Starting /dee2/code/volunteer_pipeline.sh SRR8481846 current disk space = 3087807791104 free memory = 1449867112 SRR8481846 SRAfilesize bfcae81aa6e39cedf54f5da0d3ce13a6 SRR8481846.sra SRR8481846.sra file validated SRR8481846 is single end SRR8481846 is conventional basespace SRR8481846 read1 length is 22-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8481846_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 22-100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.45425 34.0 33.0 34.0 31.0 34.0 2 32.9195 34.0 34.0 34.0 31.0 34.0 3 33.23225 34.0 34.0 34.0 31.0 34.0 4 36.52975 37.0 37.0 37.0 35.0 37.0 5 36.53525 37.0 37.0 37.0 35.0 37.0 6 36.57475 37.0 37.0 37.0 35.0 37.0 7 36.558 37.0 37.0 37.0 35.0 37.0 8 36.54675 37.0 37.0 37.0 35.0 37.0 9 38.463 39.0 39.0 39.0 37.0 39.0 10-11 38.436875 39.0 39.0 39.0 37.0 39.0 12-13 38.418 39.0 39.0 39.0 37.0 39.0 14-15 40.017625 41.0 40.0 41.0 38.0 41.0 16-17 40.078125 41.0 40.0 41.0 38.0 41.0 18-19 40.16525 41.0 40.0 41.0 38.5 41.0 20-21 40.098375000000004 41.0 40.0 41.0 38.0 41.0 22-23 40.03924643571786 41.0 40.0 41.0 38.0 41.0 24-25 40.055152576288144 41.0 40.0 41.0 38.0 41.0 26-27 40.08066533266633 41.0 40.0 41.0 38.0 41.0 28-29 39.91233116558279 41.0 40.0 41.0 38.0 41.0 30-31 39.97136068034017 41.0 40.0 41.0 38.0 41.0 32-33 39.95860430215107 41.0 40.0 41.0 38.0 41.0 34-35 39.8824412206103 41.0 40.0 41.0 38.0 41.0 36-37 39.91208104052026 41.0 40.0 41.0 38.0 41.0 38-39 39.93709354677338 41.0 40.0 41.0 38.0 41.0 40-41 39.86843421710856 41.0 40.0 41.0 38.0 41.0 42-43 39.818409204602304 41.0 40.0 41.0 38.0 41.0 44-45 39.74924962481241 41.0 40.0 41.0 37.5 41.0 46-47 39.70285142571285 41.0 40.0 41.0 37.0 41.0 48-49 39.682591295647825 41.0 40.0 41.0 37.0 41.0 50-51 39.627063531765884 41.0 40.0 41.0 37.0 41.0 52-53 39.46298149074538 41.0 39.5 41.0 36.0 41.0 54-55 39.358679339669834 41.0 39.0 41.0 36.0 41.0 56-57 39.21373186593297 41.0 39.0 41.0 35.0 41.0 58-59 39.08629314657328 41.0 39.0 41.0 35.0 41.0 60-61 38.849896395533264 40.0 38.0 41.0 35.0 41.0 62-63 38.57880910683012 40.0 37.0 41.0 35.0 41.0 64-65 38.358769076807604 40.0 37.0 41.0 35.0 41.0 66-67 38.03465098824118 39.0 36.5 41.0 34.5 41.0 68-69 37.66712534400801 39.0 36.0 41.0 34.0 41.0 70-71 37.25356517388041 37.5 35.0 40.0 34.0 41.0 72-73 36.85364023017263 37.0 35.0 39.0 34.0 41.0 74-75 36.34778567659478 36.5 35.0 39.0 33.5 40.5 76-77 33.997247247247245 34.5 32.5 36.5 30.0 38.5 78-79 35.398648648648646 36.0 35.0 37.0 33.0 39.0 80-81 35.307932932932935 35.0 35.0 37.0 33.0 39.0 82-83 34.948573573573576 35.0 35.0 36.5 33.0 37.0 84-85 34.72947947947948 35.0 35.0 36.0 33.0 37.0 86-87 34.53841341341341 35.0 35.0 36.0 33.0 37.0 88-89 34.3785035035035 35.0 35.0 35.0 33.0 36.0 90-91 34.29404404404404 35.0 35.0 35.0 33.0 36.0 92-93 34.141766766766764 35.0 35.0 35.0 32.5 36.0 94-95 34.1046046046046 35.0 35.0 35.0 33.0 36.0 96-97 34.04542042042042 35.0 34.5 35.0 32.0 35.0 98-99 33.943193193193196 35.0 34.0 35.0 32.0 35.0 100 31.18993993993994 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 3.0 20 1.0 21 0.0 22 1.0 23 5.0 24 7.0 25 7.0 26 9.0 27 12.0 28 12.0 29 20.0 30 27.0 31 31.0 32 39.0 33 48.0 34 70.0 35 135.0 36 281.0 37 772.0 38 1927.0 39 592.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.07287657172184 13.369258403900435 11.880934051834744 46.676930972542976 2 20.0 15.65 39.125 25.224999999999998 3 18.7 20.424999999999997 26.450000000000003 34.425 4 22.225 28.999999999999996 22.125 26.650000000000002 5 22.650000000000002 31.5 24.6 21.25 6 19.0 35.725 25.0 20.275000000000002 7 14.85 29.075 37.375 18.7 8 17.549999999999997 25.15 33.675 23.625 9 17.325 21.625 35.5 25.55 10-11 19.6875 33.375 25.224999999999998 21.712500000000002 12-13 19.675 26.625 28.537499999999998 25.162499999999998 14-15 19.6375 27.8375 28.6875 23.8375 16-17 19.35 28.325 28.025 24.3 18-19 19.8625 27.962500000000002 28.237499999999997 23.9375 20-21 20.1875 27.125 28.5625 24.125 22-23 19.929982495623904 28.419604901225306 27.369342335583895 24.281070267566893 24-25 19.572286143071533 28.176588294147077 28.01400700350175 24.23711855927964 26-27 20.072536268134066 28.08904452226113 27.901450725362682 23.936968484242122 28-29 19.984992496248125 29.689844922461226 26.900950475237618 23.424212106053027 30-31 19.47223611805903 28.83941970985493 28.4392196098049 23.24912456228114 32-33 20.022511255627816 28.46423211605803 27.813906953476735 23.699349674837418 34-35 20.28514257128564 28.4392196098049 28.151575787893947 23.12406203101551 36-37 19.672336168084044 28.039019509754876 27.901450725362682 24.387193596798397 38-39 19.997498749374685 27.56378189094547 28.339169584792394 24.099549774887443 40-41 20.42271135567784 29.064532266133064 26.700850425212607 23.81190595297649 42-43 19.809904952476238 28.61430715357679 27.951475737868936 23.62431215607804 44-45 20.260130065032516 28.076538269134566 28.214107053526767 23.449224612306153 46-47 20.08504252126063 29.439719859929962 26.825912956478238 23.649324662331164 48-49 20.222611305652826 27.826413206603302 27.101050525262632 24.84992496248124 50-51 21.398199099549775 28.951975987994 26.825912956478238 22.823911955977987 52-53 19.872436218109055 28.251625812906454 28.189094547273637 23.686843421710854 54-55 20.42271135567784 27.801400700350175 27.501250625312657 24.274637318659327 56-57 20.47273636818409 28.58929464732366 28.05152576288144 22.886443221610804 58-59 20.28514257128564 29.052026013006504 25.962981490745374 24.69984992496248 60-61 20.662914321450906 29.593495934959353 26.454033771106943 23.289555972482802 62-63 20.290217663247436 27.970978233675257 27.845884413309985 23.892919689767325 64-65 20.340255191393545 28.33375031273455 27.90843132349262 23.417563172379285 66-67 20.79059294470853 28.258694020515385 27.107830873154864 23.842882161621215 68-69 20.390292719539655 27.395546659994995 28.021015761821367 24.193144858643983 70-71 20.002501876407305 28.246184638478862 27.62071553665249 24.130597948461347 72-73 20.26519889917438 28.15861896422317 27.90843132349262 23.667750813109834 74-75 20.743150256474415 28.474915551107216 27.11122231952959 23.670711872888777 76-77 20.47047047047047 28.44094094094094 27.239739739739736 23.84884884884885 78-79 20.295295295295297 28.791291291291294 26.363863863863862 24.54954954954955 80-81 20.382882882882882 28.553553553553552 28.44094094094094 22.62262262262262 82-83 20.645645645645647 27.990490490490487 27.47747747747748 23.886386386386384 84-85 20.382882882882882 28.07807807807808 27.27727727727728 24.261761761761765 86-87 20.733233233233232 28.14064064064064 27.43993993993994 23.686186186186188 88-89 20.332832832832835 28.603603603603606 27.57757757757758 23.485985985985984 90-91 20.50800800800801 28.541041041041044 26.626626626626624 24.324324324324326 92-93 20.70820820820821 28.07807807807808 27.239739739739736 23.973973973973976 94-95 19.96996996996997 28.490990990990987 27.38988988988989 24.14914914914915 96-97 20.15765765765766 27.652652652652655 28.103103103103106 24.086586586586588 98-99 21.27127127127127 27.990490490490487 27.540040040040044 23.1981981981982 100 20.740927419354836 28.452620967741936 27.242943548387093 23.563508064516128 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 3.0 24 3.0 25 3.0 26 5.0 27 8.0 28 10.5 29 14.0 30 20.0 31 27.0 32 34.5 33 48.5 34 61.0 35 74.5 36 93.5 37 110.0 38 130.0 39 148.5 40 179.5 41 197.5 42 231.0 43 258.5 44 261.0 45 258.5 46 250.5 47 252.0 48 224.5 49 208.5 50 178.0 51 138.5 52 120.0 53 92.5 54 78.5 55 69.0 56 54.5 57 39.5 58 26.0 59 26.0 60 21.5 61 8.5 62 4.0 63 4.0 64 4.5 65 6.5 66 4.5 67 2.0 68 2.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.5 74 1.0 75 1.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.7007007007007007 >>END_MODULE >>Sequence Length Distribution warn #Length Count 22-23 2.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 1.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 1.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 3996.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88 0.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra Rejected 1047647 READS because READLEN < 1 Read 1047647 spots for SRR8481846.sra Written 1047647 spots for SRR8481846.sra Rejected 1047633 READS because READLEN < 1 Read 1047633 spots for SRR8481846.sra Written 1047633 spots for SRR8481846.sra SRR ids: ['SRR8481846.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gsb8ms3v SRR8481846.sra spots: 20952674 blocks: [[1, 1047633], [1047634, 2095266], [2095267, 3142899], [3142900, 4190532], [4190533, 5238165], [5238166, 6285798], [6285799, 7333431], [7333432, 8381064], [8381065, 9428697], [9428698, 10476330], [10476331, 11523963], [11523964, 12571596], [12571597, 13619229], [13619230, 14666862], [14666863, 15714495], [15714496, 16762128], [16762129, 17809761], [17809762, 18857394], [18857395, 19905027], [19905028, 20952674]] SRR8481846 file size 4990342 SRR8481846 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8481846 SRR8481846_1.fastq Input file: SRR8481846_1.fastq trimmed: SRR8481846-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 18:36:42 2025 >> started Thu Feb 13 18:36:51 2025 >> done (9.675s) 20952674 reads processed; of these: 569 ( 0.00%) short reads filtered out after trimming by size control 266 ( 0.00%) empty reads filtered out after trimming by size control 20951839 (100.00%) reads available; of these: 1076798 ( 5.14%) trimmed reads available after processing 19875041 (94.86%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 157 0.00% 19 270 0.00% 20 398 0.00% 21 441 0.00% 22 1343 0.01% 23 900 0.00% 24 1717 0.01% 25 3220 0.02% 26 7447 0.04% 27 6188 0.03% 28 4727 0.02% 29 2867 0.01% 30 1734 0.01% 31 1601 0.01% 32 1539 0.01% 33 1601 0.01% 34 1702 0.01% 35 1624 0.01% 36 1663 0.01% 37 1752 0.01% 38 1975 0.01% 39 2052 0.01% 40 1997 0.01% 41 2265 0.01% 42 2094 0.01% 43 2315 0.01% 44 2416 0.01% 45 2459 0.01% 46 2693 0.01% 47 2846 0.01% 48 2905 0.01% 49 2843 0.01% 50 2928 0.01% 51 3296 0.02% 52 3124 0.01% 53 3344 0.02% 54 3344 0.02% 55 3430 0.02% 56 3537 0.02% 57 3600 0.02% 58 3706 0.02% 59 3838 0.02% 60 4084 0.02% 61 4187 0.02% 62 4371 0.02% 63 4684 0.02% 64 5188 0.02% 65 5480 0.03% 66 5510 0.03% 67 5643 0.03% 68 5864 0.03% 69 6373 0.03% 70 6625 0.03% 71 6767 0.03% 72 7358 0.04% 73 8060 0.04% 74 8877 0.04% 75 11070 0.05% 76 2742 0.01% 77 2630 0.01% 78 3667 0.02% 79 4491 0.02% 80 5220 0.02% 81 5844 0.03% 82 6439 0.03% 83 7115 0.03% 84 7970 0.04% 85 8420 0.04% 86 9359 0.04% 87 10093 0.05% 88 11468 0.05% 89 13133 0.06% 90 14518 0.07% 91 16889 0.08% 92 19809 0.09% 93 23196 0.11% 94 28865 0.14% 95 34913 0.17% 96 44757 0.21% 97 59249 0.28% 98 89365 0.43% 99 454544 2.17% 100 19861104 94.79% 20951839 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=27 prefix-density=0.20 prefix-fanout=1.9 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=8 fanout-score=11.41 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=11.4 sequence=AGATCGGAAGAGCACACGTCTGAACTCC Started job on | Feb 13 18:37:12 Started mapping on | Feb 13 18:37:12 Finished on | Feb 13 18:37:55 Mapping speed, Million of reads per hour | 1754.11 Number of input reads | 20951839 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 18546461 Uniquely mapped reads % | 88.52% Average mapped length | 99.23 Number of splices: Total | 5567887 Number of splices: Annotated (sjdb) | 5478833 Number of splices: GT/AG | 5463424 Number of splices: GC/AG | 82866 Number of splices: AT/AC | 5779 Number of splices: Non-canonical | 15818 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.09 Insertion rate per base | 0.02% Insertion average length | 1.81 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 702074 % of reads mapped to multiple loci | 3.35% Number of reads mapped to too many loci | 116570 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.56% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1703304 1703304 1703304 N_multimapping 702074 702074 702074 N_noFeature 809804 18297478 937564 N_ambiguous 196158 780 74720 UnstrandedReadsAssigned:17540499 PositiveStrandReadsAssigned:248203 NegativeStrandReadsAssigned:17534177 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8481846 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR8481846-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,951,839 reads, 17,924,390 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR8481846.ke.tsv 34699 SRR8481846.se.tsv 87100 total ==> SRR8481846.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2694 91.0688 Potri.005G024800.1.v4.1 1035 936 534 37.0094 Potri.004G059700.1.v4.1 961 862 26 1.95665 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 891 20.3234 Potri.016G087400.1.v4.1 270 171 482.576 183.07 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 328 12.7106 Potri.012G127500.1.v4.1 977 878 349 25.7857 ==> SRR8481846.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 222 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 247 Potri.001G212900.v4.1 44 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 63 Potri.001G416900.v4.1 10 Potri.001G452600.v4.1 9 SRR8481846 completed mapping pipeline successfully