Starting /dee2/code/volunteer_pipeline.sh SRR8474570 current disk space = 3049479471104 free memory = 1580003320 SRR8474570 SRAfilesize f759cae55daf19fbfd7586fa6c6ffd69 SRR8474570.sra SRR8474570.sra file validated SRR8474570 is paired end SRR8474570 is conventional basespace SRR8474570 read1 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474570_1.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.8 6.0 6.0 6.0 6.0 6.0 4 5.95625 6.0 6.0 6.0 6.0 6.0 5 5.99625 6.0 6.0 6.0 6.0 6.0 6 9.91675 10.0 10.0 10.0 10.0 10.0 7 9.858 10.0 10.0 10.0 10.0 10.0 8 9.96575 10.0 10.0 10.0 10.0 10.0 9 9.888 10.0 10.0 10.0 10.0 10.0 10-14 9.9573 10.0 10.0 10.0 10.0 10.0 15-19 9.957049999999999 10.0 10.0 10.0 10.0 10.0 20-24 9.949349999999999 10.0 10.0 10.0 10.0 10.0 25-29 9.9474 10.0 10.0 10.0 10.0 10.0 30-34 9.9285 10.0 10.0 10.0 10.0 10.0 35-39 9.946700000000002 10.0 10.0 10.0 10.0 10.0 40-44 9.9443 10.0 10.0 10.0 10.0 10.0 45-49 9.922149999999998 10.0 10.0 10.0 10.0 10.0 50-54 9.93465 10.0 10.0 10.0 10.0 10.0 55-59 9.89425 10.0 10.0 10.0 10.0 10.0 60-64 9.9078 10.0 10.0 10.0 10.0 10.0 65-69 9.9167 10.0 10.0 10.0 10.0 10.0 70-74 9.84345 10.0 10.0 10.0 10.0 10.0 75-79 9.858600000000001 10.0 10.0 10.0 10.0 10.0 80-84 9.8889 10.0 10.0 10.0 10.0 10.0 85-89 9.86635 10.0 10.0 10.0 10.0 10.0 90-94 9.89495 10.0 10.0 10.0 10.0 10.0 95-99 9.82405 10.0 10.0 10.0 10.0 10.0 100-104 9.82958684085055 10.0 10.0 10.0 10.0 10.0 105-109 9.82430424067987 10.0 10.0 10.0 10.0 10.0 110-114 9.865072312944463 10.0 10.0 10.0 10.0 10.0 115-119 9.84556565134764 10.0 10.0 10.0 10.0 10.0 120-124 9.832977892867735 10.0 10.0 10.0 10.0 10.0 125-129 9.821765372071209 10.0 10.0 10.0 10.0 10.0 130-134 9.769230162214711 10.0 10.0 10.0 10.0 10.0 135-139 9.752360003060346 10.0 10.0 10.0 10.0 10.0 140-144 9.655778227403825 10.0 10.0 10.0 9.2 10.0 145-149 9.569403463490989 10.0 10.0 10.0 9.2 10.0 150 9.599699586932031 10.0 10.0 10.0 10.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 9.0 9 3991.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.25 10.775 17.925 35.05 2 22.8 16.400000000000002 30.625000000000004 30.175 3 21.475 23.3 24.025 31.2 4 24.975 31.45 20.175 23.400000000000002 5 22.475 34.599999999999994 23.625 19.3 6 15.525 37.95 25.974999999999998 20.549999999999997 7 12.3 27.250000000000004 40.5 19.950000000000003 8 16.125 26.6 33.75 23.525 9 16.975 22.525000000000002 35.8 24.7 10-14 19.185 31.045 27.855 21.915000000000003 15-19 19.195 29.615000000000002 28.694999999999997 22.495 20-24 18.740000000000002 30.3 28.76 22.2 25-29 18.825 29.39 28.43 23.355 30-34 18.285 30.525000000000002 28.110000000000003 23.080000000000002 35-39 19.09 30.185000000000002 27.99 22.735 40-44 18.985 30.37 28.765 21.88 45-49 18.815 30.205 28.735 22.245 50-54 18.88 30.025000000000002 28.79 22.305 55-59 19.2 30.064999999999998 27.77 22.965 60-64 18.305 29.695 28.765 23.235 65-69 18.545 29.505 29.035 22.915 70-74 18.575 30.495 28.439999999999998 22.49 75-79 18.93 29.935000000000002 28.455000000000002 22.68 80-84 18.455 30.014999999999997 28.125 23.405 85-89 18.42 30.125 28.26 23.195 90-94 18.665000000000003 29.875 28.765 22.695 95-99 18.64 29.645 28.515 23.200000000000003 100-104 18.540524070688605 29.65671338614666 28.45317895592119 23.34958358724355 105-109 18.75688434303698 29.65643849986887 27.883556254917387 23.703120902176764 110-114 18.767294232542998 30.258803103466985 28.08854647062015 22.885356193369866 115-119 19.139566395663955 29.90627822944896 28.359304426377598 22.594850948509485 120-124 19.218528995756717 28.907355021216407 28.164780763790663 23.70933521923621 125-129 18.368100424589258 30.059688634545566 28.219801858347175 23.352409082518 130-134 18.557033974938637 29.233949102183182 29.020798346466865 23.188218576411316 135-139 18.248622167789343 29.55705245968565 28.692930530040144 23.50139484248486 140-144 18.48074179743224 29.87874465049929 28.737517831669045 22.90299572039943 145-149 19.0936329588015 30.29962546816479 27.677902621722843 22.928838951310862 150 18.400300413067967 29.215170859932403 28.051070221554635 24.333458505444987 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.5 20 1.0 21 0.5 22 1.0 23 3.0 24 4.0 25 5.5 26 8.5 27 13.0 28 17.5 29 25.5 30 35.0 31 42.5 32 58.0 33 71.5 34 90.0 35 107.0 36 123.0 37 145.5 38 186.5 39 213.5 40 238.0 41 265.5 42 279.5 43 303.5 44 294.5 45 280.0 46 246.5 47 198.5 48 173.5 49 148.5 50 115.5 51 82.0 52 64.5 53 49.0 54 31.5 55 23.0 56 20.5 57 13.5 58 5.0 59 3.0 60 2.5 61 1.5 62 0.5 63 1.0 64 1.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 20.0 100-101 38.0 102-103 55.0 104-105 44.0 106-107 57.0 108-109 45.0 110-111 57.0 112-113 56.0 114-115 59.0 116-117 54.0 118-119 54.0 120-121 71.0 122-123 56.0 124-125 53.0 126-127 62.0 128-129 53.0 130-131 68.0 132-133 71.0 134-135 72.0 136-137 27.0 138-139 54.0 140-141 64.0 142-143 81.0 144-145 66.0 146-147 0.0 148-149 0.0 150-151 2663.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2442748091603 96.525 2 1.7302798982188294 3.4000000000000004 3 0.02544529262086514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGCAG 10 0.008630993 134.0875 5 >>END_MODULE SRR8474570 read2 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474570_2.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.27 6.0 6.0 6.0 1.0 6.0 4 5.82625 6.0 6.0 6.0 6.0 6.0 5 5.8725 6.0 6.0 6.0 6.0 6.0 6 9.60625 10.0 10.0 10.0 10.0 10.0 7 9.64525 10.0 10.0 10.0 10.0 10.0 8 9.91675 10.0 10.0 10.0 10.0 10.0 9 9.8835 10.0 10.0 10.0 10.0 10.0 10-14 9.891950000000001 10.0 10.0 10.0 10.0 10.0 15-19 9.925900000000002 10.0 10.0 10.0 10.0 10.0 20-24 9.8263 10.0 10.0 10.0 10.0 10.0 25-29 9.8792 10.0 10.0 10.0 10.0 10.0 30-34 9.91355 10.0 10.0 10.0 10.0 10.0 35-39 9.922550000000001 10.0 10.0 10.0 10.0 10.0 40-44 9.9418 10.0 10.0 10.0 10.0 10.0 45-49 9.922 10.0 10.0 10.0 10.0 10.0 50-54 9.88455 10.0 10.0 10.0 10.0 10.0 55-59 9.905899999999999 10.0 10.0 10.0 10.0 10.0 60-64 9.8669 10.0 10.0 10.0 10.0 10.0 65-69 9.87395 10.0 10.0 10.0 10.0 10.0 70-74 9.8768 10.0 10.0 10.0 10.0 10.0 75-79 9.811150000000001 10.0 10.0 10.0 10.0 10.0 80-84 9.80905 10.0 10.0 10.0 10.0 10.0 85-89 9.859399999999999 10.0 10.0 10.0 10.0 10.0 90-94 9.797450000000001 10.0 10.0 10.0 10.0 10.0 95-99 9.846350000000001 10.0 10.0 10.0 10.0 10.0 100-104 9.794681208410434 10.0 10.0 10.0 10.0 10.0 105-109 9.758464130956105 10.0 10.0 10.0 10.0 10.0 110-114 9.681328598764045 10.0 10.0 10.0 10.0 10.0 115-119 9.567901792492927 10.0 10.0 10.0 8.4 10.0 120-124 9.490789116915831 10.0 10.0 10.0 7.6 10.0 125-129 9.570735841401572 10.0 10.0 10.0 9.2 10.0 130-134 9.566928195747856 10.0 10.0 10.0 9.2 10.0 135-139 9.42246425898653 10.0 10.0 10.0 6.8 10.0 140-144 9.26667056771922 10.0 10.0 10.0 6.0 10.0 145-149 9.146624570237003 10.0 10.0 10.0 6.0 10.0 150 9.067217423957942 10.0 10.0 10.0 6.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 43.0 9 3957.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.5 17.724999999999998 21.5 26.275 2 23.674999999999997 30.725 28.425 17.175 3 23.474999999999998 33.425 26.25 16.85 4 26.900000000000002 33.925 21.85 17.325 5 24.9 39.025 22.15 13.925 6 18.575 40.675 24.95 15.8 7 19.45 20.275000000000002 41.375 18.9 8 23.075000000000003 22.625 30.675 23.625 9 23.225 23.599999999999998 31.025000000000002 22.15 10-14 23.990000000000002 29.2 27.265 19.545 15-19 23.474999999999998 28.13 29.18 19.215 20-24 23.44 28.110000000000003 29.595 18.855 25-29 23.41 28.134999999999998 29.39 19.064999999999998 30-34 23.715 28.43 29.025000000000002 18.83 35-39 23.380000000000003 28.610000000000003 29.12 18.89 40-44 23.86 28.38 29.220000000000002 18.54 45-49 22.925 27.800000000000004 29.81 19.465 50-54 22.965 28.455000000000002 29.4 19.18 55-59 23.48 27.485 30.009999999999998 19.025 60-64 23.369999999999997 28.015 29.42 19.195 65-69 23.525 27.785 29.64 19.05 70-74 23.13 28.73 29.294999999999998 18.845 75-79 23.32 28.595 30.3 17.785 80-84 23.474999999999998 28.425 29.38 18.72 85-89 23.044999999999998 28.144999999999996 30.285 18.525 90-94 23.05 28.425 29.81 18.715 95-99 22.515 28.549999999999997 30.11 18.825 100-104 23.308957952468006 28.366849482023156 29.839528742636606 18.484663822872232 105-109 23.262522947810123 28.47102019407291 29.73511670600577 18.5313401521112 110-114 23.292279312028647 28.424936248711408 29.56974662253812 18.71303781672183 115-119 22.713414634146343 28.754516711833784 29.736901535682026 18.79516711833785 120-124 22.454031117397456 28.453559641678456 30.015322960867515 19.077086280056577 125-129 22.823210879330503 28.87206941111316 29.493569626484522 18.811150083071812 130-134 23.09133186926754 27.67084356026353 30.125306807905954 19.112517762562977 135-139 22.501190719194394 28.801796284956115 29.965299040620536 18.731713955228958 140-144 22.496433666191155 28.445078459343794 29.92154065620542 19.13694721825963 145-149 22.074906367041198 29.318352059925097 29.49812734082397 19.10861423220974 150 21.479534359744648 28.952309425460008 30.266616597822004 19.301539616973336 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 0.5 25 6.0 26 9.5 27 10.0 28 14.5 29 15.5 30 25.5 31 36.0 32 36.5 33 49.5 34 73.5 35 96.0 36 122.5 37 155.0 38 188.0 39 219.0 40 250.0 41 283.5 42 297.0 43 286.5 44 289.5 45 276.5 46 243.0 47 212.5 48 197.0 49 165.5 50 113.5 51 86.0 52 64.5 53 53.0 54 40.5 55 26.0 56 16.0 57 9.5 58 10.0 59 8.5 60 4.0 61 1.5 62 1.0 63 0.5 64 1.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 20.0 100-101 38.0 102-103 55.0 104-105 44.0 106-107 57.0 108-109 45.0 110-111 57.0 112-113 56.0 114-115 59.0 116-117 54.0 118-119 54.0 120-121 71.0 122-123 56.0 124-125 53.0 126-127 62.0 128-129 53.0 130-131 68.0 132-133 71.0 134-135 72.0 136-137 27.0 138-139 54.0 140-141 64.0 142-143 81.0 144-145 66.0 146-147 0.0 148-149 0.0 150-151 2663.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.16700610997964 96.39999999999999 2 1.8329938900203666 3.5999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra Read 1669832 spots for SRR8474570.sra Written 1669832 spots for SRR8474570.sra Read 1669829 spots for SRR8474570.sra Written 1669829 spots for SRR8474570.sra SRR ids: ['SRR8474570.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_idvtrigz SRR8474570.sra spots: 33396583 blocks: [[1, 1669829], [1669830, 3339658], [3339659, 5009487], [5009488, 6679316], [6679317, 8349145], [8349146, 10018974], [10018975, 11688803], [11688804, 13358632], [13358633, 15028461], [15028462, 16698290], [16698291, 18368119], [18368120, 20037948], [20037949, 21707777], [21707778, 23377606], [23377607, 25047435], [25047436, 26717264], [26717265, 28387093], [28387094, 30056922], [30056923, 31726751], [31726752, 33396583]] SRR8474570 file size 12031538 SRR8474570 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8474570 SRR8474570_1.fastq SRR8474570_2.fastq Input file: SRR8474570_1.fastq Paired file: SRR8474570_2.fastq trimmed: SRR8474570-trimmed-pair1.fastq, SRR8474570-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:56:04 2025 >> started Tue Feb 11 15:56:42 2025 >> done (38.293s) 32147043 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 6 ( 0.00%) empty read pairs filtered out after trimming by size control 32147035 (100.00%) read pairs available; of these: 1801602 ( 5.60%) trimmed read pairs available after processing 30345433 (94.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 1 0.00% 29 0 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 1 0.00% 34 0 0.00% 35 0 0.00% 36 1 0.00% 37 0 0.00% 38 1 0.00% 39 0 0.00% 40 3 0.00% 41 2 0.00% 42 1 0.00% 43 4 0.00% 44 3 0.00% 45 1 0.00% 46 4 0.00% 47 3 0.00% 48 1 0.00% 49 2 0.00% 50 4 0.00% 51 4 0.00% 52 4 0.00% 53 2 0.00% 54 3 0.00% 55 6 0.00% 56 3 0.00% 57 4 0.00% 58 6 0.00% 59 0 0.00% 60 7 0.00% 61 10 0.00% 62 10 0.00% 63 8 0.00% 64 9 0.00% 65 9 0.00% 66 14 0.00% 67 7 0.00% 68 8 0.00% 69 19 0.00% 70 10 0.00% 71 13 0.00% 72 10 0.00% 73 16 0.00% 74 12 0.00% 75 9 0.00% 76 17 0.00% 77 11 0.00% 78 7 0.00% 79 18 0.00% 80 12 0.00% 81 15 0.00% 82 25 0.00% 83 18 0.00% 84 19 0.00% 85 16 0.00% 86 31 0.00% 87 27 0.00% 88 29 0.00% 89 22 0.00% 90 25 0.00% 91 32 0.00% 92 27 0.00% 93 47 0.00% 94 114 0.00% 95 92 0.00% 96 146 0.00% 97 122 0.00% 98 147 0.00% 99 34206 0.11% 100 35351 0.11% 101 36599 0.11% 102 37070 0.12% 103 39324 0.12% 104 40613 0.13% 105 43696 0.14% 106 46187 0.14% 107 49602 0.15% 108 52620 0.16% 109 55554 0.17% 110 57400 0.18% 111 58723 0.18% 112 58937 0.18% 113 60425 0.19% 114 62528 0.19% 115 65394 0.20% 116 66788 0.21% 117 70300 0.22% 118 74849 0.23% 119 79651 0.25% 120 81251 0.25% 121 83159 0.26% 122 83414 0.26% 123 84043 0.26% 124 85331 0.27% 125 87437 0.27% 126 90323 0.28% 127 93890 0.29% 128 98217 0.31% 129 103372 0.32% 130 106554 0.33% 131 110524 0.34% 132 110666 0.34% 133 110941 0.35% 134 111252 0.35% 135 111626 0.35% 136 112361 0.35% 137 5491 0.02% 138 118596 0.37% 139 123573 0.38% 140 127411 0.40% 141 133957 0.42% 142 138901 0.43% 143 143072 0.45% 144 149100 0.46% 145 201446 0.63% 146 140050 0.44% 147 153202 0.48% 148 235087 0.73% 149 1186570 3.69% 150 26499143 82.43% 32147035 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=33 prefix-density=0.21 prefix-fanout=2.0 sequence=TTAATTTACAGCAAATACTATATTAGACAAACATGGAGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=442.39 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=28.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=35 prefix-density=0.21 prefix-fanout=2.1 sequence=CACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=550.45 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=40.1 sequence=TGATGATGAAGA SRR8474570 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:57:29 Started mapping on | Feb 11 15:57:29 Finished on | Feb 11 16:03:51 Mapping speed, Million of reads per hour | 302.96 Number of input reads | 32147035 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 28441718 Uniquely mapped reads % | 88.47% Average mapped length | 288.48 Number of splices: Total | 24070023 Number of splices: Annotated (sjdb) | 23435288 Number of splices: GT/AG | 23565257 Number of splices: GC/AG | 326575 Number of splices: AT/AC | 23802 Number of splices: Non-canonical | 154389 Mismatch rate per base, % | 1.51% Deletion rate per base | 0.10% Deletion average length | 2.94 Insertion rate per base | 0.07% Insertion average length | 2.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1256625 % of reads mapped to multiple loci | 3.91% Number of reads mapped to too many loci | 233929 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.38% % of reads unmapped: other | 0.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2448693 2448693 2448693 N_multimapping 1256625 1256625 1256625 N_noFeature 997010 28071607 1218131 N_ambiguous 392777 2537 242264 UnstrandedReadsAssigned:27051931 PositiveStrandReadsAssigned:367574 NegativeStrandReadsAssigned:26981323 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=135 echo kmer=131 SRR8474570 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8474570-trimmed-pair1.fastq SRR8474570-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,147,035 reads, 27,215,952 reads pseudoaligned [quant] estimated average fragment length: 177.742 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,210 rounds 52401 SRR8474570.ke.tsv 34699 SRR8474570.se.tsv 87100 total ==> SRR8474570.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1841.26 3111 70.8947 Potri.005G024800.1.v4.1 1035 858.258 4311 210.76 Potri.004G059700.1.v4.1 961 784.263 80 4.28013 Potri.007G009000.2.v4.1 1416 1239.26 0 0 Potri.003G141000.2.v4.1 2943 2766.26 1160 17.5952 Potri.016G087400.1.v4.1 270 99.8175 1528.8 642.648 Potri.015G069301.1.v4.1 564 387.317 0 0 Potri.010G195200.1.v4.1 1773 1596.26 77 2.02403 Potri.012G127500.1.v4.1 977 800.263 21123 1107.52 ==> SRR8474570.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 184 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 119 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 72 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 91 SRR8474570 completed mapping pipeline successfully