Starting /dee2/code/volunteer_pipeline.sh SRR8481849 current disk space = 3087707955200 free memory = 1454825184 SRR8481849 SRAfilesize 5032c3162c985e034aa00f0866843ad5 SRR8481849.sra SRR8481849.sra file validated SRR8481849 is single end SRR8481849 is conventional basespace SRR8481849 read1 length is 100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8481849_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 100 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39775 34.0 33.0 34.0 31.0 34.0 2 32.92425 34.0 34.0 34.0 31.0 34.0 3 33.26275 34.0 34.0 34.0 31.0 34.0 4 36.5825 37.0 37.0 37.0 35.0 37.0 5 36.52925 37.0 37.0 37.0 35.0 37.0 6 36.58375 37.0 37.0 37.0 35.0 37.0 7 36.577 37.0 37.0 37.0 35.0 37.0 8 36.57225 37.0 37.0 37.0 35.0 37.0 9 38.487 39.0 39.0 39.0 37.0 39.0 10-11 38.491375 39.0 39.0 39.0 37.0 39.0 12-13 38.481125 39.0 39.0 39.0 37.0 39.0 14-15 40.08375 41.0 40.0 41.0 38.0 41.0 16-17 40.1295 41.0 40.0 41.0 38.0 41.0 18-19 40.164249999999996 41.0 40.0 41.0 38.5 41.0 20-21 40.161125 41.0 40.0 41.0 38.5 41.0 22-23 40.039375 41.0 40.0 41.0 38.0 41.0 24-25 40.0625 41.0 40.0 41.0 38.0 41.0 26-27 40.0905 41.0 40.0 41.0 38.0 41.0 28-29 39.949124999999995 41.0 40.0 41.0 38.0 41.0 30-31 40.006125 41.0 40.0 41.0 38.0 41.0 32-33 39.947500000000005 41.0 40.0 41.0 38.0 41.0 34-35 39.91175 41.0 40.0 41.0 38.0 41.0 36-37 39.939875 41.0 40.0 41.0 38.0 41.0 38-39 39.943 41.0 40.0 41.0 38.0 41.0 40-41 39.901875000000004 41.0 40.0 41.0 38.0 41.0 42-43 39.852625 41.0 40.0 41.0 38.0 41.0 44-45 39.795249999999996 41.0 40.0 41.0 37.5 41.0 46-47 39.754875 41.0 40.0 41.0 37.5 41.0 48-49 39.70025 41.0 40.0 41.0 37.0 41.0 50-51 39.646 41.0 40.0 41.0 37.0 41.0 52-53 39.511624999999995 41.0 39.5 41.0 36.5 41.0 54-55 39.384375 41.0 39.0 41.0 36.0 41.0 56-57 39.31375 41.0 39.0 41.0 36.0 41.0 58-59 39.144375 41.0 39.0 41.0 35.0 41.0 60-61 38.95425 40.0 38.0 41.0 35.0 41.0 62-63 38.655875 40.0 37.5 41.0 35.0 41.0 64-65 38.353625 39.5 37.0 41.0 35.0 41.0 66-67 38.051249999999996 39.0 36.5 41.0 34.5 41.0 68-69 37.670375 39.0 36.0 41.0 34.0 41.0 70-71 37.296 37.5 35.0 40.0 34.0 41.0 72-73 36.9105 37.0 35.0 39.0 34.0 41.0 74-75 36.439875 37.0 35.0 39.0 34.0 40.5 76-77 33.981875 34.5 32.5 36.5 30.0 38.5 78-79 35.425375 36.0 35.0 37.0 32.5 39.0 80-81 35.257625000000004 35.0 35.0 37.0 33.0 39.0 82-83 34.922125 35.0 35.0 36.0 33.0 37.0 84-85 34.754875 35.0 35.0 36.0 33.0 37.0 86-87 34.562 35.0 35.0 36.0 33.0 37.0 88-89 34.383625 35.0 35.0 35.0 33.0 36.0 90-91 34.25212500000001 35.0 35.0 35.0 32.5 36.0 92-93 34.15625 35.0 35.0 35.0 32.5 36.0 94-95 34.084125 35.0 35.0 35.0 32.5 36.0 96-97 34.0415 35.0 34.5 35.0 32.5 35.0 98-99 33.990875 35.0 34.0 35.0 32.5 35.0 100 31.16925 34.0 31.0 35.0 24.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 1.0 22 2.0 23 1.0 24 3.0 25 8.0 26 4.0 27 7.0 28 15.0 29 21.0 30 24.0 31 32.0 32 45.0 33 63.0 34 80.0 35 128.0 36 255.0 37 810.0 38 1940.0 39 559.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.398869185299407 13.492675404780263 11.590850681058853 46.51760472886147 2 19.525000000000002 14.149999999999999 42.025 24.3 3 18.975 18.95 26.674999999999997 35.4 4 21.675 27.500000000000004 23.125 27.700000000000003 5 24.05 29.875 25.974999999999998 20.1 6 18.975 35.0 25.8 20.225 7 15.2 28.65 38.324999999999996 17.825 8 17.2 23.575 35.75 23.474999999999998 9 17.974999999999998 21.575 34.875 25.575 10-11 19.537499999999998 31.3125 26.575 22.575 12-13 19.85 26.637499999999996 28.1625 25.35 14-15 19.625 27.1625 28.675 24.5375 16-17 19.425 27.6875 27.962500000000002 24.925 18-19 20.175 28.0625 28.299999999999997 23.4625 20-21 20.0875 27.800000000000004 28.925 23.1875 22-23 20.0 28.549999999999997 28.025 23.425 24-25 19.787499999999998 28.812500000000004 27.1 24.3 26-27 20.1 28.4125 27.825 23.6625 28-29 19.9625 29.062500000000004 27.3125 23.6625 30-31 19.2625 28.5625 27.212500000000002 24.962500000000002 32-33 20.575 27.925 28.1625 23.3375 34-35 19.9625 28.1375 27.6375 24.2625 36-37 19.8125 28.575 28.037499999999998 23.575 38-39 19.950000000000003 27.237499999999997 28.1625 24.65 40-41 20.45 28.499999999999996 27.3125 23.7375 42-43 19.6125 29.1125 26.8625 24.4125 44-45 20.025000000000002 28.3125 26.8 24.8625 46-47 19.3125 28.237499999999997 28.425 24.025 48-49 19.7375 26.7625 27.987499999999997 25.5125 50-51 20.025000000000002 27.800000000000004 28.175 24.0 52-53 21.3625 27.5125 27.487499999999997 23.6375 54-55 20.1125 28.025 28.475 23.3875 56-57 20.5125 28.525 26.7125 24.25 58-59 20.4 28.5625 27.737499999999997 23.3 60-61 20.775 27.6375 27.425 24.1625 62-63 20.9375 28.1125 28.012500000000003 22.9375 64-65 19.8875 27.925 28.3625 23.825 66-67 20.2875 28.212500000000002 27.075 24.425 68-69 21.025 27.575 28.1375 23.2625 70-71 21.2625 28.025 27.3375 23.375 72-73 21.525 28.1 26.6125 23.7625 74-75 20.3625 28.237499999999997 27.037499999999998 24.3625 76-77 20.8875 28.599999999999998 26.724999999999998 23.7875 78-79 20.925 27.6125 27.537499999999998 23.925 80-81 20.8625 27.800000000000004 26.875 24.462500000000002 82-83 21.2 27.150000000000002 27.700000000000003 23.95 84-85 20.2375 28.3625 27.150000000000002 24.25 86-87 20.4875 27.125 27.500000000000004 24.887500000000003 88-89 20.575 29.1875 27.537499999999998 22.7 90-91 21.425 27.8375 27.125 23.6125 92-93 21.1875 26.974999999999998 28.499999999999996 23.3375 94-95 20.5875 28.15 27.3125 23.95 96-97 19.575 27.762500000000003 28.175 24.4875 98-99 21.1875 27.325 28.0625 23.425 100 21.31890259249937 28.089604832620186 27.258998238107225 23.33249433677322 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 2.0 26 3.5 27 3.5 28 3.5 29 7.5 30 9.5 31 11.0 32 16.5 33 28.5 34 42.5 35 64.5 36 85.0 37 107.0 38 132.0 39 149.0 40 191.0 41 225.5 42 246.0 43 263.5 44 269.5 45 281.5 46 294.5 47 263.5 48 238.0 49 229.0 50 189.5 51 146.0 52 111.5 53 87.0 54 71.5 55 57.5 56 42.5 57 36.0 58 27.5 59 19.0 60 14.5 61 9.0 62 4.5 63 5.0 64 3.0 65 0.5 66 0.5 67 2.5 68 2.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 100 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940289 READS because READLEN < 1 Read 940289 spots for SRR8481849.sra Written 940289 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra Rejected 940285 READS because READLEN < 1 Read 940285 spots for SRR8481849.sra Written 940285 spots for SRR8481849.sra SRR ids: ['SRR8481849.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qpulsswk SRR8481849.sra spots: 18805704 blocks: [[1, 940285], [940286, 1880570], [1880571, 2820855], [2820856, 3761140], [3761141, 4701425], [4701426, 5641710], [5641711, 6581995], [6581996, 7522280], [7522281, 8462565], [8462566, 9402850], [9402851, 10343135], [10343136, 11283420], [11283421, 12223705], [12223706, 13163990], [13163991, 14104275], [14104276, 15044560], [15044561, 15984845], [15984846, 16925130], [16925131, 17865415], [17865416, 18805704]] SRR8481849 file size 4477181 SRR8481849 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8481849 SRR8481849_1.fastq Input file: SRR8481849_1.fastq trimmed: SRR8481849-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 18:46:31 2025 >> started Thu Feb 13 18:46:42 2025 >> done (10.286s) 18805704 reads processed; of these: 387 ( 0.00%) short reads filtered out after trimming by size control 202 ( 0.00%) empty reads filtered out after trimming by size control 18805115 (100.00%) reads available; of these: 993432 ( 5.28%) trimmed reads available after processing 17811683 (94.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 106 0.00% 19 155 0.00% 20 188 0.00% 21 290 0.00% 22 907 0.00% 23 517 0.00% 24 1215 0.01% 25 2412 0.01% 26 5783 0.03% 27 4569 0.02% 28 3451 0.02% 29 2299 0.01% 30 1431 0.01% 31 1148 0.01% 32 1209 0.01% 33 1174 0.01% 34 1171 0.01% 35 1239 0.01% 36 1308 0.01% 37 1439 0.01% 38 1444 0.01% 39 1446 0.01% 40 1581 0.01% 41 1507 0.01% 42 1594 0.01% 43 1777 0.01% 44 1847 0.01% 45 1936 0.01% 46 2130 0.01% 47 2254 0.01% 48 2255 0.01% 49 2356 0.01% 50 2526 0.01% 51 2667 0.01% 52 2720 0.01% 53 2686 0.01% 54 2898 0.02% 55 3035 0.02% 56 3088 0.02% 57 3074 0.02% 58 3077 0.02% 59 3338 0.02% 60 3488 0.02% 61 3703 0.02% 62 3887 0.02% 63 4027 0.02% 64 4222 0.02% 65 4349 0.02% 66 4684 0.02% 67 4994 0.03% 68 5164 0.03% 69 5492 0.03% 70 5797 0.03% 71 6048 0.03% 72 6541 0.03% 73 6943 0.04% 74 7894 0.04% 75 9884 0.05% 76 1934 0.01% 77 2556 0.01% 78 3616 0.02% 79 4562 0.02% 80 5113 0.03% 81 5745 0.03% 82 6265 0.03% 83 6950 0.04% 84 7876 0.04% 85 8243 0.04% 86 9042 0.05% 87 10015 0.05% 88 11010 0.06% 89 12590 0.07% 90 14165 0.08% 91 16383 0.09% 92 18988 0.10% 93 23277 0.12% 94 28317 0.15% 95 34499 0.18% 96 43796 0.23% 97 57705 0.31% 98 86207 0.46% 99 410957 2.19% 100 17804940 94.68% 18805115 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.69 fanout-score-rank=19 prefix-density=0.22 prefix-fanout=3.3 sequence=TTTCTCAATTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=71.92 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.8 sequence=ATAGCAACACTACCATTTTAATTATACATGAAAGATAAACAGGACGACAAGCAGCTAACACGACTTGAGACTTGATACTTGATACTAGAGAGGAAGCCCCAGAGCTGCAAATCCAAGAAGATTTGCAGAAAACAAGCCATGAATATATACTAGCTACTTTATTGAAACTTGTTGAAGACAAGAGACAACCCTTATAAACGCCTAGTAGATGAAATATTATTTCTTGTCAATCCGTCGATGCGATGATCATTTCTTGAATCAACGCAGCCAGCGGATCGCTCTCATTTACAAGTGCAAGGATCGCAGGTACAGTTGGCTCCACACTTGCAGCCATTCTCGGCTCCCACGACCGTCTCAGCAGCTCCCGCAAAGTGACCCTTCTCTGGTGCCACACCAAGAACCAGAGTTTCGTTGGTGATCGTCTCTGAGGAGCTCATGTCAGGGTACATCTTGCATCCTCCACAGCCGCTGCCGCACTT Started job on | Feb 13 18:46:59 Started mapping on | Feb 13 18:47:00 Finished on | Feb 13 18:47:21 Mapping speed, Million of reads per hour | 3223.73 Number of input reads | 18805115 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 17589083 Uniquely mapped reads % | 93.53% Average mapped length | 99.16 Number of splices: Total | 5366169 Number of splices: Annotated (sjdb) | 5277814 Number of splices: GT/AG | 5268659 Number of splices: GC/AG | 77134 Number of splices: AT/AC | 4422 Number of splices: Non-canonical | 15954 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 903925 % of reads mapped to multiple loci | 4.81% Number of reads mapped to too many loci | 84193 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.21% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 312107 312107 312107 N_multimapping 903925 903925 903925 N_noFeature 623972 17423448 706679 N_ambiguous 141103 506 57921 UnstrandedReadsAssigned:16824008 PositiveStrandReadsAssigned:165129 NegativeStrandReadsAssigned:16824483 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8481849 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR8481849-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,805,115 reads, 17,438,413 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,297 rounds 52401 SRR8481849.ke.tsv 34699 SRR8481849.se.tsv 87100 total ==> SRR8481849.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1323 51.4012 Potri.005G024800.1.v4.1 1035 936 300 23.8965 Potri.004G059700.1.v4.1 961 862 31 2.68129 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 648.526 17.0015 Potri.016G087400.1.v4.1 270 171 662.667 288.927 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 342.966 15.2751 Potri.012G127500.1.v4.1 977 878 170 14.4359 ==> SRR8481849.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 738 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 162 Potri.001G212900.v4.1 787 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 54 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 11 SRR8481849 completed mapping pipeline successfully