Starting /dee2/code/volunteer_pipeline.sh SRR8481848 current disk space = 3087471030272 free memory = 1487990308 SRR8481848 SRAfilesize 15141d1d1e7ae8813687ae5a48d99716 SRR8481848.sra SRR8481848.sra file validated SRR8481848 is single end SRR8481848 is conventional basespace SRR8481848 read1 length is 62-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8481848_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 62-100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2995 34.0 33.0 34.0 31.0 34.0 2 32.83825 34.0 34.0 34.0 31.0 34.0 3 33.22875 34.0 34.0 34.0 31.0 34.0 4 36.5645 37.0 37.0 37.0 35.0 37.0 5 36.5425 37.0 37.0 37.0 35.0 37.0 6 36.54 37.0 37.0 37.0 35.0 37.0 7 36.561 37.0 37.0 37.0 35.0 37.0 8 36.53 37.0 37.0 37.0 35.0 37.0 9 38.45025 39.0 39.0 39.0 37.0 39.0 10-11 38.50075 39.0 39.0 39.0 37.0 39.0 12-13 38.408375 39.0 39.0 39.0 37.0 39.0 14-15 40.018375000000006 41.0 40.0 41.0 38.0 41.0 16-17 40.080124999999995 41.0 40.0 41.0 38.0 41.0 18-19 40.08775 41.0 40.0 41.0 38.0 41.0 20-21 40.10625 41.0 40.0 41.0 38.0 41.0 22-23 40.042375 41.0 40.0 41.0 38.0 41.0 24-25 40.002125 41.0 40.0 41.0 38.0 41.0 26-27 40.04 41.0 40.0 41.0 38.0 41.0 28-29 39.904375 41.0 40.0 41.0 38.0 41.0 30-31 39.929249999999996 41.0 40.0 41.0 38.0 41.0 32-33 39.947874999999996 41.0 40.0 41.0 38.0 41.0 34-35 39.916875000000005 41.0 40.0 41.0 38.0 41.0 36-37 39.90825 41.0 40.0 41.0 38.0 41.0 38-39 39.882875 41.0 40.0 41.0 38.0 41.0 40-41 39.812124999999995 41.0 40.0 41.0 38.0 41.0 42-43 39.8035 41.0 40.0 41.0 38.0 41.0 44-45 39.737 41.0 40.0 41.0 37.5 41.0 46-47 39.674499999999995 41.0 40.0 41.0 37.0 41.0 48-49 39.642250000000004 41.0 40.0 41.0 37.0 41.0 50-51 39.564 41.0 40.0 41.0 37.0 41.0 52-53 39.441625 41.0 39.5 41.0 36.0 41.0 54-55 39.393375000000006 41.0 39.0 41.0 36.0 41.0 56-57 39.260875 41.0 39.0 41.0 36.0 41.0 58-59 39.154125 41.0 39.0 41.0 35.0 41.0 60-61 38.927125000000004 40.0 38.5 41.0 35.0 41.0 62-63 38.672699924981245 40.0 37.5 41.0 35.0 41.0 64-65 38.342335583895974 39.5 37.0 41.0 35.0 41.0 66-67 37.97797676657784 39.0 36.5 41.0 34.5 41.0 68-69 37.70302727045284 39.0 36.0 41.0 34.0 41.0 70-71 37.335027734765035 38.5 35.0 40.0 34.0 41.0 72-73 36.84530935816918 37.0 35.0 39.0 34.0 41.0 74-75 36.452735924913654 37.0 35.0 39.0 34.0 41.0 76-77 34.0678517776665 34.5 33.0 36.5 30.0 38.5 78-79 35.42300951427141 36.0 35.0 37.0 32.5 39.0 80-81 35.31246870305458 35.0 35.0 37.0 33.0 39.0 82-83 34.97909364046069 35.0 35.0 36.5 33.0 37.0 84-85 34.718202303455186 35.0 35.0 36.0 33.0 37.0 86-87 34.532674011016525 35.0 35.0 36.0 33.0 37.0 88-89 34.358913370055085 35.0 35.0 35.5 33.0 36.0 90-91 34.24311467200801 35.0 35.0 35.0 33.0 36.0 92-93 34.17325988983475 35.0 35.0 35.0 32.5 36.0 94-95 34.0970205307962 35.0 34.5 35.0 32.0 36.0 96-97 34.03342513770656 35.0 35.0 35.0 32.0 35.0 98-99 33.94379068602905 35.0 34.5 35.0 32.0 35.0 100 31.195042563845767 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 6.0 22 2.0 23 3.0 24 3.0 25 2.0 26 9.0 27 15.0 28 18.0 29 17.0 30 20.0 31 41.0 32 42.0 33 61.0 34 84.0 35 135.0 36 241.0 37 691.0 38 1992.0 39 612.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.683178534571724 12.538699690402478 13.519091847265221 46.25902992776057 2 21.325 15.35 37.275000000000006 26.05 3 19.475 19.85 26.224999999999998 34.449999999999996 4 21.025 29.475 22.45 27.05 5 22.3 32.1 24.6 21.0 6 18.925 34.575 25.45 21.05 7 14.975 29.675 36.9 18.45 8 17.150000000000002 25.55 33.4 23.9 9 17.575 22.6 34.75 25.074999999999996 10-11 19.0875 32.1875 25.7 23.025000000000002 12-13 19.4625 27.1 28.262500000000003 25.174999999999997 14-15 19.787499999999998 28.599999999999998 28.275 23.3375 16-17 20.45 28.075 27.825 23.65 18-19 19.400000000000002 28.3125 27.800000000000004 24.4875 20-21 20.075000000000003 28.4125 28.075 23.4375 22-23 20.599999999999998 29.4125 27.187499999999996 22.8 24-25 19.3 29.4 27.650000000000002 23.65 26-27 19.7 28.975 27.6875 23.6375 28-29 19.7 28.525 27.6375 24.1375 30-31 19.650000000000002 28.6375 27.762500000000003 23.95 32-33 20.7375 28.6625 27.9375 22.662499999999998 34-35 19.4875 28.725 27.3875 24.4 36-37 19.5125 29.049999999999997 27.725 23.7125 38-39 20.1 28.15 28.512500000000003 23.2375 40-41 21.1125 28.525 26.7625 23.599999999999998 42-43 20.3875 28.65 27.400000000000002 23.5625 44-45 19.5625 29.0875 27.800000000000004 23.549999999999997 46-47 20.1125 28.999999999999996 27.700000000000003 23.1875 48-49 20.775 28.6625 27.150000000000002 23.4125 50-51 20.125 28.65 27.55 23.674999999999997 52-53 20.25 28.237499999999997 28.0875 23.425 54-55 20.0875 28.1 28.299999999999997 23.5125 56-57 20.0125 29.2375 27.125 23.625 58-59 19.537499999999998 29.25 27.250000000000004 23.962500000000002 60-61 20.0625 29.7375 26.687499999999996 23.5125 62-63 19.877484685585696 28.94111763970496 27.415926990873857 23.76547068383548 64-65 21.05526381595399 28.432108027006752 27.394348587146787 23.118279569892472 66-67 19.669876203576344 29.348505689633615 27.12267100162561 23.858947105164436 68-69 20.55291468601451 29.02176632474356 26.65749311983988 23.767825869402053 70-71 20.43037657950707 29.20055048167146 27.4990616789691 22.870011259852372 72-73 20.57314478788637 28.45701414090852 27.04292328869979 23.92691778250532 74-75 19.389160095130805 28.626861935160846 28.451620978845916 23.532356990862436 76-77 20.292939409113668 28.70555833750626 27.503755633450176 23.497746619929895 78-79 20.86880320480721 28.592889334001004 26.84026039058588 23.69804707060591 80-81 20.86880320480721 29.04356534802203 26.314471707561342 23.773159739609415 82-83 20.15523284927391 29.369053580370558 27.516274411617424 22.959439158738107 84-85 20.61842764146219 28.067100650976464 27.265898848272407 24.04857285928893 86-87 20.0050075112669 28.054581872809216 28.029544316474713 23.910866299449175 88-89 21.056584877315974 28.254882323485226 28.104656985478215 22.58387581372058 90-91 21.056584877315974 27.679018527791687 26.61492238357536 24.649474211316978 92-93 20.943915873810717 27.96695042563846 27.190786179268905 23.898347521281924 94-95 20.756134201301954 28.31747621432148 26.627441161742617 24.298948422633952 96-97 20.43064596895343 29.06860290435653 26.84026039058588 23.660490736104155 98-99 20.030045067601403 28.254882323485226 28.029544316474713 23.685528292438658 100 20.953101361573374 26.979324256177513 27.433182047402926 24.634392334846194 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.5 25 4.5 26 6.5 27 8.5 28 12.0 29 19.5 30 23.5 31 24.0 32 32.0 33 45.0 34 57.0 35 72.5 36 98.0 37 117.5 38 124.0 39 149.0 40 188.0 41 211.5 42 237.5 43 262.0 44 262.0 45 276.5 46 263.5 47 239.5 48 234.5 49 212.0 50 179.5 51 141.5 52 102.0 53 76.0 54 71.5 55 59.5 56 47.5 57 32.5 58 25.0 59 24.0 60 16.5 61 9.5 62 8.5 63 8.5 64 6.0 65 4.0 66 2.5 67 1.0 68 1.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.7010515773660491 >>END_MODULE >>Sequence Length Distribution warn #Length Count 62 1.0 63 0.0 64 0.0 65 0.0 66 1.0 67 1.0 68 0.0 69 0.0 70 1.0 71 0.0 72 1.0 73 0.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 3994.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62349397590361 99.225 2 0.3514056224899598 0.7000000000000001 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0125 0.0 0.0 0.025 0.0 82-83 0.1 0.0 0.0 0.025 0.0 84-85 0.1 0.0 0.0 0.025 0.0 86-87 0.1 0.0 0.0 0.025 0.0 88 0.1 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836940 READS because READLEN < 1 Rejected 836940 READS because READLEN < 1 Read 836940 spots for SRR8481848.sra Read 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Written 836940 spots for SRR8481848.sra Rejected 836954 READS because READLEN < 1 Read 836954 spots for SRR8481848.sra Written 836954 spots for SRR8481848.sra SRR ids: ['SRR8481848.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_43jx3ai2 SRR8481848.sra spots: 16738814 blocks: [[1, 836940], [836941, 1673880], [1673881, 2510820], [2510821, 3347760], [3347761, 4184700], [4184701, 5021640], [5021641, 5858580], [5858581, 6695520], [6695521, 7532460], [7532461, 8369400], [8369401, 9206340], [9206341, 10043280], [10043281, 10880220], [10880221, 11717160], [11717161, 12554100], [12554101, 13391040], [13391041, 14227980], [14227981, 15064920], [15064921, 15901860], [15901861, 16738814]] SRR8481848 file size 3982355 SRR8481848 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8481848 SRR8481848_1.fastq Input file: SRR8481848_1.fastq trimmed: SRR8481848-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 19:04:15 2025 >> started Thu Feb 13 19:04:24 2025 >> done (8.891s) 16738814 reads processed; of these: 140 ( 0.00%) short reads filtered out after trimming by size control 191 ( 0.00%) empty reads filtered out after trimming by size control 16738483 (100.00%) reads available; of these: 346286 ( 2.07%) trimmed reads available after processing 16392197 (97.93%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 26 0.00% 19 28 0.00% 20 72 0.00% 21 85 0.00% 22 762 0.00% 23 40 0.00% 24 16 0.00% 25 15 0.00% 26 29 0.00% 27 129 0.00% 28 123 0.00% 29 17 0.00% 30 15 0.00% 31 24 0.00% 32 28 0.00% 33 257 0.00% 34 23 0.00% 35 25 0.00% 36 36 0.00% 37 33 0.00% 38 51 0.00% 39 49 0.00% 40 39 0.00% 41 42 0.00% 42 37 0.00% 43 38 0.00% 44 49 0.00% 45 43 0.00% 46 54 0.00% 47 58 0.00% 48 49 0.00% 49 9 0.00% 50 12 0.00% 51 11 0.00% 52 10 0.00% 53 71 0.00% 54 59 0.00% 55 78 0.00% 56 95 0.00% 57 89 0.00% 58 91 0.00% 59 225 0.00% 60 273 0.00% 61 286 0.00% 62 268 0.00% 63 184 0.00% 64 249 0.00% 65 256 0.00% 66 253 0.00% 67 314 0.00% 68 322 0.00% 69 399 0.00% 70 438 0.00% 71 436 0.00% 72 579 0.00% 73 627 0.00% 74 748 0.00% 75 897 0.01% 76 890 0.01% 77 59 0.00% 78 45 0.00% 79 24 0.00% 80 33 0.00% 81 40 0.00% 82 53 0.00% 83 57 0.00% 84 75 0.00% 85 113 0.00% 86 138 0.00% 87 146 0.00% 88 191 0.00% 89 247 0.00% 90 339 0.00% 91 474 0.00% 92 691 0.00% 93 996 0.01% 94 1597 0.01% 95 2664 0.02% 96 4844 0.03% 97 10166 0.06% 98 28001 0.17% 99 295092 1.76% 100 16381937 97.87% 16738483 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=16 prefix-density=0.22 prefix-fanout=2.3 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=34.50 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.5 sequence=AAACAGCATATAATCATAGCAACACTACCATTTTAATTATACATGAAAGATAAACAGGACGACAAGCAGCTAACACGACTTGAGACTTGATACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCATTCTCGGCTCCCACGACCGTCTCAGCAGCTCCCGCAAAGTGACCCTTCTCTGGTGCCACACCAAGAACCAGAGTTTCGTTGGTGATCGTCTCTGAGGAGCTCATGTCAGGGTACATCTTGCATCCTCCACAGCCGCTGCCGCACTT Started job on | Feb 13 19:04:43 Started mapping on | Feb 13 19:04:44 Finished on | Feb 13 19:05:07 Mapping speed, Million of reads per hour | 2619.94 Number of input reads | 16738483 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15900827 Uniquely mapped reads % | 95.00% Average mapped length | 99.55 Number of splices: Total | 4883751 Number of splices: Annotated (sjdb) | 4798030 Number of splices: GT/AG | 4790743 Number of splices: GC/AG | 74965 Number of splices: AT/AC | 4881 Number of splices: Non-canonical | 13162 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 504612 % of reads mapped to multiple loci | 3.01% Number of reads mapped to too many loci | 89296 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.45% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 333044 333044 333044 N_multimapping 504612 504612 504612 N_noFeature 741167 15696684 838850 N_ambiguous 168547 673 61900 UnstrandedReadsAssigned:14991113 PositiveStrandReadsAssigned:203470 NegativeStrandReadsAssigned:15000077 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8481848 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR8481848-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,738,483 reads, 15,265,097 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR8481848.ke.tsv 34699 SRR8481848.se.tsv 87100 total ==> SRR8481848.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 878 35.8513 Potri.005G024800.1.v4.1 1035 936 387 32.3981 Potri.004G059700.1.v4.1 961 862 11 0.999931 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 740.407 20.3998 Potri.016G087400.1.v4.1 270 171 465 213.08 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 147 6.88092 Potri.012G127500.1.v4.1 977 878 174 15.5289 ==> SRR8481848.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 291 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 18 Potri.001G452600.v4.1 18 SRR8481848 completed mapping pipeline successfully