Starting /dee2/code/volunteer_pipeline.sh SRR8481850 current disk space = 3087702388736 free memory = 1443421600 SRR8481850 SRAfilesize 5583d48aae0c54f03cb9f685c72c411a SRR8481850.sra SRR8481850.sra file validated SRR8481850 is single end SRR8481850 is conventional basespace SRR8481850 read1 length is 74-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8481850_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 74-100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8905 34.0 33.0 34.0 31.0 34.0 2 32.6175 34.0 34.0 34.0 31.0 34.0 3 33.22125 34.0 34.0 34.0 31.0 34.0 4 36.55725 37.0 37.0 37.0 35.0 37.0 5 36.57425 37.0 37.0 37.0 35.0 37.0 6 36.61075 37.0 37.0 37.0 35.0 37.0 7 36.62125 37.0 37.0 37.0 35.0 37.0 8 36.5885 37.0 37.0 37.0 35.0 37.0 9 38.47675 39.0 39.0 39.0 37.0 39.0 10-11 38.51925 39.0 39.0 39.0 37.5 39.0 12-13 38.445125 39.0 39.0 39.0 37.0 39.0 14-15 40.055499999999995 41.0 40.0 41.0 38.0 41.0 16-17 40.172125 41.0 40.0 41.0 38.0 41.0 18-19 40.177375 41.0 40.0 41.0 38.5 41.0 20-21 40.163624999999996 41.0 40.0 41.0 38.5 41.0 22-23 40.10075 41.0 40.0 41.0 38.0 41.0 24-25 40.103875 41.0 40.0 41.0 38.0 41.0 26-27 40.095124999999996 41.0 40.0 41.0 38.0 41.0 28-29 39.95399999999999 41.0 40.0 41.0 38.0 41.0 30-31 40.033249999999995 41.0 40.0 41.0 38.0 41.0 32-33 39.99325 41.0 40.0 41.0 38.0 41.0 34-35 39.944874999999996 41.0 40.0 41.0 38.0 41.0 36-37 39.892375 41.0 40.0 41.0 38.0 41.0 38-39 39.919 41.0 40.0 41.0 38.0 41.0 40-41 39.892250000000004 41.0 40.0 41.0 38.0 41.0 42-43 39.835 41.0 40.0 41.0 38.0 41.0 44-45 39.762 41.0 40.0 41.0 38.0 41.0 46-47 39.735625 41.0 40.0 41.0 37.0 41.0 48-49 39.70575 41.0 40.0 41.0 37.0 41.0 50-51 39.659499999999994 41.0 40.0 41.0 37.0 41.0 52-53 39.57525 41.0 40.0 41.0 36.5 41.0 54-55 39.466750000000005 41.0 39.0 41.0 36.0 41.0 56-57 39.3065 41.0 39.0 41.0 35.5 41.0 58-59 39.156875 41.0 39.0 41.0 35.0 41.0 60-61 38.9615 40.0 38.5 41.0 35.0 41.0 62-63 38.719375 40.0 37.5 41.0 35.0 41.0 64-65 38.415875 40.0 37.0 41.0 35.0 41.0 66-67 38.048625 39.0 36.5 41.0 35.0 41.0 68-69 37.738125 39.0 36.0 41.0 35.0 41.0 70-71 37.343500000000006 38.0 35.5 40.0 34.0 41.0 72-73 36.945499999999996 37.0 35.0 39.0 34.0 41.0 74-75 36.451042229307326 37.0 35.0 39.0 34.0 41.0 76-77 34.16791697924481 34.5 33.0 36.5 30.0 38.5 78-79 35.56089022255564 36.0 35.0 37.0 33.0 39.0 80-81 35.32720680170043 35.0 35.0 37.0 33.5 39.0 82-83 35.03513378344586 35.0 35.0 36.0 33.0 37.0 84-85 34.80920230057514 35.0 35.0 36.0 33.0 37.0 86-87 34.593398349587396 35.0 35.0 36.0 33.0 37.0 88-89 34.426606651662915 35.0 35.0 35.0 33.0 36.0 90-91 34.33795948987247 35.0 35.0 35.0 33.0 36.0 92-93 34.20605151287822 35.0 35.0 35.0 33.0 36.0 94-95 34.20642660665166 35.0 35.0 35.0 33.0 36.0 96-97 34.10252563140786 35.0 35.0 35.0 33.0 36.0 98-99 34.03588397099274 35.0 35.0 35.0 32.5 35.0 100 31.516879219804952 34.0 31.0 35.0 25.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 2.0 22 5.0 23 4.0 24 6.0 25 2.0 26 8.0 27 8.0 28 18.0 29 17.0 30 28.0 31 38.0 32 31.0 33 54.0 34 80.0 35 102.0 36 239.0 37 763.0 38 2012.0 39 581.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.901493319360753 12.811108200157193 10.977207230809537 48.31019124967252 2 17.974999999999998 13.600000000000001 43.35 25.074999999999996 3 17.474999999999998 19.7 26.5 36.325 4 20.674999999999997 27.474999999999998 23.25 28.599999999999998 5 23.275000000000002 31.324999999999996 24.125 21.275 6 17.45 35.475 25.05 22.025 7 14.575 30.125 37.1 18.2 8 16.725 26.075 34.225 22.975 9 16.900000000000002 21.75 36.199999999999996 25.15 10-11 19.650000000000002 32.625 25.825 21.9 12-13 19.6875 26.987499999999997 27.474999999999998 25.85 14-15 18.462500000000002 28.9 28.787499999999998 23.849999999999998 16-17 19.0875 28.599999999999998 28.3125 24.0 18-19 19.2625 28.0875 28.6125 24.0375 20-21 18.975 28.7 28.012500000000003 24.3125 22-23 19.325 29.275000000000002 27.250000000000004 24.15 24-25 19.225 28.749999999999996 29.4 22.625 26-27 19.4625 28.3125 28.3125 23.9125 28-29 19.162499999999998 28.775000000000002 28.012500000000003 24.05 30-31 20.4125 28.0625 27.725 23.799999999999997 32-33 19.4875 29.462500000000002 27.5625 23.4875 34-35 19.0625 29.4375 28.037499999999998 23.4625 36-37 19.725 28.725 27.8125 23.7375 38-39 19.675 28.499999999999996 28.075 23.75 40-41 19.650000000000002 29.225 27.025 24.099999999999998 42-43 19.400000000000002 28.1375 28.012500000000003 24.45 44-45 19.45 28.749999999999996 28.212500000000002 23.5875 46-47 19.1375 28.775000000000002 28.512500000000003 23.575 48-49 20.2875 27.500000000000004 27.9125 24.3 50-51 18.862499999999997 29.275000000000002 28.925 22.9375 52-53 19.2625 29.2375 27.237499999999997 24.2625 54-55 19.725 28.6875 27.55 24.0375 56-57 19.900000000000002 28.4375 27.212500000000002 24.45 58-59 20.3 28.4125 27.375 23.9125 60-61 19.925 28.9875 26.974999999999998 24.1125 62-63 20.349999999999998 28.7375 27.287499999999998 23.625 64-65 19.675 30.099999999999998 26.8 23.425 66-67 20.724999999999998 28.3875 27.237499999999997 23.65 68-69 19.0125 28.625 27.275 25.087500000000002 70-71 19.3 28.925 27.1375 24.637500000000003 72-73 18.987499999999997 29.012500000000003 26.924999999999997 25.074999999999996 74-75 19.02737842230279 28.20352544068008 28.01600200025003 24.753094136767096 76-77 19.479869967491872 28.68217054263566 27.35683920980245 24.48112028007002 78-79 19.72993248312078 27.68192048012003 28.432108027006752 24.15603900975244 80-81 19.692423105776445 28.244561140285075 28.419604901225306 23.643410852713178 82-83 19.692423105776445 29.34483620905226 27.11927981995499 23.843460865216304 84-85 19.654913728432106 28.419604901225306 27.981995498874717 23.943485871467868 86-87 19.84246061515379 28.982245561390346 27.60690172543136 23.568392098024507 88-89 19.504876219054765 29.632408102025504 27.35683920980245 23.50587646911728 90-91 20.042510627656913 27.481870467616904 27.60690172543136 24.868717179294826 92-93 20.905226306576644 28.40710177544386 26.894223555888974 23.793448362090523 94-95 20.717679419854964 27.956989247311824 27.70692673168292 23.618404601150285 96-97 20.21755438859715 28.557139284821204 27.106776694173547 24.118529632408105 98-99 20.31757939484871 27.24431107776944 28.68217054263566 23.755938984746187 100 19.57831325301205 28.96586345381526 27.610441767068274 23.84538152610442 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 3.0 24 4.0 25 4.0 26 5.5 27 8.5 28 14.0 29 19.0 30 21.5 31 26.0 32 37.5 33 50.5 34 62.0 35 75.0 36 92.5 37 115.0 38 137.5 39 164.0 40 192.5 41 218.0 42 244.5 43 261.0 44 261.0 45 266.0 46 254.0 47 235.5 48 233.0 49 197.0 50 164.0 51 143.5 52 110.5 53 93.0 54 70.5 55 50.5 56 45.0 57 37.0 58 24.5 59 13.0 60 11.0 61 10.5 62 7.5 63 4.0 64 2.5 65 2.0 66 2.0 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.3750937734433608 >>END_MODULE >>Sequence Length Distribution warn #Length Count 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 3999.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14141414141415 98.15 2 0.7575757575757576 1.5 3 0.050505050505050504 0.15 4 0.050505050505050504 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093631 READS because READLEN < 1 Read 1093631 spots for SRR8481850.sra Written 1093631 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra Rejected 1093612 READS because READLEN < 1 Read 1093612 spots for SRR8481850.sra Written 1093612 spots for SRR8481850.sra SRR ids: ['SRR8481850.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_97x6mp5b SRR8481850.sra spots: 21872259 blocks: [[1, 1093612], [1093613, 2187224], [2187225, 3280836], [3280837, 4374448], [4374449, 5468060], [5468061, 6561672], [6561673, 7655284], [7655285, 8748896], [8748897, 9842508], [9842509, 10936120], [10936121, 12029732], [12029733, 13123344], [13123345, 14216956], [14216957, 15310568], [15310569, 16404180], [16404181, 17497792], [17497793, 18591404], [18591405, 19685016], [19685017, 20778628], [20778629, 21872259]] SRR8481850 file size 5210804 SRR8481850 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8481850 SRR8481850_1.fastq Input file: SRR8481850_1.fastq trimmed: SRR8481850-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 18:47:21 2025 >> started Thu Feb 13 18:47:31 2025 >> done (10.420s) 21872259 reads processed; of these: 90 ( 0.00%) short reads filtered out after trimming by size control 121 ( 0.00%) empty reads filtered out after trimming by size control 21872048 (100.00%) reads available; of these: 427378 ( 1.95%) trimmed reads available after processing 21444670 (98.05%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 23 0.00% 20 34 0.00% 21 49 0.00% 22 512 0.00% 23 24 0.00% 24 9 0.00% 25 8 0.00% 26 19 0.00% 27 75 0.00% 28 96 0.00% 29 12 0.00% 30 16 0.00% 31 18 0.00% 32 27 0.00% 33 174 0.00% 34 20 0.00% 35 28 0.00% 36 25 0.00% 37 36 0.00% 38 36 0.00% 39 21 0.00% 40 29 0.00% 41 31 0.00% 42 31 0.00% 43 52 0.00% 44 44 0.00% 45 46 0.00% 46 66 0.00% 47 39 0.00% 48 48 0.00% 49 52 0.00% 50 56 0.00% 51 48 0.00% 52 58 0.00% 53 59 0.00% 54 91 0.00% 55 63 0.00% 56 101 0.00% 57 89 0.00% 58 102 0.00% 59 15 0.00% 60 130 0.00% 61 135 0.00% 62 134 0.00% 63 256 0.00% 64 184 0.00% 65 213 0.00% 66 232 0.00% 67 239 0.00% 68 240 0.00% 69 291 0.00% 70 300 0.00% 71 309 0.00% 72 345 0.00% 73 438 0.00% 74 540 0.00% 75 608 0.00% 76 648 0.00% 77 62 0.00% 78 53 0.00% 79 46 0.00% 80 45 0.00% 81 56 0.00% 82 73 0.00% 83 80 0.00% 84 94 0.00% 85 146 0.00% 86 167 0.00% 87 194 0.00% 88 269 0.00% 89 374 0.00% 90 486 0.00% 91 623 0.00% 92 901 0.00% 93 1413 0.01% 94 2079 0.01% 95 3368 0.02% 96 5938 0.03% 97 12632 0.06% 98 35083 0.16% 99 362942 1.66% 100 21437281 98.01% 21872048 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=34 prefix-density=0.42 prefix-fanout=2.1 sequence=TAAAATCACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=28.40 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=3.1 sequence=CCAAATCCTCCTCGAAGAAGATTAAGCAGTTGCAATTGGACCCAGATTGACAGTGGTTTCTACAGCTTTCATGGCTTCAAATCTTGGCTCCTTGGCCTGGAATTTGAGGCCAGCATACAGCTTCATGTAGTCATCAAATACAAATTTTGGGTACACGTTTTTCTTCTCTTCTGCTTCCTTCTCCACCAAAGCTGGTGCTGGATAGATAACTGCTTCACTTCCAGGGTTATAGAAAGAAGCTACTGACATCCTAGTGCCATCCGTTTGAGCAATCACTCTGTGCTCCACACTCTTATACTTGCCATTGGTGATTACCTCGAGTTGGTCACCAAGGTTGACAACAATGGAGTGGCGCATCGGGGGCACATCAATCCACTGGCCATCCTTGAGA Started job on | Feb 13 18:47:52 Started mapping on | Feb 13 18:47:52 Finished on | Feb 13 18:48:54 Mapping speed, Million of reads per hour | 1269.99 Number of input reads | 21872048 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 18066944 Uniquely mapped reads % | 82.60% Average mapped length | 99.58 Number of splices: Total | 5317558 Number of splices: Annotated (sjdb) | 5219749 Number of splices: GT/AG | 5218251 Number of splices: GC/AG | 73916 Number of splices: AT/AC | 4953 Number of splices: Non-canonical | 20438 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.15 Insertion rate per base | 0.02% Insertion average length | 1.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 830827 % of reads mapped to multiple loci | 3.80% Number of reads mapped to too many loci | 58084 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.32% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2974277 2974277 2974277 N_multimapping 830827 830827 830827 N_noFeature 865638 17859629 975037 N_ambiguous 159347 609 61245 UnstrandedReadsAssigned:17041959 PositiveStrandReadsAssigned:206706 NegativeStrandReadsAssigned:17030662 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8481850 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR8481850-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,872,048 reads, 17,547,530 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,287 rounds 52401 SRR8481850.ke.tsv 34699 SRR8481850.se.tsv 87100 total ==> SRR8481850.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2013 74.3641 Potri.005G024800.1.v4.1 1035 936 473 35.8245 Potri.004G059700.1.v4.1 961 862 29 2.38498 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 849.771 21.182 Potri.016G087400.1.v4.1 270 171 591.211 245.098 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 621.957 26.339 Potri.012G127500.1.v4.1 977 878 248 20.024 ==> SRR8481850.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 482 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 796 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 140 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 16 SRR8481850 completed mapping pipeline successfully