Starting /dee2/code/volunteer_pipeline.sh SRR8474564 current disk space = 3050275323904 free memory = 1417830168 SRR8474564 SRAfilesize 42d4c1898a9fd41baf94a6be5a1a4f72 SRR8474564.sra SRR8474564.sra file validated SRR8474564 is paired end SRR8474564 is conventional basespace SRR8474564 read1 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474564_1.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.82875 6.0 6.0 6.0 6.0 6.0 4 5.97375 6.0 6.0 6.0 6.0 6.0 5 5.995 6.0 6.0 6.0 6.0 6.0 6 9.92 10.0 10.0 10.0 10.0 10.0 7 9.87575 10.0 10.0 10.0 10.0 10.0 8 9.96025 10.0 10.0 10.0 10.0 10.0 9 9.9055 10.0 10.0 10.0 10.0 10.0 10-14 9.9661 10.0 10.0 10.0 10.0 10.0 15-19 9.96745 10.0 10.0 10.0 10.0 10.0 20-24 9.95025 10.0 10.0 10.0 10.0 10.0 25-29 9.96125 10.0 10.0 10.0 10.0 10.0 30-34 9.94195 10.0 10.0 10.0 10.0 10.0 35-39 9.951550000000001 10.0 10.0 10.0 10.0 10.0 40-44 9.951649999999999 10.0 10.0 10.0 10.0 10.0 45-49 9.933499999999999 10.0 10.0 10.0 10.0 10.0 50-54 9.941750000000003 10.0 10.0 10.0 10.0 10.0 55-59 9.91365 10.0 10.0 10.0 10.0 10.0 60-64 9.92455 10.0 10.0 10.0 10.0 10.0 65-69 9.91765 10.0 10.0 10.0 10.0 10.0 70-74 9.8612 10.0 10.0 10.0 10.0 10.0 75-79 9.84045 10.0 10.0 10.0 10.0 10.0 80-84 9.89875 10.0 10.0 10.0 10.0 10.0 85-89 9.889349999999999 10.0 10.0 10.0 10.0 10.0 90-94 9.8991 10.0 10.0 10.0 10.0 10.0 95-99 9.840050000000002 10.0 10.0 10.0 10.0 10.0 100-104 9.865764193777844 10.0 10.0 10.0 10.0 10.0 105-109 9.858166362166195 10.0 10.0 10.0 10.0 10.0 110-114 9.886557087938893 10.0 10.0 10.0 10.0 10.0 115-119 9.869993402269255 10.0 10.0 10.0 10.0 10.0 120-124 9.856199376483588 10.0 10.0 10.0 10.0 10.0 125-129 9.841519237008171 10.0 10.0 10.0 10.0 10.0 130-134 9.775389391462177 10.0 10.0 10.0 10.0 10.0 135-139 9.76062932964799 10.0 10.0 10.0 10.0 10.0 140-144 9.692066486294305 10.0 10.0 10.0 10.0 10.0 145-149 9.647440992015111 10.0 10.0 10.0 9.2 10.0 150 9.629213483146067 10.0 10.0 10.0 10.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 9.0 9 3991.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.075 11.125 16.275000000000002 35.525 2 24.25 15.4 30.025000000000002 30.325000000000003 3 21.725 21.65 24.25 32.375 4 24.25 30.725 20.65 24.375 5 23.225 33.074999999999996 23.225 20.474999999999998 6 16.650000000000002 36.875 25.825 20.65 7 11.85 28.775000000000002 39.975 19.400000000000002 8 16.025 26.125 33.2 24.65 9 17.075000000000003 22.975 34.849999999999994 25.1 10-14 18.75 31.009999999999998 27.79 22.45 15-19 19.08 29.34 28.449999999999996 23.13 20-24 18.905 29.330000000000002 28.63 23.135 25-29 18.32 29.845 28.544999999999998 23.29 30-34 18.68 30.165 28.155 23.0 35-39 18.69 29.64 28.13 23.54 40-44 19.005 29.830000000000002 27.865000000000002 23.3 45-49 18.990000000000002 29.195 28.335 23.48 50-54 18.86 30.035 27.500000000000004 23.605 55-59 18.9 29.654999999999998 27.63 23.815 60-64 18.775 29.515 28.455000000000002 23.255 65-69 18.75 29.62 28.050000000000004 23.580000000000002 70-74 19.400000000000002 29.315 28.155 23.13 75-79 18.855 29.865000000000002 28.199999999999996 23.080000000000002 80-84 18.89 29.725 27.595 23.79 85-89 19.375 29.99 27.589999999999996 23.044999999999998 90-94 19.145 29.93 27.855 23.07 95-99 19.07 29.87 28.044999999999998 23.015 100-104 19.219462747085654 29.50836289913837 27.861125190065888 23.411049163710086 105-109 19.120319883678665 28.841460248221424 28.633743573765386 23.40447629433453 110-114 18.9572192513369 29.13368983957219 28.449197860962567 23.45989304812834 115-119 19.131396957123098 29.836791147994468 27.84508990318119 23.186721991701244 120-124 19.40186267137155 29.426736854283565 27.807022618152367 23.364377856192515 125-129 18.723250346615227 29.314606064259447 28.277774428838388 23.684369160286938 130-134 19.321926489226872 28.65019011406844 27.896070975918885 24.131812420785806 135-139 19.11784243390461 29.586820778530626 28.13870067756078 23.156636110003987 140-144 19.014182424916573 29.35205784204672 27.940767519466075 23.692992213570633 145-149 18.625821833682537 29.246441731088797 28.162705006863664 23.965031428365002 150 18.7749184487133 28.959768031895617 29.793403407031533 22.47191011235955 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 1.0 24 3.0 25 3.5 26 5.5 27 10.5 28 16.5 29 21.5 30 29.0 31 40.5 32 54.5 33 64.5 34 80.5 35 100.0 36 122.5 37 143.5 38 161.5 39 195.5 40 226.5 41 241.5 42 247.5 43 252.5 44 271.0 45 284.5 46 263.5 47 225.5 48 191.0 49 178.5 50 148.5 51 109.5 52 89.5 53 64.0 54 43.0 55 28.5 56 20.5 57 15.0 58 9.0 59 7.0 60 5.5 61 5.5 62 6.0 63 2.5 64 1.0 65 1.5 66 1.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 20.0 100-101 35.0 102-103 28.0 104-105 39.0 106-107 48.0 108-109 45.0 110-111 38.0 112-113 57.0 114-115 50.0 116-117 49.0 118-119 70.0 120-121 67.0 122-123 54.0 124-125 57.0 126-127 53.0 128-129 66.0 130-131 73.0 132-133 63.0 134-135 53.0 136-137 36.0 138-139 70.0 140-141 54.0 142-143 46.0 144-145 70.0 146-147 0.0 148-149 0.0 150-151 2759.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.14060112073358 96.325 2 1.8339276617422313 3.5999999999999996 3 0.025471217524197655 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCAGC 10 0.008334899 135.6625 1 AATAGCA 10 0.008334899 135.6625 5 TTCAGCT 25 0.001135094 81.39751 2 >>END_MODULE SRR8474564 read2 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474564_2.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.34875 6.0 6.0 6.0 1.0 6.0 4 5.81 6.0 6.0 6.0 6.0 6.0 5 5.89625 6.0 6.0 6.0 6.0 6.0 6 9.71325 10.0 10.0 10.0 10.0 10.0 7 9.70825 10.0 10.0 10.0 10.0 10.0 8 9.91375 10.0 10.0 10.0 10.0 10.0 9 9.916 10.0 10.0 10.0 10.0 10.0 10-14 9.91455 10.0 10.0 10.0 10.0 10.0 15-19 9.92955 10.0 10.0 10.0 10.0 10.0 20-24 9.8669 10.0 10.0 10.0 10.0 10.0 25-29 9.907050000000002 10.0 10.0 10.0 10.0 10.0 30-34 9.9249 10.0 10.0 10.0 10.0 10.0 35-39 9.91375 10.0 10.0 10.0 10.0 10.0 40-44 9.934149999999999 10.0 10.0 10.0 10.0 10.0 45-49 9.911950000000001 10.0 10.0 10.0 10.0 10.0 50-54 9.88945 10.0 10.0 10.0 10.0 10.0 55-59 9.902349999999998 10.0 10.0 10.0 10.0 10.0 60-64 9.8856 10.0 10.0 10.0 10.0 10.0 65-69 9.8811 10.0 10.0 10.0 10.0 10.0 70-74 9.870500000000002 10.0 10.0 10.0 10.0 10.0 75-79 9.811849999999998 10.0 10.0 10.0 10.0 10.0 80-84 9.8248 10.0 10.0 10.0 10.0 10.0 85-89 9.8796 10.0 10.0 10.0 10.0 10.0 90-94 9.8248 10.0 10.0 10.0 10.0 10.0 95-99 9.848650000000001 10.0 10.0 10.0 10.0 10.0 100-104 9.788807892088366 10.0 10.0 10.0 10.0 10.0 105-109 9.77460122916971 10.0 10.0 10.0 10.0 10.0 110-114 9.700625172335965 10.0 10.0 10.0 10.0 10.0 115-119 9.518911847751601 10.0 10.0 10.0 8.4 10.0 120-124 9.532113750593266 10.0 10.0 10.0 7.6 10.0 125-129 9.58353149488386 10.0 10.0 10.0 8.4 10.0 130-134 9.575082372156668 10.0 10.0 10.0 9.2 10.0 135-139 9.458259248429489 10.0 10.0 10.0 6.8 10.0 140-144 9.275572769454232 10.0 10.0 10.0 6.0 10.0 145-149 9.18673166218611 10.0 10.0 10.0 6.0 10.0 150 9.163102573396158 10.0 10.0 10.0 6.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 32.0 9 3968.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.7 18.125 19.825 28.349999999999998 2 25.474999999999998 28.825 28.225 17.474999999999998 3 23.075000000000003 32.625 27.150000000000002 17.150000000000002 4 26.05 34.625 22.975 16.35 5 26.1 36.875 21.75 15.275 6 19.0 40.9 24.55 15.55 7 19.675 19.275000000000002 40.25 20.8 8 22.3 24.099999999999998 30.375000000000004 23.225 9 23.425 23.75 30.5 22.325 10-14 23.494999999999997 29.29 26.974999999999998 20.24 15-19 24.085 27.939999999999998 28.76 19.215 20-24 23.905 27.925 28.560000000000002 19.61 25-29 23.78 28.67 28.389999999999997 19.16 30-34 23.755000000000003 27.275 29.585 19.384999999999998 35-39 23.145 28.51 29.095 19.25 40-44 23.419999999999998 27.750000000000004 29.65 19.18 45-49 23.665 27.615000000000002 29.505 19.215 50-54 23.39 27.83 29.635 19.145 55-59 23.82 28.21 28.865000000000002 19.105 60-64 23.76 28.17 28.689999999999998 19.38 65-69 24.15 27.96 29.315 18.575 70-74 23.68 27.500000000000004 29.775000000000002 19.045 75-79 23.94 27.63 29.580000000000002 18.85 80-84 22.845 28.9 28.854999999999997 19.400000000000002 85-89 23.44 28.12 29.455 18.985 90-94 23.7 27.925 29.425 18.95 95-99 23.39 28.360000000000003 29.13 19.12 100-104 24.0750126710593 27.921946274708564 28.92549417131272 19.077546882919414 105-109 23.783559225216806 28.03136521784286 29.526925273926363 18.65815028301397 110-114 23.41711229946524 27.919786096256683 29.673796791443852 18.989304812834224 115-119 23.26417704011065 28.442600276625175 29.604426002766253 18.688796680497926 120-124 23.2197605136808 27.621912419737377 30.068837855035575 19.089489211546248 125-129 23.382964615106395 28.51286997407921 29.362830791488335 18.741334619326057 130-134 22.769328263624843 28.738910012674275 29.75285171102662 18.73891001267427 135-139 22.990567291085426 28.65683539258669 29.141756343828884 19.210840972499003 140-144 22.851779755283648 28.67769744160178 29.345105672969968 19.125417130144605 145-149 22.231052669604797 28.430026732172532 29.159742793150784 20.179177805071888 150 22.943095324392896 30.192098586444367 27.727437477346868 19.137368611815873 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 3.0 25 2.5 26 4.5 27 10.0 28 11.0 29 15.0 30 20.5 31 23.5 32 36.5 33 52.0 34 63.5 35 81.0 36 98.0 37 135.0 38 168.0 39 198.5 40 229.0 41 253.5 42 284.0 43 301.0 44 291.0 45 274.5 46 266.5 47 246.0 48 218.0 49 182.0 50 136.0 51 97.0 52 74.5 53 59.0 54 49.0 55 34.5 56 23.5 57 19.5 58 13.0 59 6.5 60 5.0 61 4.5 62 3.0 63 1.0 64 0.5 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 20.0 100-101 35.0 102-103 28.0 104-105 39.0 106-107 48.0 108-109 45.0 110-111 38.0 112-113 57.0 114-115 50.0 116-117 49.0 118-119 70.0 120-121 67.0 122-123 54.0 124-125 57.0 126-127 53.0 128-129 66.0 130-131 73.0 132-133 63.0 134-135 53.0 136-137 36.0 138-139 70.0 140-141 54.0 142-143 46.0 144-145 70.0 146-147 0.0 148-149 0.0 150-151 2759.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.14060112073358 96.325 2 1.8339276617422313 3.5999999999999996 3 0.025471217524197655 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTACA 10 0.008334899 135.6625 4 TTTGGTA 20 4.6754454E-4 101.74687 2 >>END_MODULE Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra Read 1076149 spots for SRR8474564.sra Written 1076149 spots for SRR8474564.sra Read 1076131 spots for SRR8474564.sra Written 1076131 spots for SRR8474564.sra SRR ids: ['SRR8474564.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_prmbhgiq SRR8474564.sra spots: 21522638 blocks: [[1, 1076131], [1076132, 2152262], [2152263, 3228393], [3228394, 4304524], [4304525, 5380655], [5380656, 6456786], [6456787, 7532917], [7532918, 8609048], [8609049, 9685179], [9685180, 10761310], [10761311, 11837441], [11837442, 12913572], [12913573, 13989703], [13989704, 15065834], [15065835, 16141965], [16141966, 17218096], [17218097, 18294227], [18294228, 19370358], [19370359, 20446489], [20446490, 21522638]] SRR8474564 file size 7756870 SRR8474564 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8474564 SRR8474564_1.fastq SRR8474564_2.fastq Input file: SRR8474564_1.fastq Paired file: SRR8474564_2.fastq trimmed: SRR8474564-trimmed-pair1.fastq, SRR8474564-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 13:56:12 2025 >> started Tue Feb 11 13:56:51 2025 >> done (39.796s) 21522638 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 190 ( 0.00%) empty read pairs filtered out after trimming by size control 21522446 (100.00%) read pairs available; of these: 1382566 ( 6.42%) trimmed read pairs available after processing 20139880 (93.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 3 0.00% 28 2 0.00% 29 1 0.00% 30 1 0.00% 31 2 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 3 0.00% 36 3 0.00% 37 3 0.00% 38 5 0.00% 39 1 0.00% 40 5 0.00% 41 3 0.00% 42 6 0.00% 43 1 0.00% 44 6 0.00% 45 2 0.00% 46 6 0.00% 47 1 0.00% 48 6 0.00% 49 2 0.00% 50 5 0.00% 51 5 0.00% 52 5 0.00% 53 10 0.00% 54 9 0.00% 55 6 0.00% 56 4 0.00% 57 8 0.00% 58 10 0.00% 59 5 0.00% 60 11 0.00% 61 5 0.00% 62 7 0.00% 63 5 0.00% 64 8 0.00% 65 11 0.00% 66 18 0.00% 67 5 0.00% 68 12 0.00% 69 6 0.00% 70 15 0.00% 71 6 0.00% 72 16 0.00% 73 12 0.00% 74 9 0.00% 75 9 0.00% 76 12 0.00% 77 14 0.00% 78 20 0.00% 79 18 0.00% 80 17 0.00% 81 16 0.00% 82 12 0.00% 83 23 0.00% 84 19 0.00% 85 16 0.00% 86 17 0.00% 87 31 0.00% 88 17 0.00% 89 26 0.00% 90 21 0.00% 91 19 0.00% 92 30 0.00% 93 48 0.00% 94 78 0.00% 95 80 0.00% 96 81 0.00% 97 84 0.00% 98 100 0.00% 99 20613 0.10% 100 21760 0.10% 101 22307 0.10% 102 22803 0.11% 103 23499 0.11% 104 25076 0.12% 105 26355 0.12% 106 27988 0.13% 107 29904 0.14% 108 32342 0.15% 109 33575 0.16% 110 34812 0.16% 111 35448 0.16% 112 35991 0.17% 113 36762 0.17% 114 38004 0.18% 115 39739 0.18% 116 40782 0.19% 117 43119 0.20% 118 46006 0.21% 119 48272 0.22% 120 50207 0.23% 121 50631 0.24% 122 51139 0.24% 123 51939 0.24% 124 52531 0.24% 125 54096 0.25% 126 56119 0.26% 127 58469 0.27% 128 61158 0.28% 129 64389 0.30% 130 65854 0.31% 131 68020 0.32% 132 67866 0.32% 133 67965 0.32% 134 68537 0.32% 135 70065 0.33% 136 70104 0.33% 137 3875 0.02% 138 73781 0.34% 139 76898 0.36% 140 79437 0.37% 141 82809 0.38% 142 85814 0.40% 143 88331 0.41% 144 92839 0.43% 145 129287 0.60% 146 87711 0.41% 147 101423 0.47% 148 180176 0.84% 149 948529 4.41% 150 17776199 82.59% 21522446 reads passed initial QC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=25.60 fanout-score-rank=14 prefix-density=0.23 prefix-fanout=9.2 sequence=ATTCTTGATAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=554.17 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=35.8 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=40 prefix-density=0.12 prefix-fanout=1.9 sequence=GCGGGAGCAGCTA criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=532.64 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=32.4 sequence=AAGAAGAAGAAG SRR8474564 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 13:58:49 Started mapping on | Feb 11 13:58:49 Finished on | Feb 11 14:05:16 Mapping speed, Million of reads per hour | 200.21 Number of input reads | 21522446 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 17001381 Uniquely mapped reads % | 78.99% Average mapped length | 280.70 Number of splices: Total | 14463731 Number of splices: Annotated (sjdb) | 14114054 Number of splices: GT/AG | 14152659 Number of splices: GC/AG | 199189 Number of splices: AT/AC | 13367 Number of splices: Non-canonical | 98516 Mismatch rate per base, % | 1.58% Deletion rate per base | 0.09% Deletion average length | 2.93 Insertion rate per base | 0.06% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 797731 % of reads mapped to multiple loci | 3.71% Number of reads mapped to too many loci | 321958 % of reads mapped to too many loci | 1.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.73% % of reads unmapped: other | 1.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3723334 3723334 3723334 N_multimapping 797731 797731 797731 N_noFeature 470537 16679427 703536 N_ambiguous 309016 5672 215997 UnstrandedReadsAssigned:16221828 PositiveStrandReadsAssigned:316282 NegativeStrandReadsAssigned:16081848 Dataset is classified negative stranded MeadianReadLen=142 20thPercentileLength=127 echo kmer=123 SRR8474564 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8474564-trimmed-pair1.fastq SRR8474564-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,522,446 reads, 18,119,883 reads pseudoaligned [quant] estimated average fragment length: 170.82 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,189 rounds 52401 SRR8474564.ke.tsv 34699 SRR8474564.se.tsv 87100 total ==> SRR8474564.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1848.18 1276 43.8698 Potri.005G024800.1.v4.1 1035 865.18 539 39.586 Potri.004G059700.1.v4.1 961 791.184 84 6.74623 Potri.007G009000.2.v4.1 1416 1246.18 0 0 Potri.003G141000.2.v4.1 2943 2773.18 705.315 16.1609 Potri.016G087400.1.v4.1 270 106.226 1069.64 639.834 Potri.015G069301.1.v4.1 564 394.242 0 0 Potri.010G195200.1.v4.1 1773 1603.18 20 0.792697 Potri.012G127500.1.v4.1 977 807.18 9188 723.286 ==> SRR8474564.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 84 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 32 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR8474564 completed mapping pipeline successfully