449160321836 29.423834980290515 18.91030833198337 115-119 22.815561153092638 28.35712286593899 30.394626364399663 18.43268961656871 120-124 23.208933294152217 28.045841904202174 29.726711724948572 19.018513076697033 125-129 23.177454320222978 28.35552802725302 29.54475069681016 18.922266955713845 130-134 22.805872756933116 27.9347471451876 30.009787928221858 19.249592169657422 135-139 22.807620881766283 29.114794690143754 29.582502235366942 18.495082192723018 140-144 22.359436292314395 28.032834519831468 29.885224466075837 19.722504721778293 145-149 22.031582143941694 29.403279684178564 28.92499240813848 19.64014576374127 150 22.19261515036163 29.04453749524172 29.996193376475066 18.76665397792158 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 2.5 25 5.0 26 6.0 27 4.5 28 11.0 29 19.5 30 23.5 31 34.5 32 50.5 33 62.5 34 75.0 35 95.5 36 119.0 37 164.0 38 194.5 39 217.0 40 247.5 41 279.5 42 292.5 43 275.0 44 277.0 45 258.0 46 235.5 47 209.5 48 181.0 49 162.5 50 137.0 51 99.5 52 71.0 53 58.5 54 39.0 55 26.5 56 19.5 57 14.0 58 9.5 59 7.5 60 3.5 61 3.5 62 2.5 63 0.5 64 0.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 14.0 100-101 41.0 102-103 39.0 104-105 38.0 106-107 59.0 108-109 58.0 110-111 48.0 112-113 47.0 114-115 54.0 116-117 58.0 118-119 66.0 120-121 79.0 122-123 75.0 124-125 69.0 126-127 52.0 128-129 69.0 130-131 76.0 132-133 63.0 134-135 67.0 136-137 32.0 138-139 79.0 140-141 64.0 142-143 61.0 144-145 65.0 146-147 0.0 148-149 0.0 150-151 2627.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.21792260692465 96.45 2 1.7311608961303464 3.4000000000000004 3 0.05091649694501018 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0125 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.0 0.0 0.0 0.025 0.0 90-91 0.0 0.0 0.0 0.025 0.0 92-93 0.0 0.0 0.0 0.025 0.0 94-95 0.0 0.0 0.0 0.025 0.0 96-97 0.0 0.0 0.0 0.025 0.0 98-99 0.0 0.0 0.0 0.025 0.0 100-101 0.0 0.0 0.0 0.025 0.0 102-103 0.0 0.0 0.0 0.025 0.0 104-105 0.0 0.0 0.0 0.025 0.0 106-107 0.0 0.0 0.0 0.025 0.0 108-109 0.0 0.0 0.0 0.025 0.0 110-111 0.0 0.0 0.0 0.025 0.0 112-113 0.0 0.0 0.0 0.025 0.0 114-115 0.0 0.0 0.0 0.025 0.0 116-117 0.0 0.0 0.0 0.025 0.0 118-119 0.0 0.0 0.0 0.025 0.0 120-121 0.0 0.0 0.0 0.025 0.0 122-123 0.0 0.0 0.0 0.025 0.0 124-125 0.0 0.0 0.0 0.025 0.0 126-127 0.0 0.0 0.0 0.025 0.0 128-129 0.0 0.0 0.0 0.025 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.0 0.0 0.0 0.025 0.0 136-137 0.0 0.0 0.0 0.025 0.0 138 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362324 spots for SRR8474563.sra Written 1362324 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra Read 1362308 spots for SRR8474563.sra Written 1362308 spots for SRR8474563.sra SRR ids: ['SRR8474563.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m2mgd_op SRR8474563.sra spots: 27246176 blocks: [[1, 1362308], [1362309, 2724616], [2724617, 4086924], [4086925, 5449232], [5449233, 6811540], [6811541, 8173848], [8173849, 9536156], [9536157, 10898464], [10898465, 12260772], [12260773, 13623080], [13623081, 14985388], [14985389, 16347696], [16347697, 17710004], [17710005, 19072312], [19072313, 20434620], [20434621, 21796928], [21796929, 23159236], [23159237, 24521544], [24521545, 25883852], [25883853, 27246176]] SRR8474563 file size 9805342 SRR8474563 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8474563 SRR8474563_1.fastq SRR8474563_2.fastq Input file: SRR8474563_1.fastq Paired file: SRR8474563_2.fastq trimmed: SRR8474563-trimmed-pair1.fastq, SRR8474563-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:40:14 2025 >> started Tue Feb 11 14:40:58 2025 >> done (44.119s) 27246176 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 311 ( 0.00%) empty read pairs filtered out after trimming by size control 27245862 (100.00%) read pairs available; of these: 1717582 ( 6.30%) trimmed read pairs available after processing 25528280 (93.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 23 3 0.00% 24 5 0.00% 25 1 0.00% 26 0 0.00% 27 4 0.00% 28 1 0.00% 29 0 0.00% 30 5 0.00% 31 4 0.00% 32 4 0.00% 33 4 0.00% 34 2 0.00% 35 4 0.00% 36 1 0.00% 37 1 0.00% 38 0 0.00% 39 4 0.00% 40 4 0.00% 41 5 0.00% 42 7 0.00% 43 7 0.00% 44 7 0.00% 45 4 0.00% 46 4 0.00% 47 2 0.00% 48 5 0.00% 49 6 0.00% 50 6 0.00% 51 8 0.00% 52 7 0.00% 53 7 0.00% 54 12 0.00% 55 14 0.00% 56 10 0.00% 57 6 0.00% 58 12 0.00% 59 7 0.00% 60 11 0.00% 61 9 0.00% 62 11 0.00% 63 10 0.00% 64 6 0.00% 65 14 0.00% 66 5 0.00% 67 15 0.00% 68 14 0.00% 69 18 0.00% 70 19 0.00% 71 13 0.00% 72 16 0.00% 73 19 0.00% 74 14 0.00% 75 13 0.00% 76 21 0.00% 77 19 0.00% 78 26 0.00% 79 16 0.00% 80 28 0.00% 81 25 0.00% 82 22 0.00% 83 26 0.00% 84 24 0.00% 85 26 0.00% 86 33 0.00% 87 42 0.00% 88 39 0.00% 89 37 0.00% 90 35 0.00% 91 42 0.00% 92 43 0.00% 93 75 0.00% 94 125 0.00% 95 131 0.00% 96 126 0.00% 97 143 0.00% 98 160 0.00% 99 31299 0.11% 100 32644 0.12% 101 33978 0.12% 102 33739 0.12% 103 35949 0.13% 104 37518 0.14% 105 39564 0.15% 106 42332 0.16% 107 45112 0.17% 108 47841 0.18% 109 49576 0.18% 110 51350 0.19% 111 51665 0.19% 112 52535 0.19% 113 52905 0.19% 114 55127 0.20% 115 57764 0.21% 116 58903 0.22% 117 62092 0.23% 118 65887 0.24% 119 68906 0.25% 120 71042 0.26% 121 72592 0.27% 122 72024 0.26% 123 72288 0.27% 124 73523 0.27% 125 75870 0.28% 126 78083 0.29% 127 82133 0.30% 128 84327 0.31% 129 89205 0.33% 130 91514 0.34% 131 93871 0.34% 132 93324 0.34% 133 92917 0.34% 134 93739 0.34% 135 94499 0.35% 136 95836 0.35% 137 5462 0.02% 138 100875 0.37% 139 105313 0.39% 140 108424 0.40% 141 112398 0.41% 142 115510 0.42% 143 118998 0.44% 144 123563 0.45% 145 167547 0.61% 146 116340 0.43% 147 133104 0.49% 148 226761 0.83% 149 1153110 4.23% 150 22223330 81.57% 27245862 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=34 prefix-density=0.26 prefix-fanout=1.9 sequence=TTAATTTACAGCAAATACTATATTAGACAAACATGGAGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=254.61 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=27.6 sequence=TCATCTTCATCA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=33 prefix-density=0.26 prefix-fanout=2.1 sequence=CACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=314.55 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=19.8 sequence=AAGAAGAAGAAG SRR8474563 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:42:28 Started mapping on | Feb 11 14:42:28 Finished on | Feb 11 14:47:24 Mapping speed, Million of reads per hour | 331.37 Number of input reads | 27245862 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 20352905 Uniquely mapped reads % | 74.70% Average mapped length | 278.95 Number of splices: Total | 17077083 Number of splices: Annotated (sjdb) | 16616743 Number of splices: GT/AG | 16704054 Number of splices: GC/AG | 232040 Number of splices: AT/AC | 17329 Number of splices: Non-canonical | 123660 Mismatch rate per base, % | 1.60% Deletion rate per base | 0.10% Deletion average length | 2.93 Insertion rate per base | 0.06% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 873289 % of reads mapped to multiple loci | 3.21% Number of reads mapped to too many loci | 267418 % of reads mapped to too many loci | 0.98% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 20.46% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6019668 6019668 6019668 N_multimapping 873289 873289 873289 N_noFeature 712060 20050427 886535 N_ambiguous 452192 5193 320332 UnstrandedReadsAssigned:19188653 PositiveStrandReadsAssigned:297285 NegativeStrandReadsAssigned:19146038 Dataset is classified negative stranded MeadianReadLen=142 20thPercentileLength=125 echo kmer=121 SRR8474563 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8474563-trimmed-pair1.fastq SRR8474563-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,245,862 reads, 23,069,835 reads pseudoaligned [quant] estimated average fragment length: 164.426 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52401 SRR8474563.ke.tsv 34699 SRR8474563.se.tsv 87100 total ==> SRR8474563.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1854.57 2009 56.1083 Potri.005G024800.1.v4.1 1035 871.574 2016 119.806 Potri.004G059700.1.v4.1 961 797.574 29 1.88329 Potri.007G009000.2.v4.1 1416 1252.57 0 0 Potri.003G141000.2.v4.1 2943 2779.57 1018.41 18.9773 Potri.016G087400.1.v4.1 270 111.81 1232.6 570.995 Potri.015G069301.1.v4.1 564 400.631 0 0 Potri.010G195200.1.v4.1 1773 1609.57 94 3.02488 Potri.012G127500.1.v4.1 977 813.574 10628 676.621 ==> SRR8474563.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 344 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 109 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 413 SRR8474563 completed mapping pipeline successfully