Starting /dee2/code/volunteer_pipeline.sh SRR8474569 current disk space = 3049985753088 free memory = 1509260292 SRR8474569 SRAfilesize 276ab152cfc261b3cb8f0a5c6e1461f7 SRR8474569.sra SRR8474569.sra file validated SRR8474569 is paired end SRR8474569 is conventional basespace SRR8474569 read1 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474569_1.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.83125 6.0 6.0 6.0 6.0 6.0 4 5.93625 6.0 6.0 6.0 6.0 6.0 5 5.99125 6.0 6.0 6.0 6.0 6.0 6 9.92 10.0 10.0 10.0 10.0 10.0 7 9.87025 10.0 10.0 10.0 10.0 10.0 8 9.96025 10.0 10.0 10.0 10.0 10.0 9 9.9005 10.0 10.0 10.0 10.0 10.0 10-14 9.9682 10.0 10.0 10.0 10.0 10.0 15-19 9.9658 10.0 10.0 10.0 10.0 10.0 20-24 9.9585 10.0 10.0 10.0 10.0 10.0 25-29 9.9566 10.0 10.0 10.0 10.0 10.0 30-34 9.9388 10.0 10.0 10.0 10.0 10.0 35-39 9.9544 10.0 10.0 10.0 10.0 10.0 40-44 9.95185 10.0 10.0 10.0 10.0 10.0 45-49 9.932549999999999 10.0 10.0 10.0 10.0 10.0 50-54 9.93225 10.0 10.0 10.0 10.0 10.0 55-59 9.91315 10.0 10.0 10.0 10.0 10.0 60-64 9.9206 10.0 10.0 10.0 10.0 10.0 65-69 9.923350000000001 10.0 10.0 10.0 10.0 10.0 70-74 9.8524 10.0 10.0 10.0 10.0 10.0 75-79 9.85505 10.0 10.0 10.0 10.0 10.0 80-84 9.901250000000001 10.0 10.0 10.0 10.0 10.0 85-89 9.897400000000001 10.0 10.0 10.0 10.0 10.0 90-94 9.9082 10.0 10.0 10.0 10.0 10.0 95-99 9.84715 10.0 10.0 10.0 10.0 10.0 100-104 9.864231391171183 10.0 10.0 10.0 10.0 10.0 105-109 9.859208316192355 10.0 10.0 10.0 10.0 10.0 110-114 9.897759170591533 10.0 10.0 10.0 10.0 10.0 115-119 9.871470822328828 10.0 10.0 10.0 10.0 10.0 120-124 9.851542559234918 10.0 10.0 10.0 10.0 10.0 125-129 9.85154135275965 10.0 10.0 10.0 10.0 10.0 130-134 9.7561447856324 10.0 10.0 10.0 10.0 10.0 135-139 9.761099381377056 10.0 10.0 10.0 10.0 10.0 140-144 9.694828142197853 10.0 10.0 10.0 10.0 10.0 145-149 9.61613728851825 10.0 10.0 10.0 9.2 10.0 150 9.646176362971094 10.0 10.0 10.0 10.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 8.0 9 3992.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.8 10.2 17.150000000000002 35.85 2 24.8 15.15 29.775000000000002 30.275000000000002 3 21.5 23.625 23.3 31.574999999999996 4 24.65 32.15 18.475 24.725 5 23.599999999999998 34.025 22.5 19.875 6 17.45 37.8 25.45 19.3 7 12.425 27.875 42.075 17.625 8 16.5 27.325 31.225 24.95 9 18.0 22.975 34.375 24.65 10-14 18.855 30.95 27.375 22.82 15-19 19.505 29.89 28.18 22.425 20-24 19.009999999999998 29.99 28.49 22.509999999999998 25-29 18.88 30.685000000000002 27.765 22.67 30-34 18.21 30.049999999999997 28.515 23.225 35-39 19.07 30.335 27.975 22.62 40-44 18.355 29.975 28.365000000000002 23.305 45-49 18.625 30.104999999999997 27.83 23.44 50-54 18.54 30.725 27.725 23.01 55-59 18.63 29.565 28.52 23.285 60-64 18.685 30.745 27.47 23.1 65-69 19.285 30.44 27.77 22.505 70-74 19.075 30.04 27.88 23.005 75-79 19.095000000000002 29.695 28.155 23.055 80-84 18.65 30.39 28.050000000000004 22.91 85-89 18.45 29.904999999999998 28.54 23.105 90-94 18.925 29.775000000000002 27.715 23.585 95-99 18.94 30.395 27.834999999999997 22.830000000000002 100-104 18.709448499594487 29.501216545012166 28.467153284671532 23.322181670721818 105-109 18.770175986670832 29.766739560553994 28.251588045402475 23.211496407372696 110-114 19.554934422704797 29.697914427004946 27.79509782842399 22.952053321866263 115-119 18.76816454281243 29.493628437290408 28.817348535658393 22.920858484238764 120-124 19.200093147813938 30.063456948244742 27.466961634744138 23.269488269197183 125-129 18.862094037809015 29.853368880271447 27.94474066892875 23.33979641299079 130-134 18.894683286695496 28.86034088018316 28.49147799542101 23.75349783770033 135-139 18.779530179011115 29.699873560923674 27.789978039528844 23.730618220536368 140-144 18.997693436779198 29.104634095198158 28.342769273782064 23.55490319424058 145-149 19.759211966435608 28.87997081357169 27.989784750091207 23.371032469901497 150 19.136480058543725 28.905964141968532 28.247347237467984 23.71020856201976 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.5 20 1.5 21 2.5 22 1.5 23 2.0 24 4.5 25 4.5 26 7.5 27 8.0 28 15.0 29 26.5 30 25.5 31 35.0 32 56.5 33 78.5 34 97.0 35 118.0 36 130.0 37 150.5 38 194.0 39 210.0 40 226.0 41 243.0 42 251.0 43 259.0 44 277.0 45 269.0 46 225.5 47 201.5 48 174.5 49 151.5 50 136.5 51 107.5 52 81.0 53 65.0 54 51.0 55 36.0 56 20.5 57 15.5 58 12.0 59 7.0 60 5.0 61 3.5 62 3.0 63 2.5 64 1.5 65 0.5 66 1.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 15.0 100-101 36.0 102-103 44.0 104-105 46.0 106-107 36.0 108-109 51.0 110-111 45.0 112-113 68.0 114-115 55.0 116-117 56.0 118-119 56.0 120-121 55.0 122-123 52.0 124-125 49.0 126-127 63.0 128-129 65.0 130-131 60.0 132-133 67.0 134-135 58.0 136-137 28.0 138-139 68.0 140-141 66.0 142-143 63.0 144-145 65.0 146-147 0.0 148-149 0.0 150-151 2733.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.32189168573609 96.675 2 1.6526824307144674 3.25 3 0.02542588354945334 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGACTCA 10 0.008252796 136.1125 4 CGGACTC 10 0.008252796 136.1125 3 >>END_MODULE SRR8474569 read2 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474569_2.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.35625 6.0 6.0 6.0 1.0 6.0 4 5.85875 6.0 6.0 6.0 6.0 6.0 5 5.9025 6.0 6.0 6.0 6.0 6.0 6 9.6685 10.0 10.0 10.0 10.0 10.0 7 9.58125 10.0 10.0 10.0 10.0 10.0 8 9.89925 10.0 10.0 10.0 10.0 10.0 9 9.9115 10.0 10.0 10.0 10.0 10.0 10-14 9.91715 10.0 10.0 10.0 10.0 10.0 15-19 9.92235 10.0 10.0 10.0 10.0 10.0 20-24 9.857850000000001 10.0 10.0 10.0 10.0 10.0 25-29 9.9023 10.0 10.0 10.0 10.0 10.0 30-34 9.9279 10.0 10.0 10.0 10.0 10.0 35-39 9.91995 10.0 10.0 10.0 10.0 10.0 40-44 9.940949999999999 10.0 10.0 10.0 10.0 10.0 45-49 9.904250000000001 10.0 10.0 10.0 10.0 10.0 50-54 9.89365 10.0 10.0 10.0 10.0 10.0 55-59 9.9083 10.0 10.0 10.0 10.0 10.0 60-64 9.886849999999999 10.0 10.0 10.0 10.0 10.0 65-69 9.881649999999999 10.0 10.0 10.0 10.0 10.0 70-74 9.880350000000002 10.0 10.0 10.0 10.0 10.0 75-79 9.8163 10.0 10.0 10.0 10.0 10.0 80-84 9.81765 10.0 10.0 10.0 10.0 10.0 85-89 9.87305 10.0 10.0 10.0 10.0 10.0 90-94 9.816300000000002 10.0 10.0 10.0 10.0 10.0 95-99 9.8408 10.0 10.0 10.0 10.0 10.0 100-104 9.797771872889133 10.0 10.0 10.0 10.0 10.0 105-109 9.76065129977508 10.0 10.0 10.0 10.0 10.0 110-114 9.70851712412691 10.0 10.0 10.0 10.0 10.0 115-119 9.561046530648778 10.0 10.0 10.0 8.4 10.0 120-124 9.523095582434618 10.0 10.0 10.0 8.4 10.0 125-129 9.546593429960591 10.0 10.0 10.0 9.2 10.0 130-134 9.539102954866772 10.0 10.0 10.0 8.4 10.0 135-139 9.418669413036458 10.0 10.0 10.0 6.8 10.0 140-144 9.276575232768874 10.0 10.0 10.0 6.0 10.0 145-149 9.139997141955734 10.0 10.0 10.0 6.0 10.0 150 9.133918770581777 10.0 10.0 10.0 6.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 39.0 9 3961.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.35 18.675 21.4 27.575 2 24.525 29.349999999999998 30.175 15.950000000000001 3 21.525 33.375 27.250000000000004 17.849999999999998 4 26.1 35.199999999999996 22.45 16.25 5 26.0 38.0 21.3 14.7 6 19.0 39.925 25.35 15.725 7 20.225 20.05 40.300000000000004 19.425 8 22.3 23.45 31.15 23.1 9 23.549999999999997 23.775 30.975 21.7 10-14 24.735 29.12 26.6 19.545 15-19 23.494999999999997 27.425 29.625 19.455 20-24 23.57 28.49 29.09 18.85 25-29 23.62 28.744999999999997 28.494999999999997 19.139999999999997 30-34 23.405 27.744999999999997 29.565 19.285 35-39 23.35 28.475 28.815 19.36 40-44 23.32 27.76 29.609999999999996 19.31 45-49 23.315 28.03 29.29 19.365 50-54 23.46 27.62 30.044999999999998 18.875 55-59 23.685000000000002 28.18 29.04 19.095000000000002 60-64 23.52 27.785 29.665000000000003 19.03 65-69 22.56 27.74 30.740000000000002 18.96 70-74 23.53 27.96 29.604999999999997 18.905 75-79 23.080000000000002 27.644999999999996 30.04 19.235 80-84 23.544999999999998 27.805000000000003 29.765000000000004 18.884999999999998 85-89 23.515 28.249999999999996 29.505 18.73 90-94 23.06 28.075 29.609999999999996 19.255 95-99 22.994999999999997 27.644999999999996 30.354999999999997 19.005 100-104 22.921735604217357 28.386050283860502 29.714111922141118 18.97810218978102 105-109 22.253462459648027 28.15266062688743 30.240549828178693 19.353327085285848 110-114 23.312190926682433 28.05310685874006 30.02042571490002 18.61427649967749 115-119 22.98233847529622 28.303152246814218 29.879275653923543 18.83523362396602 120-124 22.66402747860511 28.42754846597194 30.011061302905045 18.897362752517903 125-129 23.29738245273873 28.85967038293747 29.5261754726127 18.3167716917111 130-134 22.901297379801576 28.943017044009157 29.311879928771305 18.84380564741796 135-139 23.244825979902842 28.588540626871634 29.247354761429428 18.9192786317961 140-144 22.68120500454323 28.384706786887538 29.887467673166977 19.04662053540225 145-149 22.553812477198104 29.055089383436698 29.33965705946735 19.051441079897845 150 22.64910354921332 27.954628613245518 29.967069154774972 19.42919868276619 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 2.5 25 3.0 26 4.0 27 7.5 28 9.5 29 19.5 30 22.5 31 30.0 32 45.5 33 59.5 34 85.0 35 93.5 36 111.0 37 153.5 38 173.0 39 199.0 40 246.5 41 267.5 42 285.0 43 299.5 44 279.5 45 249.0 46 231.0 47 229.0 48 214.5 49 169.5 50 122.0 51 93.5 52 78.5 53 62.0 54 47.0 55 34.0 56 19.5 57 16.5 58 13.5 59 5.5 60 3.5 61 3.0 62 3.5 63 3.5 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 15.0 100-101 36.0 102-103 44.0 104-105 46.0 106-107 36.0 108-109 51.0 110-111 45.0 112-113 68.0 114-115 55.0 116-117 56.0 118-119 56.0 120-121 55.0 122-123 52.0 124-125 49.0 126-127 63.0 128-129 65.0 130-131 60.0 132-133 67.0 134-135 58.0 136-137 28.0 138-139 68.0 140-141 66.0 142-143 63.0 144-145 65.0 146-147 0.0 148-149 0.0 150-151 2733.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4251968503937 96.875 2 1.5494030988061978 3.05 3 0.025400050800101596 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGTTGA 10 0.008252796 136.1125 4 >>END_MODULE Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189896 spots for SRR8474569.sra Written 1189896 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra Read 1189878 spots for SRR8474569.sra Written 1189878 spots for SRR8474569.sra SRR ids: ['SRR8474569.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zi82j1l3 SRR8474569.sra spots: 23797578 blocks: [[1, 1189878], [1189879, 2379756], [2379757, 3569634], [3569635, 4759512], [4759513, 5949390], [5949391, 7139268], [7139269, 8329146], [8329147, 9519024], [9519025, 10708902], [10708903, 11898780], [11898781, 13088658], [13088659, 14278536], [14278537, 15468414], [15468415, 16658292], [16658293, 17848170], [17848171, 19038048], [19038049, 20227926], [20227927, 21417804], [21417805, 22607682], [22607683, 23797578]] SRR8474569 file size 8576830 SRR8474569 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8474569 SRR8474569_1.fastq SRR8474569_2.fastq Input file: SRR8474569_1.fastq Paired file: SRR8474569_2.fastq trimmed: SRR8474569-trimmed-pair1.fastq, SRR8474569-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:54:06 2025 >> started Tue Feb 11 14:54:35 2025 >> done (29.232s) 23797578 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 91 ( 0.00%) empty read pairs filtered out after trimming by size control 23797487 (100.00%) read pairs available; of these: 1522052 ( 6.40%) trimmed read pairs available after processing 22275435 (93.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 3 0.00% 25 1 0.00% 26 3 0.00% 27 1 0.00% 28 1 0.00% 29 3 0.00% 30 4 0.00% 31 1 0.00% 32 4 0.00% 33 0 0.00% 34 1 0.00% 35 1 0.00% 36 1 0.00% 37 3 0.00% 38 2 0.00% 39 6 0.00% 40 6 0.00% 41 2 0.00% 42 3 0.00% 43 1 0.00% 44 3 0.00% 45 7 0.00% 46 5 0.00% 47 6 0.00% 48 3 0.00% 49 11 0.00% 50 4 0.00% 51 4 0.00% 52 5 0.00% 53 6 0.00% 54 8 0.00% 55 7 0.00% 56 5 0.00% 57 3 0.00% 58 9 0.00% 59 7 0.00% 60 8 0.00% 61 15 0.00% 62 10 0.00% 63 13 0.00% 64 8 0.00% 65 14 0.00% 66 17 0.00% 67 7 0.00% 68 13 0.00% 69 12 0.00% 70 5 0.00% 71 11 0.00% 72 15 0.00% 73 16 0.00% 74 17 0.00% 75 13 0.00% 76 18 0.00% 77 11 0.00% 78 18 0.00% 79 24 0.00% 80 15 0.00% 81 23 0.00% 82 22 0.00% 83 18 0.00% 84 27 0.00% 85 20 0.00% 86 25 0.00% 87 28 0.00% 88 35 0.00% 89 20 0.00% 90 31 0.00% 91 20 0.00% 92 28 0.00% 93 48 0.00% 94 89 0.00% 95 89 0.00% 96 108 0.00% 97 88 0.00% 98 118 0.00% 99 24033 0.10% 100 24351 0.10% 101 26160 0.11% 102 25975 0.11% 103 27087 0.11% 104 28312 0.12% 105 30377 0.13% 106 32218 0.14% 107 34729 0.15% 108 36929 0.16% 109 38468 0.16% 110 39944 0.17% 111 40167 0.17% 112 40532 0.17% 113 41561 0.17% 114 43164 0.18% 115 44724 0.19% 116 45639 0.19% 117 48863 0.21% 118 51341 0.22% 119 54299 0.23% 120 55409 0.23% 121 56706 0.24% 122 56733 0.24% 123 57341 0.24% 124 57172 0.24% 125 59257 0.25% 126 61647 0.26% 127 64390 0.27% 128 67013 0.28% 129 70328 0.30% 130 72609 0.31% 131 74405 0.31% 132 73885 0.31% 133 74262 0.31% 134 74531 0.31% 135 74941 0.31% 136 75794 0.32% 137 4236 0.02% 138 80222 0.34% 139 83452 0.35% 140 86188 0.36% 141 89839 0.38% 142 92295 0.39% 143 95091 0.40% 144 100739 0.42% 145 139694 0.59% 146 94318 0.40% 147 108395 0.46% 148 196669 0.83% 149 1051321 4.42% 150 19668472 82.65% 23797487 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=23.59 fanout-score-rank=11 prefix-density=0.34 prefix-fanout=8.4 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=15 fanout-score=481.77 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=31.2 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=35 prefix-density=0.17 prefix-fanout=2.1 sequence=AAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCTGCTGCTTTGTTGGTTCCATTCCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=398.12 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=25.1 sequence=AAGAAGAAGAAA SRR8474569 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:55:23 Started mapping on | Feb 11 14:55:23 Finished on | Feb 11 15:00:53 Mapping speed, Million of reads per hour | 259.61 Number of input reads | 23797487 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 20355006 Uniquely mapped reads % | 85.53% Average mapped length | 288.01 Number of splices: Total | 17165629 Number of splices: Annotated (sjdb) | 16726304 Number of splices: GT/AG | 16805042 Number of splices: GC/AG | 232598 Number of splices: AT/AC | 16368 Number of splices: Non-canonical | 111621 Mismatch rate per base, % | 1.57% Deletion rate per base | 0.10% Deletion average length | 2.96 Insertion rate per base | 0.06% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 928637 % of reads mapped to multiple loci | 3.90% Number of reads mapped to too many loci | 201066 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.04% % of reads unmapped: other | 0.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2513844 2513844 2513844 N_multimapping 928637 928637 928637 N_noFeature 658399 20108230 801063 N_ambiguous 278375 1925 173160 UnstrandedReadsAssigned:19418232 PositiveStrandReadsAssigned:244851 NegativeStrandReadsAssigned:19380783 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=135 echo kmer=131 SRR8474569 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8474569-trimmed-pair1.fastq SRR8474569-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,797,487 reads, 20,121,156 reads pseudoaligned [quant] estimated average fragment length: 179.516 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR8474569.ke.tsv 34699 SRR8474569.se.tsv 87100 total ==> SRR8474569.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1839.48 2282 70.5165 Potri.005G024800.1.v4.1 1035 856.484 2256 149.724 Potri.004G059700.1.v4.1 961 782.493 64 4.64912 Potri.007G009000.2.v4.1 1416 1237.48 0 0 Potri.003G141000.2.v4.1 2943 2764.48 786.984 16.1817 Potri.016G087400.1.v4.1 270 99.2052 1235.1 707.681 Potri.015G069301.1.v4.1 564 385.542 0 0 Potri.010G195200.1.v4.1 1773 1594.48 32 1.14078 Potri.012G127500.1.v4.1 977 798.493 15303 1089.37 ==> SRR8474569.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 101 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 64 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR8474569 completed mapping pipeline successfully