Starting /dee2/code/volunteer_pipeline.sh SRR8474568 current disk space = 3049511538688 free memory = 1579998964 SRR8474568 SRAfilesize f9f4a904a9f559637b6dcf8c344d9b65 SRR8474568.sra SRR8474568.sra file validated SRR8474568 is paired end SRR8474568 is conventional basespace SRR8474568 read1 length is 94-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474568_1.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 94-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.835 6.0 6.0 6.0 6.0 6.0 4 5.95 6.0 6.0 6.0 6.0 6.0 5 5.99375 6.0 6.0 6.0 6.0 6.0 6 9.932 10.0 10.0 10.0 10.0 10.0 7 9.84575 10.0 10.0 10.0 10.0 10.0 8 9.93875 10.0 10.0 10.0 10.0 10.0 9 9.90625 10.0 10.0 10.0 10.0 10.0 10-14 9.96085 10.0 10.0 10.0 10.0 10.0 15-19 9.96395 10.0 10.0 10.0 10.0 10.0 20-24 9.957500000000001 10.0 10.0 10.0 10.0 10.0 25-29 9.96115 10.0 10.0 10.0 10.0 10.0 30-34 9.9347 10.0 10.0 10.0 10.0 10.0 35-39 9.95525 10.0 10.0 10.0 10.0 10.0 40-44 9.94615 10.0 10.0 10.0 10.0 10.0 45-49 9.925 10.0 10.0 10.0 10.0 10.0 50-54 9.93565 10.0 10.0 10.0 10.0 10.0 55-59 9.906249999999998 10.0 10.0 10.0 10.0 10.0 60-64 9.9236 10.0 10.0 10.0 10.0 10.0 65-69 9.92245 10.0 10.0 10.0 10.0 10.0 70-74 9.8387 10.0 10.0 10.0 10.0 10.0 75-79 9.8431 10.0 10.0 10.0 10.0 10.0 80-84 9.8898 10.0 10.0 10.0 10.0 10.0 85-89 9.885349999999999 10.0 10.0 10.0 10.0 10.0 90-94 9.903500000000001 10.0 10.0 10.0 10.0 10.0 95-99 9.819990140106311 10.0 10.0 10.0 10.0 10.0 100-104 9.857365705777891 10.0 10.0 10.0 10.0 10.0 105-109 9.856279421196657 10.0 10.0 10.0 10.0 10.0 110-114 9.875035687433178 10.0 10.0 10.0 10.0 10.0 115-119 9.872688724582192 10.0 10.0 10.0 10.0 10.0 120-124 9.838089477266921 10.0 10.0 10.0 10.0 10.0 125-129 9.83472136183569 10.0 10.0 10.0 10.0 10.0 130-134 9.756153402915515 10.0 10.0 10.0 10.0 10.0 135-139 9.758289612941368 10.0 10.0 10.0 10.0 10.0 140-144 9.684381919024391 10.0 10.0 10.0 9.2 10.0 145-149 9.62313011920715 10.0 10.0 10.0 9.2 10.0 150 9.603896103896103 10.0 10.0 10.0 10.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 8.0 9 3992.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.699999999999996 11.1 17.299999999999997 35.9 2 24.349999999999998 15.475 30.125 30.049999999999997 3 22.35 22.5 22.35 32.800000000000004 4 23.599999999999998 31.974999999999998 20.775 23.65 5 23.425 33.825 22.45 20.3 6 16.875 37.625 26.575 18.925 7 12.775 29.175 39.875 18.175 8 16.0 26.174999999999997 33.225 24.6 9 17.65 24.325 33.650000000000006 24.375 10-14 19.139999999999997 30.985000000000003 27.47 22.405 15-19 19.05 30.415 27.96 22.575 20-24 18.584999999999997 30.04 28.4 22.975 25-29 17.78 30.669999999999998 28.23 23.32 30-34 18.529999999999998 30.445 27.91 23.115 35-39 19.295 30.125 28.28 22.3 40-44 19.1 30.665 27.375 22.86 45-49 19.145 30.159999999999997 27.794999999999998 22.900000000000002 50-54 18.825 30.705 27.785 22.685 55-59 19.515 29.65 27.96 22.875 60-64 19.115 29.775000000000002 28.325 22.785 65-69 19.605 29.720000000000002 27.485 23.189999999999998 70-74 19.075 29.69 28.53 22.705000000000002 75-79 19.165 29.535 28.08 23.22 80-84 18.759999999999998 30.275000000000002 27.750000000000004 23.215 85-89 19.155 29.39 28.265 23.189999999999998 90-94 19.32 29.304999999999996 28.15 23.225 95-99 18.815644693408025 29.778933680104032 27.928378513554065 23.477043112933877 100-104 19.34647830064031 29.581258257953042 28.026222177050514 23.046041264356134 105-109 18.903651009519823 29.610837953760853 28.345015168950727 23.140495867768596 110-114 18.676644772262303 29.10520081834823 28.78216862280607 23.435985786583398 115-119 18.873380414836234 29.383306456097426 28.059834287938607 23.68347884112773 120-124 19.04016692749087 28.96307888483162 27.902393786587844 24.094360401089666 125-129 19.13464447806354 29.597579425113462 27.90922844175492 23.35854765506808 130-134 19.17088607594937 29.044303797468356 28.303797468354432 23.481012658227847 135-139 18.521704605611436 29.20857596611964 28.222604552673374 24.047114875595554 140-144 19.229439026077333 28.85107560351387 28.657397800373523 23.262087570035277 145-149 18.974949611287073 28.94471638353009 28.53440829254247 23.54592571264037 150 20.67099567099567 27.525252525252526 26.659451659451662 25.144300144300146 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 4.0 24 4.5 25 4.5 26 7.0 27 7.0 28 12.5 29 21.5 30 25.5 31 37.0 32 54.5 33 69.0 34 82.5 35 104.0 36 134.5 37 161.0 38 176.0 39 201.0 40 231.5 41 252.0 42 278.0 43 277.0 44 276.5 45 269.5 46 239.0 47 221.0 48 186.5 49 150.5 50 125.5 51 102.5 52 83.5 53 55.5 54 34.5 55 27.0 56 19.5 57 18.0 58 14.0 59 10.0 60 7.0 61 2.0 62 1.5 63 2.0 64 1.5 65 1.0 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 94-95 1.0 96-97 0.0 98-99 21.0 100-101 36.0 102-103 57.0 104-105 33.0 106-107 55.0 108-109 40.0 110-111 42.0 112-113 41.0 114-115 56.0 116-117 45.0 118-119 63.0 120-121 61.0 122-123 51.0 124-125 62.0 126-127 63.0 128-129 52.0 130-131 61.0 132-133 68.0 134-135 54.0 136-137 26.0 138-139 56.0 140-141 63.0 142-143 64.0 144-145 57.0 146-147 0.0 148-149 0.0 150-151 2772.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.985207855139 96.05 2 2.014792144861005 3.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8474568 read2 length is 94-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474568_2.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 94-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.21875 6.0 6.0 6.0 1.0 6.0 4 5.79125 6.0 6.0 6.0 6.0 6.0 5 5.88375 6.0 6.0 6.0 6.0 6.0 6 9.658 10.0 10.0 10.0 10.0 10.0 7 9.59175 10.0 10.0 10.0 10.0 10.0 8 9.90475 10.0 10.0 10.0 10.0 10.0 9 9.9055 10.0 10.0 10.0 10.0 10.0 10-14 9.909650000000001 10.0 10.0 10.0 10.0 10.0 15-19 9.919149999999998 10.0 10.0 10.0 10.0 10.0 20-24 9.8465 10.0 10.0 10.0 10.0 10.0 25-29 9.8976 10.0 10.0 10.0 10.0 10.0 30-34 9.924249999999999 10.0 10.0 10.0 10.0 10.0 35-39 9.914350000000002 10.0 10.0 10.0 10.0 10.0 40-44 9.94015 10.0 10.0 10.0 10.0 10.0 45-49 9.91515 10.0 10.0 10.0 10.0 10.0 50-54 9.893049999999999 10.0 10.0 10.0 10.0 10.0 55-59 9.9028 10.0 10.0 10.0 10.0 10.0 60-64 9.88455 10.0 10.0 10.0 10.0 10.0 65-69 9.88195 10.0 10.0 10.0 10.0 10.0 70-74 9.88365 10.0 10.0 10.0 10.0 10.0 75-79 9.808249999999997 10.0 10.0 10.0 10.0 10.0 80-84 9.821449999999999 10.0 10.0 10.0 10.0 10.0 85-89 9.8637 10.0 10.0 10.0 10.0 10.0 90-94 9.8069 10.0 10.0 10.0 10.0 10.0 95-99 9.840100945696653 10.0 10.0 10.0 10.0 10.0 100-104 9.803718676119782 10.0 10.0 10.0 10.0 10.0 105-109 9.754456846918682 10.0 10.0 10.0 10.0 10.0 110-114 9.673042133053045 10.0 10.0 10.0 10.0 10.0 115-119 9.572428321143954 10.0 10.0 10.0 9.2 10.0 120-124 9.514732473336924 10.0 10.0 10.0 7.6 10.0 125-129 9.575529663172086 10.0 10.0 10.0 9.2 10.0 130-134 9.552920068924726 10.0 10.0 10.0 9.2 10.0 135-139 9.435032906256053 10.0 10.0 10.0 6.8 10.0 140-144 9.28258163388953 10.0 10.0 10.0 6.0 10.0 145-149 9.176648387276062 10.0 10.0 10.0 6.0 10.0 150 9.080447330447331 10.0 10.0 10.0 6.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 51.0 9 3949.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.7 19.175 20.200000000000003 26.924999999999997 2 25.124999999999996 28.675 28.749999999999996 17.45 3 22.425 33.175 26.35 18.05 4 27.375 35.05 21.45 16.125 5 26.950000000000003 38.525 20.474999999999998 14.05 6 17.925 40.575 26.200000000000003 15.299999999999999 7 19.575 20.225 41.075 19.125 8 23.0 23.65 30.2 23.150000000000002 9 23.7 24.0 29.9 22.400000000000002 10-14 24.404999999999998 29.2 26.615 19.78 15-19 23.785 27.93 29.220000000000002 19.064999999999998 20-24 23.599999999999998 28.505000000000003 28.860000000000003 19.035 25-29 23.395 28.175 29.035 19.395 30-34 22.85 28.810000000000002 29.060000000000002 19.28 35-39 23.119999999999997 28.215 29.005 19.66 40-44 23.955000000000002 27.38 29.205 19.46 45-49 23.3 28.16 29.415000000000003 19.125 50-54 23.369999999999997 28.27 28.73 19.63 55-59 23.685000000000002 28.035 29.4 18.88 60-64 22.825 27.965 29.455 19.755 65-69 23.775 28.065 29.509999999999998 18.65 70-74 23.549999999999997 27.925 28.939999999999998 19.585 75-79 23.5 27.589999999999996 29.995 18.915000000000003 80-84 23.765 28.37 29.025000000000002 18.84 85-89 23.215 27.935 29.535 19.314999999999998 90-94 23.39 27.384999999999998 30.205 19.02 95-99 23.246974092227667 27.928378513554065 29.998999699909973 18.82564769430829 100-104 23.96585018802724 28.031303994308367 29.433885557475353 18.568960260189044 105-109 23.161418558426615 28.161941625693064 29.532377863793286 19.14426195208704 110-114 23.30138903844083 28.16840745127598 29.498223322924517 19.031980187358673 115-119 23.3776344325196 28.39348273369293 29.31657676694656 18.912306066840905 120-124 22.79603547209181 28.2269750188373 30.30777256129369 18.669216947777198 125-129 22.626323751891075 28.133131618759457 30.48108925869894 18.759455370650528 130-134 23.12025316455696 28.03164556962025 30.170886075949365 18.677215189873415 135-139 22.31339332980413 28.414505029115933 29.413710958178928 19.858390682901007 140-144 22.5081275506675 28.187037421318394 29.985474164764476 19.31936086324964 145-149 22.674920817736826 28.268067952778576 29.714943852577026 19.342067376907572 150 24.38672438672439 27.669552669552672 29.184704184704184 18.75901875901876 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 0.5 24 0.5 25 2.0 26 2.5 27 3.0 28 7.0 29 13.5 30 23.0 31 28.5 32 35.0 33 45.5 34 70.5 35 97.0 36 124.0 37 154.0 38 173.5 39 204.5 40 248.5 41 280.0 42 279.0 43 284.5 44 283.5 45 271.0 46 245.0 47 217.0 48 197.0 49 164.5 50 125.0 51 105.0 52 95.0 53 61.5 54 42.5 55 33.5 56 22.0 57 19.0 58 16.0 59 7.5 60 3.0 61 2.5 62 2.5 63 1.5 64 0.5 65 0.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 94-95 1.0 96-97 0.0 98-99 21.0 100-101 36.0 102-103 57.0 104-105 33.0 106-107 55.0 108-109 40.0 110-111 42.0 112-113 41.0 114-115 56.0 116-117 45.0 118-119 63.0 120-121 61.0 122-123 51.0 124-125 62.0 126-127 63.0 128-129 52.0 130-131 61.0 132-133 68.0 134-135 54.0 136-137 26.0 138-139 56.0 140-141 63.0 142-143 64.0 144-145 57.0 146-147 0.0 148-149 0.0 150-151 2772.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.06270711190416 96.175 2 1.911802192199847 3.75 3 0.025490695895997964 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTCA 10 0.0085974075 134.2625 4 >>END_MODULE Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404283 spots for SRR8474568.sra Written 1404283 spots for SRR8474568.sra Read 1404295 spots for SRR8474568.sra Written 1404295 spots for SRR8474568.sra SRR ids: ['SRR8474568.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_73ovmq78 SRR8474568.sra spots: 28085672 blocks: [[1, 1404283], [1404284, 2808566], [2808567, 4212849], [4212850, 5617132], [5617133, 7021415], [7021416, 8425698], [8425699, 9829981], [9829982, 11234264], [11234265, 12638547], [12638548, 14042830], [14042831, 15447113], [15447114, 16851396], [16851397, 18255679], [18255680, 19659962], [19659963, 21064245], [21064246, 22468528], [22468529, 23872811], [23872812, 25277094], [25277095, 26681377], [26681378, 28085672]] SRR8474568 file size 10127862 SRR8474568 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8474568 SRR8474568_1.fastq SRR8474568_2.fastq Input file: SRR8474568_1.fastq Paired file: SRR8474568_2.fastq trimmed: SRR8474568-trimmed-pair1.fastq, SRR8474568-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:55:12 2025 >> started Tue Feb 11 15:55:53 2025 >> done (41.012s) 28085672 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 182 ( 0.00%) empty read pairs filtered out after trimming by size control 28085489 (100.00%) read pairs available; of these: 1852698 ( 6.60%) trimmed read pairs available after processing 26232791 (93.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 1 0.00% 25 1 0.00% 26 3 0.00% 27 2 0.00% 28 0 0.00% 29 4 0.00% 30 2 0.00% 31 4 0.00% 32 4 0.00% 33 2 0.00% 34 4 0.00% 35 7 0.00% 36 1 0.00% 37 8 0.00% 38 6 0.00% 39 7 0.00% 40 5 0.00% 41 4 0.00% 42 2 0.00% 43 5 0.00% 44 2 0.00% 45 7 0.00% 46 5 0.00% 47 7 0.00% 48 4 0.00% 49 11 0.00% 50 8 0.00% 51 3 0.00% 52 8 0.00% 53 9 0.00% 54 15 0.00% 55 14 0.00% 56 7 0.00% 57 5 0.00% 58 8 0.00% 59 11 0.00% 60 15 0.00% 61 11 0.00% 62 19 0.00% 63 13 0.00% 64 16 0.00% 65 13 0.00% 66 21 0.00% 67 17 0.00% 68 16 0.00% 69 17 0.00% 70 12 0.00% 71 19 0.00% 72 23 0.00% 73 20 0.00% 74 21 0.00% 75 16 0.00% 76 14 0.00% 77 15 0.00% 78 25 0.00% 79 24 0.00% 80 22 0.00% 81 26 0.00% 82 26 0.00% 83 26 0.00% 84 31 0.00% 85 20 0.00% 86 27 0.00% 87 34 0.00% 88 31 0.00% 89 43 0.00% 90 47 0.00% 91 36 0.00% 92 45 0.00% 93 63 0.00% 94 93 0.00% 95 99 0.00% 96 96 0.00% 97 97 0.00% 98 131 0.00% 99 26696 0.10% 100 27603 0.10% 101 28771 0.10% 102 29055 0.10% 103 30817 0.11% 104 32017 0.11% 105 34562 0.12% 106 36432 0.13% 107 39266 0.14% 108 41948 0.15% 109 44102 0.16% 110 45314 0.16% 111 46169 0.16% 112 46595 0.17% 113 47601 0.17% 114 49659 0.18% 115 51665 0.18% 116 52683 0.19% 117 56120 0.20% 118 59892 0.21% 119 62071 0.22% 120 63850 0.23% 121 65227 0.23% 122 65030 0.23% 123 65523 0.23% 124 66347 0.24% 125 68407 0.24% 126 71540 0.25% 127 74213 0.26% 128 77928 0.28% 129 81271 0.29% 130 83915 0.30% 131 86205 0.31% 132 86192 0.31% 133 86542 0.31% 134 85984 0.31% 135 87542 0.31% 136 88678 0.32% 137 5072 0.02% 138 94204 0.34% 139 97163 0.35% 140 101090 0.36% 141 104914 0.37% 142 108611 0.39% 143 110970 0.40% 144 117465 0.42% 145 163065 0.58% 146 109702 0.39% 147 129706 0.46% 148 239186 0.85% 149 1290370 4.59% 150 23218996 82.67% 28085489 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=37 prefix-density=0.25 prefix-fanout=1.9 sequence=TTAATTTACAGCAAATACTATATTAGACAAACATGGAGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=10 fanout-score=269.46 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=29.2 sequence=TCATCTTCATCA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=33 prefix-density=0.25 prefix-fanout=2.0 sequence=CACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=312.35 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=19.6 sequence=AAGAAGAAGAAA SRR8474568 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:56:44 Started mapping on | Feb 11 15:56:44 Finished on | Feb 11 16:03:27 Mapping speed, Million of reads per hour | 250.89 Number of input reads | 28085489 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 23608863 Uniquely mapped reads % | 84.06% Average mapped length | 287.99 Number of splices: Total | 20103725 Number of splices: Annotated (sjdb) | 19582466 Number of splices: GT/AG | 19685065 Number of splices: GC/AG | 273694 Number of splices: AT/AC | 19741 Number of splices: Non-canonical | 125225 Mismatch rate per base, % | 1.58% Deletion rate per base | 0.10% Deletion average length | 2.96 Insertion rate per base | 0.06% Insertion average length | 2.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1061904 % of reads mapped to multiple loci | 3.78% Number of reads mapped to too many loci | 480531 % of reads mapped to too many loci | 1.71% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.11% % of reads unmapped: other | 1.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3414722 3414722 3414722 N_multimapping 1061904 1061904 1061904 N_noFeature 816255 23284890 1004625 N_ambiguous 344905 2608 207603 UnstrandedReadsAssigned:22447703 PositiveStrandReadsAssigned:321365 NegativeStrandReadsAssigned:22396635 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR8474568 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8474568-trimmed-pair1.fastq SRR8474568-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,085,489 reads, 23,582,010 reads pseudoaligned [quant] estimated average fragment length: 181.387 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR8474568.ke.tsv 34699 SRR8474568.se.tsv 87100 total ==> SRR8474568.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1837.61 1700 43.5098 Potri.005G024800.1.v4.1 1035 854.613 1331.06 73.2524 Potri.004G059700.1.v4.1 961 780.613 71 4.27774 Potri.007G009000.2.v4.1 1416 1235.61 0 0 Potri.003G141000.2.v4.1 2943 2762.61 959.172 16.3294 Potri.016G087400.1.v4.1 270 97.6771 1154.33 555.815 Potri.015G069301.1.v4.1 564 383.662 0 0 Potri.010G195200.1.v4.1 1773 1592.61 53 1.56516 Potri.012G127500.1.v4.1 977 796.613 14578 860.682 ==> SRR8474568.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 375 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 165 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 84 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 66 SRR8474568 completed mapping pipeline successfully