Starting /dee2/code/volunteer_pipeline.sh SRR8474571 current disk space = 3050185195520 free memory = 1417228816 SRR8474571 SRAfilesize e200458cff09a2d43468549ac45350c7 SRR8474571.sra SRR8474571.sra file validated SRR8474571 is paired end SRR8474571 is conventional basespace SRR8474571 read1 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474571_1.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.805 6.0 6.0 6.0 6.0 6.0 4 5.9475 6.0 6.0 6.0 6.0 6.0 5 5.99375 6.0 6.0 6.0 6.0 6.0 6 9.9255 10.0 10.0 10.0 10.0 10.0 7 9.859 10.0 10.0 10.0 10.0 10.0 8 9.96675 10.0 10.0 10.0 10.0 10.0 9 9.8825 10.0 10.0 10.0 10.0 10.0 10-14 9.960550000000001 10.0 10.0 10.0 10.0 10.0 15-19 9.964949999999998 10.0 10.0 10.0 10.0 10.0 20-24 9.958950000000002 10.0 10.0 10.0 10.0 10.0 25-29 9.9647 10.0 10.0 10.0 10.0 10.0 30-34 9.940349999999999 10.0 10.0 10.0 10.0 10.0 35-39 9.947 10.0 10.0 10.0 10.0 10.0 40-44 9.94945 10.0 10.0 10.0 10.0 10.0 45-49 9.937149999999999 10.0 10.0 10.0 10.0 10.0 50-54 9.940850000000001 10.0 10.0 10.0 10.0 10.0 55-59 9.89715 10.0 10.0 10.0 10.0 10.0 60-64 9.92365 10.0 10.0 10.0 10.0 10.0 65-69 9.93245 10.0 10.0 10.0 10.0 10.0 70-74 9.84805 10.0 10.0 10.0 10.0 10.0 75-79 9.85045 10.0 10.0 10.0 10.0 10.0 80-84 9.898599999999998 10.0 10.0 10.0 10.0 10.0 85-89 9.89025 10.0 10.0 10.0 10.0 10.0 90-94 9.89495 10.0 10.0 10.0 10.0 10.0 95-99 9.842749999999999 10.0 10.0 10.0 10.0 10.0 100-104 9.858679452172368 10.0 10.0 10.0 10.0 10.0 105-109 9.853445296048516 10.0 10.0 10.0 10.0 10.0 110-114 9.87858454723166 10.0 10.0 10.0 10.0 10.0 115-119 9.865958364877711 10.0 10.0 10.0 10.0 10.0 120-124 9.855877197065212 10.0 10.0 10.0 10.0 10.0 125-129 9.840420565349492 10.0 10.0 10.0 10.0 10.0 130-134 9.768446223843501 10.0 10.0 10.0 10.0 10.0 135-139 9.769941135726267 10.0 10.0 10.0 10.0 10.0 140-144 9.674668998055798 10.0 10.0 10.0 10.0 10.0 145-149 9.629445317108882 10.0 10.0 10.0 9.2 10.0 150 9.63173007896626 10.0 10.0 10.0 10.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 6.0 9 3994.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.5 10.4 17.424999999999997 35.675000000000004 2 23.45 15.275 30.875000000000004 30.4 3 20.95 21.55 25.575 31.924999999999997 4 24.875 30.049999999999997 20.525 24.55 5 23.225 33.800000000000004 22.525000000000002 20.45 6 16.525000000000002 37.85 25.85 19.775000000000002 7 12.975 30.175 38.9 17.95 8 16.075 26.3 33.800000000000004 23.825 9 16.6 23.5 34.75 25.15 10-14 18.87 31.495 27.595 22.040000000000003 15-19 18.315 29.62 29.475 22.59 20-24 18.905 30.154999999999998 28.565 22.375 25-29 18.815 30.665 27.98 22.54 30-34 18.64 30.595 27.97 22.795 35-39 18.795 30.185000000000002 27.91 23.11 40-44 18.965 30.78 27.465 22.79 45-49 18.845 30.28 28.15 22.725 50-54 18.985 30.53 28.18 22.305 55-59 18.69 30.175 28.04 23.095 60-64 19.009999999999998 29.7 28.494999999999997 22.795 65-69 18.21 29.925 28.389999999999997 23.474999999999998 70-74 18.525 30.48 27.805000000000003 23.189999999999998 75-79 18.685 30.209999999999997 27.76 23.345 80-84 19.145 29.775000000000002 28.525 22.555 85-89 18.884999999999998 30.06 28.110000000000003 22.945 90-94 18.575 29.494999999999997 28.560000000000002 23.369999999999997 95-99 18.75 30.135 28.29 22.825 100-104 18.581919473284376 30.1696632058749 27.96150924284629 23.28690807799443 105-109 18.79929431299294 29.48837691988377 28.585512660855127 23.126816106268162 110-114 18.885992445603023 29.733468106612758 28.009788796084482 23.37075065169974 115-119 18.83435244863108 29.416625351181626 28.689472814410845 23.059549385776457 120-124 18.699466712540858 29.577384024313318 27.90871036183267 23.81443890131315 125-129 18.98741725803566 29.530681614884607 28.77333174309738 22.70856938398235 130-134 17.99550112471882 29.142714321419643 28.592851787053235 24.268932766808298 135-139 18.52263078832212 29.18816537130168 28.86813402129188 23.42106981908432 140-144 18.589831437577086 28.915992873783747 28.82691517061806 23.667260518021106 145-149 19.15259089607787 29.17263097623819 28.836243916404236 22.8385342112797 150 19.310839913854988 28.85857860732233 28.966259870782483 22.8643216080402 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 2.0 24 5.5 25 7.5 26 8.5 27 9.0 28 10.0 29 17.0 30 32.0 31 44.0 32 58.0 33 76.0 34 96.5 35 116.0 36 133.0 37 157.0 38 181.5 39 218.0 40 262.5 41 267.5 42 255.5 43 268.0 44 270.0 45 254.0 46 239.5 47 216.0 48 183.0 49 149.0 50 119.5 51 95.0 52 62.0 53 41.5 54 42.0 55 33.5 56 22.5 57 16.0 58 9.0 59 4.0 60 2.0 61 3.5 62 2.0 63 0.0 64 1.0 65 1.0 66 0.5 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 18.0 100-101 28.0 102-103 43.0 104-105 38.0 106-107 40.0 108-109 38.0 110-111 36.0 112-113 40.0 114-115 65.0 116-117 50.0 118-119 60.0 120-121 57.0 122-123 47.0 124-125 49.0 126-127 76.0 128-129 53.0 130-131 60.0 132-133 63.0 134-135 59.0 136-137 32.0 138-139 64.0 140-141 66.0 142-143 58.0 144-145 74.0 146-147 0.0 148-149 0.0 150-151 2786.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.06221315655279 96.15 2 1.8867924528301887 3.6999999999999997 3 0.05099439061703213 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTGG 10 0.0088387 133.025 6 CATTTGA 10 0.0088387 133.025 5 CTGATCA 10 0.0088387 133.025 6 CAAACCC 10 0.0088387 133.025 8 TTTGATG 10 0.0088387 133.025 7 >>END_MODULE SRR8474571 read2 length is 99-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8474571_2.fastq File type Conventional base calls Encoding Illumina 1.3 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 99-150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 1.0 1.0 1.0 1.0 1.0 1.0 2 1.0 1.0 1.0 1.0 1.0 1.0 3 5.43125 6.0 6.0 6.0 1.0 6.0 4 5.805 6.0 6.0 6.0 6.0 6.0 5 5.875 6.0 6.0 6.0 6.0 6.0 6 9.63275 10.0 10.0 10.0 10.0 10.0 7 9.679 10.0 10.0 10.0 10.0 10.0 8 9.9225 10.0 10.0 10.0 10.0 10.0 9 9.91 10.0 10.0 10.0 10.0 10.0 10-14 9.907 10.0 10.0 10.0 10.0 10.0 15-19 9.9209 10.0 10.0 10.0 10.0 10.0 20-24 9.848099999999999 10.0 10.0 10.0 10.0 10.0 25-29 9.8976 10.0 10.0 10.0 10.0 10.0 30-34 9.9189 10.0 10.0 10.0 10.0 10.0 35-39 9.91775 10.0 10.0 10.0 10.0 10.0 40-44 9.943299999999999 10.0 10.0 10.0 10.0 10.0 45-49 9.9146 10.0 10.0 10.0 10.0 10.0 50-54 9.901599999999998 10.0 10.0 10.0 10.0 10.0 55-59 9.905650000000001 10.0 10.0 10.0 10.0 10.0 60-64 9.87715 10.0 10.0 10.0 10.0 10.0 65-69 9.881699999999999 10.0 10.0 10.0 10.0 10.0 70-74 9.886199999999999 10.0 10.0 10.0 10.0 10.0 75-79 9.826 10.0 10.0 10.0 10.0 10.0 80-84 9.8234 10.0 10.0 10.0 10.0 10.0 85-89 9.87595 10.0 10.0 10.0 10.0 10.0 90-94 9.818699999999998 10.0 10.0 10.0 10.0 10.0 95-99 9.85325 10.0 10.0 10.0 10.0 10.0 100-104 9.801578332126397 10.0 10.0 10.0 10.0 10.0 105-109 9.771716799748575 10.0 10.0 10.0 10.0 10.0 110-114 9.706813846404959 10.0 10.0 10.0 10.0 10.0 115-119 9.570297540223864 10.0 10.0 10.0 8.4 10.0 120-124 9.522424480335184 10.0 10.0 10.0 7.6 10.0 125-129 9.567173206969109 10.0 10.0 10.0 9.2 10.0 130-134 9.557336212169718 10.0 10.0 10.0 9.2 10.0 135-139 9.41107395181539 10.0 10.0 10.0 6.8 10.0 140-144 9.326317796955363 10.0 10.0 10.0 6.0 10.0 145-149 9.162844633350627 10.0 10.0 10.0 6.0 10.0 150 9.03445800430725 10.0 10.0 10.0 6.0 10.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 8 43.0 9 3957.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.275 18.075 19.950000000000003 27.700000000000003 2 24.6 29.275000000000002 29.525000000000002 16.6 3 21.775 33.825 26.950000000000003 17.45 4 26.275 35.425000000000004 22.2 16.1 5 26.85 36.575 21.975 14.6 6 18.2 40.425 24.95 16.425 7 20.075000000000003 20.275000000000002 40.325 19.325 8 22.075 24.224999999999998 30.225 23.474999999999998 9 23.849999999999998 24.2 29.65 22.3 10-14 23.849999999999998 29.310000000000002 26.85 19.99 15-19 23.3 28.095 28.62 19.985 20-24 23.24 28.694999999999997 28.810000000000002 19.255 25-29 23.395 29.04 29.025000000000002 18.54 30-34 23.64 28.09 29.34 18.93 35-39 23.43 27.810000000000002 29.81 18.95 40-44 23.645 27.91 29.165000000000003 19.28 45-49 23.169999999999998 28.425 29.67 18.735 50-54 23.39 28.005000000000003 29.709999999999997 18.895 55-59 23.575 28.33 29.595 18.5 60-64 23.24 28.625 29.085 19.05 65-69 23.7 28.895 28.9 18.505 70-74 23.385 28.67 28.9 19.045 75-79 22.775000000000002 28.310000000000002 29.785 19.13 80-84 23.05 27.82 30.18 18.95 85-89 23.16 28.26 29.735 18.845 90-94 23.18 28.415000000000003 29.455 18.95 95-99 23.215 28.26 30.09 18.435000000000002 100-104 23.398328690807798 28.371739680931878 29.94682198024816 18.283109648012154 105-109 23.111249481112495 27.32980489829805 30.6714404317144 18.88750518887505 110-114 22.82811086875565 28.797148481140606 29.361068255572697 19.013672394531042 115-119 23.25786371398667 28.689472814410845 29.93995482840302 18.112708643199472 120-124 23.068983313263374 28.33878089339985 29.93864327082975 18.653592522507022 125-129 22.863617389230125 29.172878525851274 29.602242232691278 18.361261852227322 130-134 23.131717070732314 28.567858035491128 30.05498625343664 18.245438640339913 135-139 22.976944680295215 28.13010254065704 30.089478152961924 18.80347462608582 140-144 22.358503494586817 28.64190763327395 30.43716595861313 18.562422913526106 145-149 22.516461494417406 29.072430575436588 29.509018036072142 18.90208989407386 150 22.36180904522613 28.320172290021535 30.940416367552046 18.377602297200287 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 1.5 24 2.0 25 3.5 26 5.0 27 5.5 28 8.5 29 14.5 30 16.5 31 20.0 32 41.0 33 60.0 34 75.0 35 104.0 36 125.5 37 156.0 38 194.0 39 215.5 40 254.0 41 287.0 42 287.5 43 277.0 44 289.5 45 278.5 46 246.5 47 223.0 48 183.0 49 150.5 50 119.5 51 98.0 52 79.0 53 53.0 54 34.0 55 21.0 56 16.0 57 15.0 58 10.0 59 8.0 60 7.0 61 4.0 62 2.0 63 1.0 64 0.5 65 1.5 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 98-99 18.0 100-101 28.0 102-103 43.0 104-105 38.0 106-107 40.0 108-109 38.0 110-111 36.0 112-113 40.0 114-115 65.0 116-117 50.0 118-119 60.0 120-121 57.0 122-123 47.0 124-125 49.0 126-127 76.0 128-129 53.0 130-131 60.0 132-133 63.0 134-135 59.0 136-137 32.0 138-139 64.0 140-141 66.0 142-143 58.0 144-145 74.0 146-147 0.0 148-149 0.0 150-151 2786.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.11368850369615 96.22500000000001 2 1.8098394086158553 3.55 3 0.07647208768799389 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0125 0.0 130-131 0.0 0.0 0.0 0.025 0.0 132-133 0.0 0.0 0.0 0.025 0.0 134-135 0.0 0.0 0.0 0.025 0.0 136-137 0.0 0.0 0.0 0.025 0.0 138 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCAAAC 10 0.0088387 133.025 6 CAAGCTT 10 0.0088387 133.025 9 >>END_MODULE Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264200 spots for SRR8474571.sra Written 1264200 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra Read 1264193 spots for SRR8474571.sra Written 1264193 spots for SRR8474571.sra SRR ids: ['SRR8474571.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__djbguo4 SRR8474571.sra spots: 25283867 blocks: [[1, 1264193], [1264194, 2528386], [2528387, 3792579], [3792580, 5056772], [5056773, 6320965], [6320966, 7585158], [7585159, 8849351], [8849352, 10113544], [10113545, 11377737], [11377738, 12641930], [12641931, 13906123], [13906124, 15170316], [15170317, 16434509], [16434510, 17698702], [17698703, 18962895], [18962896, 20227088], [20227089, 21491281], [21491282, 22755474], [22755475, 24019667], [24019668, 25283867]] SRR8474571 file size 9118639 SRR8474571 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8474571 SRR8474571_1.fastq SRR8474571_2.fastq Input file: SRR8474571_1.fastq Paired file: SRR8474571_2.fastq trimmed: SRR8474571-trimmed-pair1.fastq, SRR8474571-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:20:45 2025 >> started Tue Feb 11 14:21:34 2025 >> done (49.306s) 25283867 read pairs processed; of these: 1 ( 0.00%) short read pairs filtered out after trimming by size control 187 ( 0.00%) empty read pairs filtered out after trimming by size control 25283679 (100.00%) read pairs available; of these: 1553027 ( 6.14%) trimmed read pairs available after processing 23730652 (93.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 3 0.00% 24 0 0.00% 25 2 0.00% 26 1 0.00% 27 2 0.00% 28 0 0.00% 29 3 0.00% 30 0 0.00% 31 4 0.00% 32 1 0.00% 33 3 0.00% 34 4 0.00% 35 3 0.00% 36 3 0.00% 37 4 0.00% 38 1 0.00% 39 5 0.00% 40 2 0.00% 41 5 0.00% 42 4 0.00% 43 3 0.00% 44 2 0.00% 45 6 0.00% 46 3 0.00% 47 12 0.00% 48 3 0.00% 49 4 0.00% 50 9 0.00% 51 10 0.00% 52 8 0.00% 53 2 0.00% 54 7 0.00% 55 12 0.00% 56 4 0.00% 57 11 0.00% 58 7 0.00% 59 9 0.00% 60 11 0.00% 61 7 0.00% 62 12 0.00% 63 12 0.00% 64 10 0.00% 65 6 0.00% 66 12 0.00% 67 14 0.00% 68 14 0.00% 69 14 0.00% 70 16 0.00% 71 15 0.00% 72 9 0.00% 73 16 0.00% 74 8 0.00% 75 12 0.00% 76 16 0.00% 77 16 0.00% 78 14 0.00% 79 17 0.00% 80 26 0.00% 81 11 0.00% 82 16 0.00% 83 19 0.00% 84 21 0.00% 85 17 0.00% 86 24 0.00% 87 23 0.00% 88 33 0.00% 89 29 0.00% 90 31 0.00% 91 31 0.00% 92 34 0.00% 93 40 0.00% 94 76 0.00% 95 92 0.00% 96 101 0.00% 97 95 0.00% 98 101 0.00% 99 23412 0.09% 100 24170 0.10% 101 24458 0.10% 102 25418 0.10% 103 26813 0.11% 104 28220 0.11% 105 30187 0.12% 106 32011 0.13% 107 34336 0.14% 108 36835 0.15% 109 38305 0.15% 110 39805 0.16% 111 40518 0.16% 112 40914 0.16% 113 41541 0.16% 114 43268 0.17% 115 45538 0.18% 116 46637 0.18% 117 49285 0.19% 118 51903 0.21% 119 54707 0.22% 120 57092 0.23% 121 57815 0.23% 122 57684 0.23% 123 58523 0.23% 124 59268 0.23% 125 61357 0.24% 126 64000 0.25% 127 66043 0.26% 128 68901 0.27% 129 72130 0.29% 130 75448 0.30% 131 76714 0.30% 132 76641 0.30% 133 76427 0.30% 134 76624 0.30% 135 78120 0.31% 136 79709 0.32% 137 4413 0.02% 138 83859 0.33% 139 87753 0.35% 140 90316 0.36% 141 94647 0.37% 142 97504 0.39% 143 100558 0.40% 144 105342 0.42% 145 147364 0.58% 146 99335 0.39% 147 115088 0.46% 148 201110 0.80% 149 1066009 4.22% 150 21048370 83.25% 25283679 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=12.79 fanout-score-rank=15 prefix-density=0.40 prefix-fanout=5.9 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=334.02 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=22.8 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=35 prefix-density=0.27 prefix-fanout=2.0 sequence=CACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=285.21 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=18.1 sequence=AAGAAGAAGAAG SRR8474571 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:23:22 Started mapping on | Feb 11 14:23:22 Finished on | Feb 11 14:30:18 Mapping speed, Million of reads per hour | 218.80 Number of input reads | 25283679 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 20309729 Uniquely mapped reads % | 80.33% Average mapped length | 280.78 Number of splices: Total | 17261222 Number of splices: Annotated (sjdb) | 16807695 Number of splices: GT/AG | 16889141 Number of splices: GC/AG | 237016 Number of splices: AT/AC | 16012 Number of splices: Non-canonical | 119053 Mismatch rate per base, % | 1.60% Deletion rate per base | 0.10% Deletion average length | 2.92 Insertion rate per base | 0.06% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 886105 % of reads mapped to multiple loci | 3.50% Number of reads mapped to too many loci | 220831 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.68% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4087845 4087845 4087845 N_multimapping 886105 886105 886105 N_noFeature 703065 20059248 842269 N_ambiguous 371784 3187 258370 UnstrandedReadsAssigned:19234880 PositiveStrandReadsAssigned:247294 NegativeStrandReadsAssigned:19209090 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=138 echo kmer=133 SRR8474571 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8474571-trimmed-pair1.fastq SRR8474571-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,283,679 reads, 21,456,009 reads pseudoaligned [quant] estimated average fragment length: 172.748 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR8474571.ke.tsv 34699 SRR8474571.se.tsv 87100 total ==> SRR8474571.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1846.25 847 24.3179 Potri.005G024800.1.v4.1 1035 863.252 625 38.3775 Potri.004G059700.1.v4.1 961 789.252 53 3.55955 Potri.007G009000.2.v4.1 1416 1244.25 0 0 Potri.003G141000.2.v4.1 2943 2771.25 869 16.6218 Potri.016G087400.1.v4.1 270 104.605 1222.52 619.496 Potri.015G069301.1.v4.1 564 392.314 0 0 Potri.010G195200.1.v4.1 1773 1601.25 100 3.31036 Potri.012G127500.1.v4.1 977 805.252 17473 1150.19 ==> SRR8474571.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 159 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 121 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 39 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 79 SRR8474571 completed mapping pipeline successfully