Starting /dee2/code/volunteer_pipeline.sh SRR8481847 current disk space = 3087538106368 free memory = 1489493948 SRR8481847 SRAfilesize 5484a4ecf2de5dbe18759f4152369173 SRR8481847.sra SRR8481847.sra file validated SRR8481847 is single end SRR8481847 is conventional basespace SRR8481847 read1 length is 15-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8481847_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 15-100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.29925 34.0 33.0 34.0 31.0 34.0 2 32.827 34.0 34.0 34.0 31.0 34.0 3 33.26475 34.0 34.0 34.0 31.0 34.0 4 36.577 37.0 37.0 37.0 35.0 37.0 5 36.57875 37.0 37.0 37.0 35.0 37.0 6 36.58425 37.0 37.0 37.0 35.0 37.0 7 36.59025 37.0 37.0 37.0 35.0 37.0 8 36.5415 37.0 37.0 37.0 35.0 37.0 9 38.41975 39.0 39.0 39.0 37.0 39.0 10-11 38.47125 39.0 39.0 39.0 37.0 39.0 12-13 38.4495 39.0 39.0 39.0 37.0 39.0 14-15 40.066874999999996 41.0 40.0 41.0 38.0 41.0 16-17 40.15857928964482 41.0 40.0 41.0 38.0 41.0 18-19 40.177588794397195 41.0 40.0 41.0 38.5 41.0 20-21 40.176713356678334 41.0 40.0 41.0 39.0 41.0 22-23 40.069157984045816 41.0 40.0 41.0 38.0 41.0 24-25 40.069051788841634 41.0 40.0 41.0 38.0 41.0 26-27 40.104078058543905 41.0 40.0 41.0 38.0 41.0 28-29 39.96885163872905 41.0 40.0 41.0 38.0 41.0 30-31 39.99249437077808 41.0 40.0 41.0 38.0 41.0 32-33 39.98398799099324 41.0 40.0 41.0 38.0 41.0 34-35 39.942567567567565 41.0 40.0 41.0 38.0 41.0 36-37 39.98185685685686 41.0 40.0 41.0 38.0 41.0 38-39 39.99011511511512 41.0 40.0 41.0 38.0 41.0 40-41 39.97797797797797 41.0 40.0 41.0 38.0 41.0 42-43 39.89677177177177 41.0 40.0 41.0 38.0 41.0 44-45 39.80755755755756 41.0 40.0 41.0 37.5 41.0 46-47 39.75162662662663 41.0 40.0 41.0 37.0 41.0 48-49 39.698573573573576 41.0 40.0 41.0 37.0 41.0 50-51 39.64026526526526 41.0 40.0 41.0 37.0 41.0 52-53 39.56806806806807 41.0 40.0 41.0 37.0 41.0 54-55 39.495745745745744 41.0 39.0 41.0 36.0 41.0 56-57 39.323448448448445 41.0 39.0 41.0 36.0 41.0 58-59 39.14814814814815 41.0 39.0 41.0 35.0 41.0 60-61 38.9994994994995 40.5 38.5 41.0 35.0 41.0 62-63 38.7220970970971 40.0 37.5 41.0 35.0 41.0 64-65 38.46821821821822 40.0 37.0 41.0 35.0 41.0 66-67 38.11498998998999 39.0 36.5 41.0 35.0 41.0 68-69 37.824074074074076 39.0 36.0 41.0 34.5 41.0 70-71 37.49036536536536 38.5 35.5 40.5 34.0 41.0 72-73 37.07857857857858 37.0 35.0 39.5 34.0 41.0 74-75 36.5975975975976 37.0 35.0 39.0 34.0 41.0 76-77 34.194569569569566 34.5 32.5 36.5 30.5 38.5 78-79 35.61774274274274 36.0 35.0 37.0 33.0 39.0 80-81 35.432807807807805 35.5 35.0 37.0 33.0 39.0 82-83 35.100725725725724 35.0 35.0 36.5 33.0 37.5 84-85 34.88863863863864 35.0 35.0 36.0 33.0 37.0 86-87 34.70445445445445 35.0 35.0 36.0 33.0 37.0 88-89 34.450950950950954 35.0 35.0 35.5 33.0 36.0 90-91 34.35085085085085 35.0 35.0 35.0 33.0 36.0 92-93 34.2779029029029 35.0 35.0 35.0 33.0 36.0 94-95 34.265765765765764 35.0 35.0 35.0 33.0 36.0 96-97 34.107232232232235 35.0 35.0 35.0 33.0 35.5 98-99 34.04441941941942 35.0 35.0 35.0 33.0 35.0 100 31.374624624624623 34.0 31.0 35.0 25.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 3.0 21 0.0 22 0.0 23 2.0 24 9.0 25 4.0 26 7.0 27 11.0 28 13.0 29 18.0 30 21.0 31 24.0 32 32.0 33 55.0 34 74.0 35 121.0 36 272.0 37 718.0 38 1967.0 39 646.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.641528925619834 12.680785123966942 13.223140495867769 45.45454545454545 2 19.825 15.225 37.025000000000006 27.925 3 19.525000000000002 17.599999999999998 26.775 36.1 4 21.975 26.724999999999998 24.075 27.224999999999998 5 22.825 31.35 24.55 21.275 6 18.375 35.85 25.124999999999996 20.65 7 15.325 29.975 36.825 17.875 8 16.925 27.675 33.15 22.25 9 17.599999999999998 20.974999999999998 35.875 25.55 10-11 19.525000000000002 32.3875 26.437500000000004 21.65 12-13 19.975 27.1125 28.237499999999997 24.675 14-15 18.6125 27.237499999999997 29.512500000000003 24.637500000000003 16-17 20.297648824412207 27.71385692846423 28.501750875437722 23.486743371685844 18-19 18.82191095547774 28.77688844422211 28.001500750375186 24.399699849924964 20-21 19.92246123061531 29.352176088044025 28.101550775387697 22.623811905952977 22-23 19.41213258286429 28.367729831144466 28.630393996247655 23.589743589743588 24-25 18.388791593695274 29.10933199899925 27.983487615711784 24.518388791593697 26-27 19.314485864398296 28.921691268451337 27.858393795346508 23.90542907180385 28-29 19.60220165123843 28.096072054040533 28.396297222917187 23.90542907180385 30-31 19.239429572179134 29.609707280460345 27.207905929447087 23.942957217913435 32-33 19.289467100325243 28.258694020515385 28.358769076807604 24.093069802351764 34-35 20.245245245245243 28.465965965965967 27.515015015015017 23.773773773773772 36-37 19.61961961961962 28.403403403403406 26.876876876876878 25.100100100100097 38-39 19.832332332332335 29.129129129129126 27.602602602602605 23.435935935935937 40-41 19.36936936936937 28.903903903903906 28.47847847847848 23.24824824824825 42-43 19.582082082082085 28.991491491491487 27.69019019019019 23.736236236236234 44-45 19.206706706706704 29.016516516516518 28.39089089089089 23.385885885885884 46-47 19.607107107107108 29.466966966966968 27.665165165165167 23.26076076076076 48-49 19.53203203203203 29.39189189189189 27.852852852852855 23.223223223223226 50-51 20.32032032032032 28.503503503503502 27.47747747747748 23.6986986986987 52-53 19.594594594594593 29.96746746746747 27.27727727727728 23.16066066066066 54-55 18.73123123123123 28.991491491491487 28.015515515515517 24.261761761761765 56-57 19.507007007007008 28.503503503503502 28.653653653653656 23.335835835835837 58-59 19.63213213213213 27.59009009009009 28.153153153153156 24.624624624624623 60-61 19.844844844844843 28.353353353353356 27.164664664664667 24.637137137137138 62-63 19.144144144144143 28.303303303303302 28.103103103103106 24.44944944944945 64-65 19.33183183183183 29.016516516516518 27.715215215215217 23.936436436436438 66-67 19.582082082082085 29.667167167167168 27.27727727727728 23.473473473473476 68-69 20.17017017017017 28.27827827827828 28.39089089089089 23.16066066066066 70-71 19.98248248248248 28.365865865865864 28.265765765765767 23.385885885885884 72-73 20.18268268268268 28.165665665665667 27.37737737737738 24.274274274274273 74-75 19.644644644644647 28.465965965965967 28.490990990990987 23.3983983983984 76-77 20.12012012012012 29.116616616616614 27.27727727727728 23.485985985985984 78-79 19.494494494494493 28.87887887887888 28.203203203203202 23.423423423423422 80-81 20.37037037037037 27.990490490490487 28.128128128128125 23.51101101101101 82-83 19.61961961961962 29.466966966966968 28.015515515515517 22.8978978978979 84-85 19.994994994994993 28.89139139139139 27.3023023023023 23.81131131131131 86-87 20.633133133133132 28.59109109109109 26.926926926926924 23.84884884884885 88-89 20.57057057057057 27.615115115115113 28.616116116116114 23.1981981981982 90-91 19.78228228228228 28.791291291291294 27.602602602602605 23.823823823823822 92-93 19.944944944944947 28.103103103103106 28.065565565565564 23.886386386386384 94-95 20.35785785785786 28.77877877877878 27.3023023023023 23.56106106106106 96-97 19.56956956956957 28.490990990990987 27.027027027027028 24.91241241241241 98-99 19.75725725725726 28.716216216216218 28.14064064064064 23.385885885885884 100 21.146592909228062 28.16193110384712 27.835051546391753 22.856424440533065 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 1.5 22 1.0 23 1.0 24 2.0 25 5.0 26 5.5 27 7.0 28 14.0 29 21.5 30 26.5 31 32.0 32 40.5 33 51.0 34 62.5 35 74.5 36 90.0 37 119.5 38 153.5 39 179.0 40 194.0 41 226.5 42 247.5 43 246.5 44 254.5 45 247.0 46 237.5 47 240.5 48 233.5 49 195.5 50 151.5 51 128.0 52 113.0 53 88.0 54 67.0 55 53.5 56 43.5 57 38.5 58 28.0 59 24.0 60 17.0 61 9.0 62 11.0 63 7.0 64 4.0 65 3.5 66 2.0 67 2.5 68 1.5 69 0.0 70 0.5 71 0.5 72 0.5 73 1.0 74 1.0 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.47547547547547553 >>END_MODULE >>Sequence Length Distribution warn #Length Count 14-15 2.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 1.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 1.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 3996.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0125 0.0 0.0 0.025 0.0 82-83 0.037500000000000006 0.0 0.0 0.025 0.0 84-85 0.0875 0.0 0.0 0.025 0.0 86-87 0.1 0.0 0.0 0.025 0.0 88 0.15 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTAGA 15 6.4162805E-4 93.9625 9 >>END_MODULE Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306066 READS because READLEN < 1 Read 1306066 spots for SRR8481847.sra Written 1306066 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra Rejected 1306060 READS because READLEN < 1 Read 1306060 spots for SRR8481847.sra Written 1306060 spots for SRR8481847.sra SRR ids: ['SRR8481847.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ymuu9_7s SRR8481847.sra spots: 26121206 blocks: [[1, 1306060], [1306061, 2612120], [2612121, 3918180], [3918181, 5224240], [5224241, 6530300], [6530301, 7836360], [7836361, 9142420], [9142421, 10448480], [10448481, 11754540], [11754541, 13060600], [13060601, 14366660], [14366661, 15672720], [15672721, 16978780], [16978781, 18284840], [18284841, 19590900], [19590901, 20896960], [20896961, 22203020], [22203021, 23509080], [23509081, 24815140], [24815141, 26121206]] SRR8481847 file size 6226361 SRR8481847 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8481847 SRR8481847_1.fastq Input file: SRR8481847_1.fastq trimmed: SRR8481847-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 18:59:04 2025 >> started Thu Feb 13 18:59:15 2025 >> done (11.179s) 26121206 reads processed; of these: 1605 ( 0.01%) short reads filtered out after trimming by size control 1742 ( 0.01%) empty reads filtered out after trimming by size control 26117859 (99.99%) reads available; of these: 1387895 ( 5.31%) trimmed reads available after processing 24729964 (94.69%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 196 0.00% 19 351 0.00% 20 458 0.00% 21 624 0.00% 22 1761 0.01% 23 1015 0.00% 24 1856 0.01% 25 3386 0.01% 26 6925 0.03% 27 5244 0.02% 28 4925 0.02% 29 2889 0.01% 30 2015 0.01% 31 1888 0.01% 32 1871 0.01% 33 2040 0.01% 34 1796 0.01% 35 1838 0.01% 36 1952 0.01% 37 2126 0.01% 38 2217 0.01% 39 2298 0.01% 40 2565 0.01% 41 2613 0.01% 42 2573 0.01% 43 2570 0.01% 44 2851 0.01% 45 2951 0.01% 46 3063 0.01% 47 3350 0.01% 48 3367 0.01% 49 3484 0.01% 50 3659 0.01% 51 3947 0.02% 52 3964 0.02% 53 3920 0.02% 54 4313 0.02% 55 4266 0.02% 56 4590 0.02% 57 4583 0.02% 58 4715 0.02% 59 4928 0.02% 60 5156 0.02% 61 5318 0.02% 62 5775 0.02% 63 6014 0.02% 64 6367 0.02% 65 6892 0.03% 66 7239 0.03% 67 7416 0.03% 68 7855 0.03% 69 8482 0.03% 70 8646 0.03% 71 9132 0.03% 72 9875 0.04% 73 10646 0.04% 74 11652 0.04% 75 14682 0.06% 76 3241 0.01% 77 3879 0.01% 78 5316 0.02% 79 6515 0.02% 80 7489 0.03% 81 8187 0.03% 82 9208 0.04% 83 10242 0.04% 84 11195 0.04% 85 12080 0.05% 86 13101 0.05% 87 14554 0.06% 88 16171 0.06% 89 18393 0.07% 90 20756 0.08% 91 23883 0.09% 92 27568 0.11% 93 33709 0.13% 94 41055 0.16% 95 49835 0.19% 96 63942 0.24% 97 82356 0.32% 98 121746 0.47% 99 546734 2.09% 100 24713614 94.62% 26117859 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.32 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=36.29 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.4 sequence=AAACAGCATATAATCATAGCAACACTACCATTTTAATTATACATGAAAGATAAACAGGACGACAAGCAGCTAACACGACTTGAGACTTGATACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCATTCTCGGCTCCCACGACCGTCTCAGCAGCTCCCGCAAAGTGACCCTTCTCTGGTGCCACACCAAGAACCAGAGTTTCGTTGGTGATCGTCTCTGAGGAGCTCATGTCAGGGTACATCTTGCATCCTCCACAGCCGCTGCCGCACTT Started job on | Feb 13 18:59:33 Started mapping on | Feb 13 18:59:33 Finished on | Feb 13 19:00:04 Mapping speed, Million of reads per hour | 3033.04 Number of input reads | 26117859 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 24807774 Uniquely mapped reads % | 94.98% Average mapped length | 99.08 Number of splices: Total | 7606661 Number of splices: Annotated (sjdb) | 7479517 Number of splices: GT/AG | 7466819 Number of splices: GC/AG | 112392 Number of splices: AT/AC | 7143 Number of splices: Non-canonical | 20307 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.10 Insertion rate per base | 0.02% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 815491 % of reads mapped to multiple loci | 3.12% Number of reads mapped to too many loci | 119339 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.42% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 494594 494594 494594 N_multimapping 815491 815491 815491 N_noFeature 1199559 24500234 1345970 N_ambiguous 255943 1003 94472 UnstrandedReadsAssigned:23352272 PositiveStrandReadsAssigned:306537 NegativeStrandReadsAssigned:23367332 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8481847 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR8481847-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,117,859 reads, 23,756,836 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR8481847.ke.tsv 34699 SRR8481847.se.tsv 87100 total ==> SRR8481847.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 3218 83.5482 Potri.005G024800.1.v4.1 1035 936 841 44.7658 Potri.004G059700.1.v4.1 961 862 73 4.21931 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 1153.51 20.2077 Potri.016G087400.1.v4.1 270 171 825.236 240.441 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 228 6.78587 Potri.012G127500.1.v4.1 977 878 316 17.9316 ==> SRR8481847.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 373 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 334 Potri.001G212900.v4.1 37 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 67 Potri.001G416900.v4.1 44 Potri.001G452600.v4.1 29 SRR8481847 completed mapping pipeline successfully