Starting /dee2/code/volunteer_pipeline.sh SRR8481845 current disk space = 3087889047552 free memory = 1445015920 SRR8481845 SRAfilesize b11ef8ac9065ea332cc22b9466889b8b SRR8481845.sra SRR8481845.sra file validated SRR8481845 is single end SRR8481845 is conventional basespace SRR8481845 read1 length is 22-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8481845_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 22-100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.9905 34.0 33.0 34.0 31.0 34.0 2 32.6855 34.0 34.0 34.0 31.0 34.0 3 33.17125 34.0 34.0 34.0 31.0 34.0 4 36.54225 37.0 37.0 37.0 35.0 37.0 5 36.523 37.0 37.0 37.0 35.0 37.0 6 36.55475 37.0 37.0 37.0 35.0 37.0 7 36.60725 37.0 37.0 37.0 35.0 37.0 8 36.56025 37.0 37.0 37.0 35.0 37.0 9 38.46925 39.0 39.0 39.0 37.0 39.0 10-11 38.461124999999996 39.0 39.0 39.0 37.0 39.0 12-13 38.422 39.0 39.0 39.0 37.0 39.0 14-15 40.022375 41.0 40.0 41.0 38.0 41.0 16-17 40.113625 41.0 40.0 41.0 38.0 41.0 18-19 40.1175 41.0 40.0 41.0 38.0 41.0 20-21 40.129999999999995 41.0 40.0 41.0 38.0 41.0 22-23 40.073880001250316 41.0 40.0 41.0 38.0 41.0 24-25 40.0986496624156 41.0 40.0 41.0 38.0 41.0 26-27 40.06801700425106 41.0 40.0 41.0 38.0 41.0 28-29 39.93023255813954 41.0 40.0 41.0 38.0 41.0 30-31 39.994998749687426 41.0 40.0 41.0 38.0 41.0 32-33 39.948487121780445 41.0 40.0 41.0 38.0 41.0 34-35 39.945611402850716 41.0 40.0 41.0 38.0 41.0 36-37 39.90947736934233 41.0 40.0 41.0 38.0 41.0 38-39 39.89297324331083 41.0 40.0 41.0 38.0 41.0 40-41 39.87534383595899 41.0 40.0 41.0 38.0 41.0 42-43 39.767691922980745 41.0 40.0 41.0 38.0 41.0 44-45 39.75343835958989 41.0 40.0 41.0 37.5 41.0 46-47 39.714053513378346 41.0 40.0 41.0 37.0 41.0 48-49 39.702925731432856 41.0 40.0 41.0 37.0 41.0 50-51 39.65391347836959 41.0 40.0 41.0 37.0 41.0 52-53 39.5648912228057 41.0 40.0 41.0 37.0 41.0 54-55 39.42173043260816 41.0 39.0 41.0 36.0 41.0 56-57 39.296574143535885 41.0 39.0 41.0 36.0 41.0 58-59 39.15066266566642 41.0 39.0 41.0 35.0 41.0 60-61 38.96611652913228 40.0 38.5 41.0 35.0 41.0 62-63 38.666166541635405 40.0 37.5 41.0 35.0 41.0 64-65 38.32691345672836 39.5 37.0 41.0 35.0 41.0 66-67 38.04727363681841 39.0 36.5 41.0 34.5 41.0 68-69 37.779264632316156 39.0 36.0 41.0 34.0 41.0 70-71 37.33629314657328 38.5 35.5 40.0 34.0 41.0 72-73 36.92631263717924 37.0 35.0 39.0 34.0 41.0 74-75 36.44369369369369 37.0 35.0 39.0 34.0 40.5 76-77 34.01889389389389 34.5 32.5 36.5 30.0 38.5 78-79 35.521271271271274 36.0 35.0 37.0 33.0 39.0 80-81 35.37237237237237 35.5 35.0 37.0 33.5 39.0 82-83 35.01063563563564 35.0 35.0 36.0 33.0 37.0 84-85 34.771646646646644 35.0 35.0 36.0 33.0 37.0 86-87 34.596846846846844 35.0 35.0 36.0 33.0 37.0 88-89 34.4507007007007 35.0 35.0 35.0 33.0 36.0 90-91 34.30455455455456 35.0 35.0 35.0 33.0 36.0 92-93 34.21584084084084 35.0 35.0 35.0 32.5 36.0 94-95 34.171046046046044 35.0 35.0 35.0 33.0 36.0 96-97 34.13563563563564 35.0 35.0 35.0 33.0 35.0 98-99 34.03978978978979 35.0 35.0 35.0 32.5 35.0 100 31.484984984984983 34.0 31.0 35.0 25.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 2.0 20 2.0 21 0.0 22 0.0 23 2.0 24 4.0 25 9.0 26 6.0 27 12.0 28 16.0 29 19.0 30 23.0 31 26.0 32 31.0 33 63.0 34 82.0 35 146.0 36 239.0 37 798.0 38 1959.0 39 558.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.056338028169012 13.145539906103288 13.119457485654667 47.67866458007303 2 19.400000000000002 14.899999999999999 40.0 25.7 3 18.15 20.325 28.375 33.15 4 22.15 27.875 24.099999999999998 25.874999999999996 5 22.425 32.0 24.975 20.599999999999998 6 18.7 36.375 23.7 21.224999999999998 7 14.499999999999998 30.45 35.975 19.075 8 16.650000000000002 26.400000000000002 34.275 22.675 9 17.4 21.45 35.699999999999996 25.45 10-11 20.5125 32.4125 25.387500000000003 21.6875 12-13 20.1125 26.75 27.625 25.5125 14-15 19.8125 28.15 27.950000000000003 24.087500000000002 16-17 19.400000000000002 28.6375 27.950000000000003 24.0125 18-19 19.900000000000002 28.625 27.700000000000003 23.775 20-21 19.3875 28.012500000000003 28.575 24.025 22-23 20.19002375296912 28.27853481685211 28.42855356919615 23.102887860982623 24-25 19.72993248312078 28.00700175043761 28.182045511377847 24.081020255063766 26-27 19.46736684171043 28.394598649662417 27.66941735433858 24.468617154288573 28-29 19.10477619404851 29.069767441860467 28.54463615903976 23.280820205051263 30-31 19.56739184796199 28.744686171542888 27.694423605901473 23.99349837459365 32-33 20.99274818704676 26.981745436359088 28.232058014503625 23.793448362090523 34-35 19.579894973743436 29.632408102025504 26.894223555888974 23.893473368342086 36-37 20.067516879219806 28.93223305826457 26.9567391847962 24.043510877719427 38-39 19.442360590147537 28.707176794198553 27.781945486371594 24.06851712928232 40-41 19.554888722180543 29.119779944986245 27.394348587146787 23.93098274568642 42-43 19.317329332333085 28.994748687171796 27.231807951987996 24.456114028507127 44-45 19.604901225306325 28.844711177794448 27.731932983245812 23.818454613653415 46-47 19.779944986246562 28.657164291072768 28.34458614653663 23.218304576144035 48-49 20.255063765941486 28.844711177794448 27.031757939484873 23.868467116779193 50-51 19.892473118279568 28.619654913728432 27.60690172543136 23.88097024256064 52-53 18.967241810452613 29.16979244811203 27.60690172543136 24.256064016004 54-55 19.454863715928983 28.444611152788195 27.93198299574894 24.168542135533883 56-57 19.579894973743436 29.207301825456366 28.169542385596397 23.0432608152038 58-59 19.592398099524882 29.094773693423353 27.306826706676667 24.006001500375092 60-61 19.579894973743436 29.107276819204802 27.11927981995499 24.193548387096776 62-63 20.24256064016004 28.257064266066518 27.85696424106027 23.643410852713178 64-65 19.759879939969984 28.8144072036018 27.63881940970485 23.78689344672336 66-67 19.27213606803402 27.826413206603302 27.813906953476735 25.087543771885944 68-69 19.35967983991996 28.451725862931465 27.97648824412206 24.212106053026513 70-71 19.847423711855928 27.71385692846423 28.73936968484242 23.699349674837418 72-73 20.300187617260786 27.567229518449032 27.40462789243277 24.72795497185741 74-75 19.41941941941942 28.240740740740737 27.82782782782783 24.512012012012015 76-77 20.18268268268268 28.59109109109109 28.37837837837838 22.84784784784785 78-79 20.095095095095093 28.47847847847848 26.989489489489486 24.436936936936938 80-81 20.10760760760761 28.716216216216218 27.352352352352355 23.823823823823822 82-83 19.807307307307305 28.02802802802803 28.303303303303302 23.86136136136136 84-85 20.10760760760761 27.790290290290294 27.289789789789793 24.81231231231231 86-87 20.25775775775776 28.678678678678676 27.08958958958959 23.973973973973976 88-89 20.18268268268268 29.454454454454453 27.239739739739736 23.123123123123122 90-91 20.533033033033032 28.353353353353356 26.126126126126124 24.987487487487485 92-93 20.895895895895897 28.015515515515517 27.57757757757758 23.51101101101101 94-95 20.67067067067067 28.09059059059059 28.040540540540544 23.1981981981982 96-97 19.76976976976977 27.77777777777778 27.43993993993994 25.012512512512515 98-99 20.045045045045047 28.44094094094094 27.69019019019019 23.823823823823822 100 21.0062893081761 28.251572327044027 26.69182389937107 24.050314465408807 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.5 21 1.0 22 2.5 23 2.0 24 2.0 25 2.5 26 1.5 27 5.5 28 10.5 29 12.0 30 17.0 31 28.0 32 35.5 33 41.0 34 49.5 35 69.0 36 93.5 37 115.5 38 149.0 39 160.5 40 176.0 41 214.5 42 230.0 43 253.5 44 263.5 45 250.0 46 263.5 47 268.5 48 262.5 49 228.5 50 172.0 51 160.5 52 132.5 53 88.0 54 69.0 55 49.0 56 30.0 57 21.5 58 17.5 59 12.0 60 12.0 61 8.0 62 2.5 63 3.5 64 3.0 65 2.0 66 2.5 67 2.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.5255255255255256 >>END_MODULE >>Sequence Length Distribution warn #Length Count 22-23 1.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 1.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 2.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 3996.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8342625443487 97.5 2 0.9883426254434872 1.95 3 0.15205271160669032 0.44999999999999996 4 0.025342118601115054 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88 0.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra Rejected 929336 READS because READLEN < 1 Read 929336 spots for SRR8481845.sra Written 929336 spots for SRR8481845.sra SRR ids: ['SRR8481845.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8d5l8vmc SRR8481845.sra spots: 18586720 blocks: [[1, 929336], [929337, 1858672], [1858673, 2788008], [2788009, 3717344], [3717345, 4646680], [4646681, 5576016], [5576017, 6505352], [6505353, 7434688], [7434689, 8364024], [8364025, 9293360], [9293361, 10222696], [10222697, 11152032], [11152033, 12081368], [12081369, 13010704], [13010705, 13940040], [13940041, 14869376], [14869377, 15798712], [15798713, 16728048], [16728049, 17657384], [17657385, 18586720]] SRR8481845 file size 4424508 SRR8481845 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8481845 SRR8481845_1.fastq Input file: SRR8481845_1.fastq trimmed: SRR8481845-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 18:31:53 2025 >> started Thu Feb 13 18:32:02 2025 >> done (8.952s) 18586720 reads processed; of these: 140 ( 0.00%) short reads filtered out after trimming by size control 130 ( 0.00%) empty reads filtered out after trimming by size control 18586450 (100.00%) reads available; of these: 365881 ( 1.97%) trimmed reads available after processing 18220569 (98.03%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 21 0.00% 20 72 0.00% 21 51 0.00% 22 677 0.00% 23 37 0.00% 24 16 0.00% 25 29 0.00% 26 28 0.00% 27 89 0.00% 28 102 0.00% 29 20 0.00% 30 25 0.00% 31 138 0.00% 32 28 0.00% 33 195 0.00% 34 23 0.00% 35 31 0.00% 36 44 0.00% 37 40 0.00% 38 47 0.00% 39 32 0.00% 40 43 0.00% 41 35 0.00% 42 35 0.00% 43 40 0.00% 44 43 0.00% 45 46 0.00% 46 58 0.00% 47 56 0.00% 48 74 0.00% 49 14 0.00% 50 12 0.00% 51 12 0.00% 52 8 0.00% 53 63 0.00% 54 69 0.00% 55 60 0.00% 56 73 0.00% 57 79 0.00% 58 114 0.00% 59 90 0.00% 60 241 0.00% 61 261 0.00% 62 319 0.00% 63 332 0.00% 64 246 0.00% 65 291 0.00% 66 300 0.00% 67 327 0.00% 68 365 0.00% 69 351 0.00% 70 431 0.00% 71 495 0.00% 72 525 0.00% 73 604 0.00% 74 721 0.00% 75 790 0.00% 76 849 0.00% 77 67 0.00% 78 45 0.00% 79 29 0.00% 80 47 0.00% 81 36 0.00% 82 56 0.00% 83 76 0.00% 84 80 0.00% 85 110 0.00% 86 125 0.00% 87 139 0.00% 88 187 0.00% 89 269 0.00% 90 350 0.00% 91 488 0.00% 92 713 0.00% 93 1012 0.01% 94 1571 0.01% 95 2619 0.01% 96 4764 0.03% 97 10315 0.06% 98 29063 0.16% 99 313494 1.69% 100 18210561 97.98% 18586450 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=23 prefix-density=0.24 prefix-fanout=2.1 sequence=CTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=19.96 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=5.1 sequence=AAGCACAAGCTTCAGCTGATGTTGCAATTGGTGGCATGTTTGGGTTCTTCAATCTTTCCTCAAGGAGCTTGCACATCTCAGCATCTGTTGGAGCCACCACTTCTATCTCCCTAACCAGTGGCAACCCTTCCTTAATGGTAGGAATTTTCCACCTCAGAATGTCTTCAAGAACGGCACGAAAAGCATCACCATGATCAAAGTATGCGCCGTGATAATAATCCTTAATGTAAAGCCTACAACCCCTTTTCCTGCTCAAAAACCAGATCAGATCAGAAGAGCCCGAGGAAAAGGTAACGCGCAAGTGCGCACAATATGCACCAGCTTTTCT Started job on | Feb 13 18:32:22 Started mapping on | Feb 13 18:32:22 Finished on | Feb 13 18:33:17 Mapping speed, Million of reads per hour | 1216.57 Number of input reads | 18586450 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15459170 Uniquely mapped reads % | 83.17% Average mapped length | 99.57 Number of splices: Total | 4863606 Number of splices: Annotated (sjdb) | 4779924 Number of splices: GT/AG | 4773953 Number of splices: GC/AG | 71893 Number of splices: AT/AC | 4341 Number of splices: Non-canonical | 13419 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 474425 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 53296 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.98% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2652855 2652855 2652855 N_multimapping 474425 474425 474425 N_noFeature 708858 15251609 819516 N_ambiguous 155416 669 58318 UnstrandedReadsAssigned:14594896 PositiveStrandReadsAssigned:206892 NegativeStrandReadsAssigned:14581336 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8481845 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR8481845-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,586,450 reads, 14,790,372 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR8481845.ke.tsv 34699 SRR8481845.se.tsv 87100 total ==> SRR8481845.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2134 90.8297 Potri.005G024800.1.v4.1 1035 936 468.143 40.8518 Potri.004G059700.1.v4.1 961 862 13 1.23181 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 769.813 22.1088 Potri.016G087400.1.v4.1 270 171 479 228.796 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 281.936 13.7563 Potri.012G127500.1.v4.1 977 878 264 24.5594 ==> SRR8481845.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 209 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 197 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 47 Potri.001G416900.v4.1 12 Potri.001G452600.v4.1 15 SRR8481845 completed mapping pipeline successfully