Starting /dee2/code/volunteer_pipeline.sh SRR8474567 current disk space = 3049988599808 free memory = 1476512720 SRR8474567 SRAfilesize 9e828fc99173a1be6c1b508b9da22979 SRR8474567.sra SRR8474567.sra file validated SRR8474567 is paired end SRR8474567 is conventional basespace SRR8474567 read1 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474567_1.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.8325 6.0 6.0 6.0 6.0 6.0 4 5.95 6.0 6.0 6.0 6.0 6.0 5 5.995 6.0 6.0 6.0 6.0 6.0 6 9.93575 10.0 10.0 10.0 10.0 10.0 7 9.84075 10.0 10.0 10.0 10.0 10.0 8 9.94525 10.0 10.0 10.0 10.0 10.0 9 9.89 10.0 10.0 10.0 10.0 10.0 10-14 9.9571 10.0 10.0 10.0 10.0 10.0 15-19 9.964450000000001 10.0 10.0 10.0 10.0 10.0 20-24 9.95345 10.0 10.0 10.0 10.0 10.0 25-29 9.9572 10.0 10.0 10.0 10.0 10.0 30-34 9.92325 10.0 10.0 10.0 10.0 10.0 35-39 9.95285 10.0 10.0 10.0 10.0 10.0 40-44 9.94575 10.0 10.0 10.0 10.0 10.0 45-49 9.92725 10.0 10.0 10.0 10.0 10.0 50-54 9.94105 10.0 10.0 10.0 10.0 10.0 55-59 9.91505 10.0 10.0 10.0 10.0 10.0 60-64 9.9281 10.0 10.0 10.0 10.0 10.0 65-69 9.93135 10.0 10.0 10.0 10.0 10.0 70-74 9.85445 10.0 10.0 10.0 10.0 10.0 75-79 9.8453 10.0 10.0 10.0 10.0 10.0 80-84 9.905100000000001 10.0 10.0 10.0 10.0 10.0 85-89 9.89325 10.0 10.0 10.0 10.0 10.0 90-94 9.911800000000001 10.0 10.0 10.0 10.0 10.0 95-99 9.83415 10.0 10.0 10.0 10.0 10.0 100-104 9.849514994998877 10.0 10.0 10.0 10.0 10.0 105-109 9.85102227555161 10.0 10.0 10.0 10.0 10.0 110-114 9.881872768807503 10.0 10.0 10.0 10.0 10.0 115-119 9.874963793791855 10.0 10.0 10.0 10.0 10.0 120-124 9.852482509527997 10.0 10.0 10.0 10.0 10.0 125-129 9.847173602628724 10.0 10.0 10.0 10.0 10.0 130-134 9.768890681813382 10.0 10.0 10.0 10.0 10.0 135-139 9.776484338510897 10.0 10.0 10.0 10.0 10.0 140-144 9.70577952983914 10.0 10.0 10.0 10.0 10.0 145-149 9.623006955260692 10.0 10.0 10.0 9.2 10.0 150 9.631806707536963 10.0 10.0 10.0 10.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 2.0 9 3998.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.35 10.5 18.05 33.1 2 22.675 15.875 30.85 30.599999999999998 3 22.075 21.5 23.400000000000002 33.025 4 24.75 31.55 20.65 23.05 5 24.55 33.225 23.05 19.175 6 18.3 37.6 25.775 18.325 7 12.8 28.925 40.25 18.025 8 16.425 25.75 34.300000000000004 23.525 9 16.2 23.0 35.55 25.25 10-14 18.790000000000003 30.75 28.205000000000002 22.255 15-19 18.725 29.935000000000002 29.244999999999997 22.095000000000002 20-24 18.82 30.055 28.685 22.439999999999998 25-29 18.94 29.865000000000002 28.57 22.625 30-34 18.78 29.909999999999997 28.21 23.1 35-39 18.67 30.615 27.395000000000003 23.32 40-44 19.205 30.445 27.67 22.68 45-49 19.175 29.48 28.185 23.16 50-54 18.65 29.615000000000002 28.444999999999997 23.29 55-59 18.765 30.070000000000004 28.060000000000002 23.105 60-64 18.875 30.214999999999996 27.865000000000002 23.044999999999998 65-69 18.81 30.009999999999998 27.935 23.244999999999997 70-74 18.759999999999998 30.349999999999998 27.73 23.16 75-79 18.85 29.065 28.92 23.165 80-84 18.625 30.330000000000002 28.025 23.02 85-89 19.115 29.849999999999998 28.27 22.765 90-94 19.125 29.86 27.66 23.355 95-99 19.28 29.945 28.110000000000003 22.665 100-104 19.340814882216158 29.905975128905066 28.475381660095035 22.27782832878374 105-109 19.67846653269439 28.44849796465193 28.80919255938579 23.063842943267893 110-114 19.592685397451618 28.746601268859628 28.2347923441915 23.425920989497254 115-119 18.127456951442333 29.837771994906152 28.813465478101985 23.22130557554953 120-124 18.417564686221404 29.43006972857719 28.404310493862734 23.748055091338674 125-129 18.766097634022163 29.176400119796348 28.52949985025457 23.528002395926926 130-134 19.1123701605288 28.756688700031475 28.977022348127164 23.15391879131256 135-139 18.528538436159682 29.013526888815573 29.006928406466514 23.45100626855823 140-144 18.78063937029621 29.29641648829662 28.49547745632811 23.427466685079057 145-149 19.072981142939398 29.797034691233627 27.947315387937238 23.182668777889738 150 18.932564010097366 27.9841327082582 30.183916336098086 22.89938694554634 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 2.0 22 1.0 23 3.5 24 6.5 25 8.0 26 6.0 27 11.5 28 19.0 29 24.5 30 36.5 31 44.0 32 57.0 33 74.5 34 84.5 35 112.0 36 131.0 37 147.5 38 170.5 39 194.0 40 223.0 41 257.5 42 299.5 43 267.0 44 241.5 45 259.5 46 239.0 47 201.5 48 184.0 49 175.5 50 135.5 51 100.5 52 80.5 53 60.5 54 40.5 55 23.5 56 19.0 57 17.0 58 15.5 59 10.5 60 5.0 61 3.0 62 1.0 63 1.5 64 1.5 65 0.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 15.0 100-101 29.0 102-103 28.0 104-105 28.0 106-107 36.0 108-109 52.0 110-111 62.0 112-113 51.0 114-115 62.0 116-117 52.0 118-119 59.0 120-121 60.0 122-123 46.0 124-125 51.0 126-127 57.0 128-129 72.0 130-131 59.0 132-133 73.0 134-135 60.0 136-137 29.0 138-139 58.0 140-141 61.0 142-143 66.0 144-145 61.0 146-147 0.0 148-149 0.0 150-151 2773.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 97.74936061381074 95.55 2 2.1994884910485935 4.3 3 0.051150895140664954 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8474567 read2 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474567_2.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.2975 6.0 6.0 6.0 1.0 6.0 4 5.8 6.0 6.0 6.0 6.0 6.0 5 5.895 6.0 6.0 6.0 6.0 6.0 6 9.64275 10.0 10.0 10.0 10.0 10.0 7 9.58125 10.0 10.0 10.0 10.0 10.0 8 9.8625 10.0 10.0 10.0 10.0 10.0 9 9.901 10.0 10.0 10.0 10.0 10.0 10-14 9.908800000000001 10.0 10.0 10.0 10.0 10.0 15-19 9.9209 10.0 10.0 10.0 10.0 10.0 20-24 9.84125 10.0 10.0 10.0 10.0 10.0 25-29 9.896350000000002 10.0 10.0 10.0 10.0 10.0 30-34 9.915600000000001 10.0 10.0 10.0 10.0 10.0 35-39 9.91485 10.0 10.0 10.0 10.0 10.0 40-44 9.9368 10.0 10.0 10.0 10.0 10.0 45-49 9.908249999999999 10.0 10.0 10.0 10.0 10.0 50-54 9.89035 10.0 10.0 10.0 10.0 10.0 55-59 9.9035 10.0 10.0 10.0 10.0 10.0 60-64 9.8856 10.0 10.0 10.0 10.0 10.0 65-69 9.880349999999998 10.0 10.0 10.0 10.0 10.0 70-74 9.884699999999999 10.0 10.0 10.0 10.0 10.0 75-79 9.80855 10.0 10.0 10.0 10.0 10.0 80-84 9.835249999999998 10.0 10.0 10.0 10.0 10.0 85-89 9.8854 10.0 10.0 10.0 10.0 10.0 90-94 9.815850000000001 10.0 10.0 10.0 10.0 10.0 95-99 9.8513 10.0 10.0 10.0 10.0 10.0 100-104 9.791923327323342 10.0 10.0 10.0 10.0 10.0 105-109 9.754899142902755 10.0 10.0 10.0 10.0 10.0 110-114 9.703113846212844 10.0 10.0 10.0 10.0 10.0 115-119 9.567015514724057 10.0 10.0 10.0 8.4 10.0 120-124 9.530447096419872 10.0 10.0 10.0 7.6 10.0 125-129 9.587834204280183 10.0 10.0 10.0 9.2 10.0 130-134 9.568052849595016 10.0 10.0 10.0 9.2 10.0 135-139 9.410081345906535 10.0 10.0 10.0 6.8 10.0 140-144 9.298501476020476 10.0 10.0 10.0 6.0 10.0 145-149 9.161207503887415 10.0 10.0 10.0 6.0 10.0 150 9.011539848539488 10.0 10.0 10.0 6.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 48.0 9 3952.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.95 18.25 20.75 27.05 2 25.7 29.625 28.199999999999996 16.475 3 24.0 34.150000000000006 25.15 16.7 4 26.525 35.575 22.35 15.55 5 25.55 37.525 22.1 14.825 6 17.525 39.925 26.674999999999997 15.875 7 19.375 20.05 41.15 19.425 8 23.0 23.7 29.325000000000003 23.974999999999998 9 22.45 23.75 30.65 23.150000000000002 10-14 23.64 29.615000000000002 26.685 20.06 15-19 23.97 27.544999999999998 28.875 19.61 20-24 23.075000000000003 28.21 29.265 19.45 25-29 23.035 28.499999999999996 28.854999999999997 19.61 30-34 23.605 27.575 29.580000000000002 19.24 35-39 23.505000000000003 28.435 28.860000000000003 19.2 40-44 23.244999999999997 28.12 29.609999999999996 19.025 45-49 23.115 28.720000000000002 29.154999999999998 19.009999999999998 50-54 23.135 28.599999999999998 29.04 19.225 55-59 22.835 28.435 29.81 18.92 60-64 22.650000000000002 28.065 30.044999999999998 19.24 65-69 23.9 28.375 29.04 18.685 70-74 23.755000000000003 28.095 29.57 18.58 75-79 23.015 28.23 29.99 18.765 80-84 23.365 28.299999999999997 29.5 18.834999999999997 85-89 23.18 28.165000000000003 29.565 19.09 90-94 23.200000000000003 28.110000000000003 30.09 18.6 95-99 22.79 28.275 30.095 18.84 100-104 23.551713679102214 28.03053280760287 29.70377110504499 18.713982408249922 105-109 23.52244035657237 27.546761477817284 30.21074869892307 18.72004946668728 110-114 22.96209415151677 28.021538625579783 29.556965399584158 19.459401823319293 115-119 22.457228281933446 28.414816455345772 29.8266984109407 19.30125685178008 120-124 23.09110816573503 28.859563187921395 29.383968189938336 18.66536045640523 125-129 23.31236897274633 28.265947888589398 29.23629829290207 19.185384845762204 130-134 23.361661945231347 28.536355051935793 29.80799496380233 18.29398803903053 135-139 22.59320356318047 28.314087759815244 29.521610029693168 19.571098647311118 140-144 22.902713526203133 28.536905337291994 29.358558309742456 19.20182282676241 145-149 22.441341586296243 29.113286310637687 28.88297106664747 19.5624010364186 150 20.952037504507754 30.544536602957084 28.6332491886044 19.87017670393076 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 2.5 25 3.0 26 5.0 27 7.5 28 11.0 29 19.0 30 27.5 31 38.5 32 48.0 33 57.0 34 75.5 35 94.0 36 120.0 37 156.5 38 174.0 39 208.5 40 261.0 41 267.5 42 281.5 43 277.5 44 259.5 45 259.5 46 253.5 47 233.0 48 190.5 49 160.5 50 127.5 51 98.5 52 81.5 53 61.5 54 43.0 55 31.0 56 22.5 57 13.5 58 7.5 59 4.5 60 3.0 61 2.5 62 1.0 63 2.0 64 1.5 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 15.0 100-101 29.0 102-103 28.0 104-105 28.0 106-107 36.0 108-109 52.0 110-111 62.0 112-113 51.0 114-115 62.0 116-117 52.0 118-119 59.0 120-121 60.0 122-123 46.0 124-125 51.0 126-127 57.0 128-129 72.0 130-131 59.0 132-133 73.0 134-135 60.0 136-137 29.0 138-139 58.0 140-141 61.0 142-143 66.0 144-145 61.0 146-147 0.0 148-149 0.0 150-151 2773.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.675 #Duplication Level Percentage of deduplicated Percentage of total 1 97.69644228308165 95.42500000000001 2 2.2267724596877403 4.35 3 0.07678525723061172 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATGG 15 0.009642722 128.46062 130-134 >>END_MODULE Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283663 spots for SRR8474567.sra Written 1283663 spots for SRR8474567.sra Read 1283680 spots for SRR8474567.sra Written 1283680 spots for SRR8474567.sra SRR ids: ['SRR8474567.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lasor5ii SRR8474567.sra spots: 25673277 blocks: [[1, 1283663], [1283664, 2567326], [2567327, 3850989], [3850990, 5134652], [5134653, 6418315], [6418316, 7701978], [7701979, 8985641], [8985642, 10269304], [10269305, 11552967], [11552968, 12836630], [12836631, 14120293], [14120294, 15403956], [15403957, 16687619], [16687620, 17971282], [17971283, 19254945], [19254946, 20538608], [20538609, 21822271], [21822272, 23105934], [23105935, 24389597], [24389598, 25673277]] SRR8474567 file size 9259117 SRR8474567 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8474567 SRR8474567_1.fastq SRR8474567_2.fastq Input file: SRR8474567_1.fastq Paired file: SRR8474567_2.fastq trimmed: SRR8474567-trimmed-pair1.fastq, SRR8474567-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:43:07 2025 >> started Tue Feb 11 14:43:34 2025 >> done (27.166s) 25673277 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 160 ( 0.00%) empty read pairs filtered out after trimming by size control 25673116 (100.00%) read pairs available; of these: 1630452 ( 6.35%) trimmed read pairs available after processing 24042664 (93.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 3 0.00% 33 1 0.00% 34 2 0.00% 35 5 0.00% 36 3 0.00% 37 2 0.00% 38 4 0.00% 39 3 0.00% 40 5 0.00% 41 4 0.00% 42 3 0.00% 43 2 0.00% 44 5 0.00% 45 5 0.00% 46 7 0.00% 47 4 0.00% 48 8 0.00% 49 6 0.00% 50 4 0.00% 51 7 0.00% 52 10 0.00% 53 11 0.00% 54 8 0.00% 55 3 0.00% 56 4 0.00% 57 9 0.00% 58 9 0.00% 59 9 0.00% 60 10 0.00% 61 6 0.00% 62 12 0.00% 63 11 0.00% 64 6 0.00% 65 11 0.00% 66 9 0.00% 67 18 0.00% 68 11 0.00% 69 13 0.00% 70 7 0.00% 71 11 0.00% 72 15 0.00% 73 15 0.00% 74 9 0.00% 75 16 0.00% 76 18 0.00% 77 11 0.00% 78 18 0.00% 79 18 0.00% 80 25 0.00% 81 18 0.00% 82 15 0.00% 83 23 0.00% 84 17 0.00% 85 16 0.00% 86 26 0.00% 87 22 0.00% 88 31 0.00% 89 35 0.00% 90 34 0.00% 91 42 0.00% 92 39 0.00% 93 47 0.00% 94 90 0.00% 95 99 0.00% 96 77 0.00% 97 92 0.00% 98 119 0.00% 99 23301 0.09% 100 24115 0.09% 101 24944 0.10% 102 25348 0.10% 103 26334 0.10% 104 28015 0.11% 105 29605 0.12% 106 31806 0.12% 107 33950 0.13% 108 36212 0.14% 109 38395 0.15% 110 40239 0.16% 111 40543 0.16% 112 40617 0.16% 113 41993 0.16% 114 43303 0.17% 115 45330 0.18% 116 47254 0.18% 117 49665 0.19% 118 53380 0.21% 119 55913 0.22% 120 57996 0.23% 121 59289 0.23% 122 58905 0.23% 123 59987 0.23% 124 60967 0.24% 125 62481 0.24% 126 65400 0.25% 127 67577 0.26% 128 71025 0.28% 129 74777 0.29% 130 77882 0.30% 131 79513 0.31% 132 80025 0.31% 133 79464 0.31% 134 80482 0.31% 135 81134 0.32% 136 82352 0.32% 137 4524 0.02% 138 86952 0.34% 139 90647 0.35% 140 93704 0.36% 141 97972 0.38% 142 101379 0.39% 143 104938 0.41% 144 110455 0.43% 145 152238 0.59% 146 103247 0.40% 147 120193 0.47% 148 212869 0.83% 149 1119627 4.36% 150 21293589 82.94% 25673116 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=35 prefix-density=0.23 prefix-fanout=1.9 sequence=TTAATTTACAGCAAATACTATATTAGACAAACATGGAGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=12 fanout-score=246.56 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=27.9 sequence=TCATCTTCATCA criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=34 prefix-density=0.23 prefix-fanout=2.0 sequence=CACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=334.29 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=21.3 sequence=AAGAAGAAGAAA SRR8474567 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:44:22 Started mapping on | Feb 11 14:44:23 Finished on | Feb 11 14:50:30 Mapping speed, Million of reads per hour | 251.83 Number of input reads | 25673116 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21854309 Uniquely mapped reads % | 85.13% Average mapped length | 288.27 Number of splices: Total | 18643121 Number of splices: Annotated (sjdb) | 18165760 Number of splices: GT/AG | 18245922 Number of splices: GC/AG | 256847 Number of splices: AT/AC | 17431 Number of splices: Non-canonical | 122921 Mismatch rate per base, % | 1.57% Deletion rate per base | 0.10% Deletion average length | 2.95 Insertion rate per base | 0.07% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1003038 % of reads mapped to multiple loci | 3.91% Number of reads mapped to too many loci | 284861 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.99% % of reads unmapped: other | 0.86% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2815769 2815769 2815769 N_multimapping 1003038 1003038 1003038 N_noFeature 712422 21579960 871386 N_ambiguous 308838 1979 192331 UnstrandedReadsAssigned:20833049 PositiveStrandReadsAssigned:272370 NegativeStrandReadsAssigned:20790592 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=136 echo kmer=131 SRR8474567 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8474567-trimmed-pair1.fastq SRR8474567-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,673,116 reads, 21,698,756 reads pseudoaligned [quant] estimated average fragment length: 179.726 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR8474567.ke.tsv 34699 SRR8474567.se.tsv 87100 total ==> SRR8474567.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1839.27 1328 37.3025 Potri.005G024800.1.v4.1 1035 856.274 849 51.2248 Potri.004G059700.1.v4.1 961 782.279 82 5.41549 Potri.007G009000.2.v4.1 1416 1237.27 0 0 Potri.003G141000.2.v4.1 2943 2764.27 825.47 15.4279 Potri.016G087400.1.v4.1 270 98.6606 1248.5 653.78 Potri.015G069301.1.v4.1 564 385.338 0 0 Potri.010G195200.1.v4.1 1773 1594.27 63 2.04157 Potri.012G127500.1.v4.1 977 798.279 14971 968.907 ==> SRR8474567.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 60 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 141 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 107 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR8474567 completed mapping pipeline successfully