Starting /dee2/code/volunteer_pipeline.sh SRR8481851 current disk space = 3087345995776 free memory = 1478542520 SRR8481851 SRAfilesize d120d783126576055692f085e496ce34 SRR8481851.sra SRR8481851.sra file validated SRR8481851 is single end SRR8481851 is conventional basespace SRR8481851 read1 length is 67-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8481851_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 67-100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2185 34.0 33.0 34.0 31.0 34.0 2 32.77825 34.0 34.0 34.0 31.0 34.0 3 33.2285 34.0 34.0 34.0 31.0 34.0 4 36.5515 37.0 37.0 37.0 35.0 37.0 5 36.54675 37.0 37.0 37.0 35.0 37.0 6 36.59075 37.0 37.0 37.0 35.0 37.0 7 36.58675 37.0 37.0 37.0 35.0 37.0 8 36.55475 37.0 37.0 37.0 35.0 37.0 9 38.482 39.0 39.0 39.0 37.0 39.0 10-11 38.51375 39.0 39.0 39.0 37.0 39.0 12-13 38.440625 39.0 39.0 39.0 37.0 39.0 14-15 40.05575 41.0 40.0 41.0 38.0 41.0 16-17 40.14075 41.0 40.0 41.0 38.0 41.0 18-19 40.185375 41.0 40.0 41.0 38.5 41.0 20-21 40.146375000000006 41.0 40.0 41.0 38.5 41.0 22-23 40.12525 41.0 40.0 41.0 38.5 41.0 24-25 40.068 41.0 40.0 41.0 38.0 41.0 26-27 40.118875 41.0 40.0 41.0 38.0 41.0 28-29 39.957125000000005 41.0 40.0 41.0 38.0 41.0 30-31 40.033375 41.0 40.0 41.0 38.0 41.0 32-33 40.029125 41.0 40.0 41.0 38.0 41.0 34-35 39.981 41.0 40.0 41.0 38.0 41.0 36-37 39.969750000000005 41.0 40.0 41.0 38.0 41.0 38-39 39.949875000000006 41.0 40.0 41.0 38.0 41.0 40-41 39.900125 41.0 40.0 41.0 38.0 41.0 42-43 39.835499999999996 41.0 40.0 41.0 38.0 41.0 44-45 39.781 41.0 40.0 41.0 38.0 41.0 46-47 39.784875 41.0 40.0 41.0 38.0 41.0 48-49 39.759875 41.0 40.0 41.0 37.0 41.0 50-51 39.7055 41.0 40.0 41.0 37.5 41.0 52-53 39.586125 41.0 40.0 41.0 37.0 41.0 54-55 39.420875 41.0 39.5 41.0 36.0 41.0 56-57 39.353375 41.0 39.0 41.0 36.0 41.0 58-59 39.210375 41.0 39.0 41.0 35.5 41.0 60-61 39.040375 40.5 38.5 41.0 35.0 41.0 62-63 38.7195 40.0 38.0 41.0 35.0 41.0 64-65 38.450500000000005 40.0 37.0 41.0 35.0 41.0 66-67 38.103 39.0 36.5 41.0 34.5 41.0 68-69 37.7759439859965 39.0 36.0 41.0 34.5 41.0 70-71 37.44973743435859 38.5 36.0 40.5 34.0 41.0 72-73 37.00450112528132 37.0 35.0 39.0 34.0 41.0 74-75 36.553763440860216 37.0 35.0 39.0 34.0 41.0 76-77 34.202550637659414 34.5 33.0 36.5 30.0 39.0 78-79 35.5406351587897 36.0 35.0 37.0 33.0 39.0 80-81 35.381845461365344 35.5 35.0 37.0 33.5 39.0 82-83 35.059014753688416 35.0 35.0 36.5 33.0 37.5 84-85 34.855338834708675 35.0 35.0 36.0 33.0 37.0 86-87 34.644661165291325 35.0 35.0 36.0 33.0 37.0 88-89 34.48774693673418 35.0 35.0 35.5 33.0 36.0 90-91 34.35846461615404 35.0 35.0 35.0 33.0 36.0 92-93 34.24193548387097 35.0 35.0 35.0 33.0 36.0 94-95 34.22743185796449 35.0 35.0 35.0 33.0 36.0 96-97 34.15741435358839 35.0 35.0 35.0 33.0 36.0 98-99 34.058389597399355 35.0 35.0 35.0 32.0 35.0 100 31.54713678419605 34.0 31.0 35.0 25.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 2.0 20 3.0 21 0.0 22 2.0 23 4.0 24 5.0 25 4.0 26 7.0 27 16.0 28 15.0 29 16.0 30 21.0 31 34.0 32 41.0 33 43.0 34 66.0 35 119.0 36 221.0 37 763.0 38 1954.0 39 662.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.089211618257263 13.407676348547717 11.20331950207469 49.29979253112033 2 18.375 15.0 42.75 23.875 3 17.549999999999997 19.425 27.450000000000003 35.575 4 21.224999999999998 27.6 23.1 28.075 5 21.75 31.424999999999997 25.95 20.875 6 18.525 33.85 26.474999999999998 21.15 7 14.475 28.9 38.375 18.25 8 17.525 24.925 33.775 23.775 9 17.424999999999997 21.15 35.725 25.7 10-11 19.662499999999998 33.4 25.662499999999998 21.275 12-13 19.5875 27.025 27.900000000000002 25.4875 14-15 19.5875 27.150000000000002 28.9875 24.275 16-17 18.5375 28.762500000000003 28.775000000000002 23.925 18-19 19.425 28.775000000000002 27.212500000000002 24.587500000000002 20-21 19.412499999999998 28.675 28.825 23.0875 22-23 19.975 29.375 27.175 23.474999999999998 24-25 19.2125 29.775000000000002 27.737499999999997 23.275000000000002 26-27 20.0 28.6875 28.262500000000003 23.05 28-29 19.4875 29.549999999999997 27.35 23.6125 30-31 18.775 29.6625 27.6875 23.875 32-33 20.2125 28.875 27.6625 23.25 34-35 19.425 29.625 27.200000000000003 23.75 36-37 18.987499999999997 27.650000000000002 29.562500000000004 23.799999999999997 38-39 19.787499999999998 28.0625 28.875 23.275000000000002 40-41 20.0375 28.4125 28.487499999999997 23.0625 42-43 19.15 28.875 28.3625 23.6125 44-45 19.25 29.95 27.4125 23.3875 46-47 19.975 28.999999999999996 27.712500000000002 23.3125 48-49 19.8625 28.549999999999997 27.2625 24.325 50-51 20.2875 28.5875 27.775 23.35 52-53 20.3125 29.4375 27.237499999999997 23.0125 54-55 20.2625 28.6375 27.625 23.474999999999998 56-57 19.75 28.512500000000003 27.8125 23.925 58-59 20.075000000000003 29.375 27.425 23.125 60-61 19.662499999999998 28.625 27.325 24.3875 62-63 18.787499999999998 29.049999999999997 28.275 23.8875 64-65 20.150000000000002 28.7375 27.6625 23.45 66-67 19.787499999999998 28.65 28.8875 22.675 68-69 20.305076269067268 28.569642410602654 27.60690172543136 23.518379594898725 70-71 20.05501375343836 27.731932983245812 27.84446111527882 24.36859214803701 72-73 20.030007501875467 29.03225806451613 27.68192048012003 23.25581395348837 74-75 20.517629407351837 28.382095523880967 27.494373593398347 23.605901475368842 76-77 19.092273068267065 29.207301825456366 27.86946736684171 23.830957739434858 78-79 20.192548137034258 27.394348587146787 28.657164291072768 23.755938984746187 80-81 20.392598149537385 27.956989247311824 27.656914228557138 23.99349837459365 82-83 20.730182545636406 28.169542385596397 27.66941735433858 23.43085771442861 84-85 19.442360590147537 30.320080020005 27.094273568392097 23.143285821455365 86-87 20.455113778444613 28.257064266066518 28.132033008252062 23.15578894723681 88-89 19.754938734683673 27.981995498874717 28.844711177794448 23.418354588647162 90-91 19.654913728432106 28.394598649662417 27.94448612153038 24.006001500375092 92-93 19.829957489372344 27.769442360590148 28.35708927231808 24.043510877719427 94-95 19.829957489372344 28.19454863715929 27.694423605901473 24.281070267566893 96-97 20.730182545636406 28.832208052013 26.93173293323331 23.50587646911728 98-99 19.99249812453113 28.507126781695426 28.34458614653663 23.15578894723681 100 20.613373554550023 27.601809954751133 27.978883861236802 23.80593262946204 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 3.5 23 2.5 24 2.0 25 4.5 26 4.5 27 10.0 28 17.0 29 21.0 30 24.5 31 32.0 32 48.0 33 53.5 34 62.0 35 80.0 36 93.0 37 100.5 38 133.0 39 177.5 40 202.0 41 236.0 42 257.0 43 258.0 44 262.0 45 256.0 46 252.0 47 243.0 48 217.5 49 184.5 50 160.5 51 132.0 52 99.5 53 83.5 54 62.0 55 42.5 56 44.0 57 39.0 58 24.0 59 18.0 60 13.5 61 11.0 62 6.5 63 4.0 64 3.5 65 2.5 66 2.5 67 3.0 68 1.5 69 0.0 70 0.5 71 1.5 72 1.0 73 0.0 74 1.5 75 1.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.5251312828207052 >>END_MODULE >>Sequence Length Distribution warn #Length Count 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 3999.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.3265511178095956 0.65 3 0.07535795026375283 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973245 READS because READLEN < 1 Read 973245 spots for SRR8481851.sra Written 973245 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra Rejected 973238 READS because READLEN < 1 Read 973238 spots for SRR8481851.sra Written 973238 spots for SRR8481851.sra SRR ids: ['SRR8481851.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hgr3f_tl SRR8481851.sra spots: 19464767 blocks: [[1, 973238], [973239, 1946476], [1946477, 2919714], [2919715, 3892952], [3892953, 4866190], [4866191, 5839428], [5839429, 6812666], [6812667, 7785904], [7785905, 8759142], [8759143, 9732380], [9732381, 10705618], [10705619, 11678856], [11678857, 12652094], [12652095, 13625332], [13625333, 14598570], [14598571, 15571808], [15571809, 16545046], [16545047, 17518284], [17518285, 18491522], [18491523, 19464767]] SRR8481851 file size 4634623 SRR8481851 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8481851 SRR8481851_1.fastq Input file: SRR8481851_1.fastq trimmed: SRR8481851-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 19:12:45 2025 >> started Thu Feb 13 19:12:55 2025 >> done (10.272s) 19464767 reads processed; of these: 115 ( 0.00%) short reads filtered out after trimming by size control 153 ( 0.00%) empty reads filtered out after trimming by size control 19464499 (100.00%) reads available; of these: 403563 ( 2.07%) trimmed reads available after processing 19060936 (97.93%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 29 0.00% 20 50 0.00% 21 67 0.00% 22 676 0.00% 23 32 0.00% 24 10 0.00% 25 18 0.00% 26 37 0.00% 27 77 0.00% 28 146 0.00% 29 21 0.00% 30 33 0.00% 31 23 0.00% 32 33 0.00% 33 212 0.00% 34 28 0.00% 35 42 0.00% 36 35 0.00% 37 43 0.00% 38 32 0.00% 39 42 0.00% 40 37 0.00% 41 45 0.00% 42 35 0.00% 43 41 0.00% 44 47 0.00% 45 52 0.00% 46 55 0.00% 47 58 0.00% 48 41 0.00% 49 56 0.00% 50 73 0.00% 51 49 0.00% 52 69 0.00% 53 80 0.00% 54 92 0.00% 55 90 0.00% 56 96 0.00% 57 132 0.00% 58 113 0.00% 59 143 0.00% 60 146 0.00% 61 175 0.00% 62 202 0.00% 63 192 0.00% 64 232 0.00% 65 265 0.00% 66 259 0.00% 67 334 0.00% 68 344 0.00% 69 357 0.00% 70 407 0.00% 71 406 0.00% 72 461 0.00% 73 568 0.00% 74 640 0.00% 75 735 0.00% 76 805 0.00% 77 73 0.00% 78 54 0.00% 79 50 0.00% 80 54 0.00% 81 59 0.00% 82 74 0.00% 83 105 0.00% 84 117 0.00% 85 138 0.00% 86 220 0.00% 87 258 0.00% 88 303 0.00% 89 360 0.00% 90 543 0.00% 91 724 0.00% 92 1030 0.01% 93 1371 0.01% 94 2161 0.01% 95 3637 0.02% 96 6083 0.03% 97 12601 0.06% 98 34121 0.18% 99 339214 1.74% 100 19051516 97.88% 19464499 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=31 prefix-density=0.14 prefix-fanout=2.0 sequence=TGCGACATGGTTGGCAAGAATCCTTCTGCGAATTTAGCAACAACCGAAGAATCAAGATACTCCTGCAAGCCCTCCAGATCATCAAAGGTAGTTTCAAAAGCATGAGTATATCCGAAATTGAGGTCGTGAATACCCAGATTAGTGCCCCAGTGTAAGCTCTTCAAGGGTTCAACTTGATTGACCAGATGAGTGAAGTCGTTTATGATTTTCTCAATTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=124.99 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=12.1 sequence=AAAACAACAACTCAACCCCAAGGGTTTTATTTTTAAGGAATAGCAGCACTCCCTTCACATAGCACAGCACAAACAAGAAATCAAGACACGAACATTCAGTGGTTCAAAACCAGCATTTATTGCACATTACATTACTTTATTCCCATGAAATAGCCCGGCCGAAGTCGTTACTCCTGAGCATTTAGTAGAGAAAGTAGTCTATCACAAGACGCTGTGACAAAGTAGGCAAAAATCCTTCTGCAAATGCAGCAAGAGCAGCAGAATCGAGGTACTCTTGCAAACCTGACTTGCTCTCAAATGTAGATTCAAAGGCATGAGTGTATCCTCGGTTTAGCTCCGCAGACTCCATGCCCAAATCCGTGCCCCAATTGAAACTCTTCATGGTTGGAATGAGATCGAGCAGATTGGTATAGTCATTAATGTAGTTGTCGATTTGTTCTCGTGTGATCTCATCCTTGAACCGAGTCAACAATGTGTGCTTCACAAGCT Started job on | Feb 13 19:13:15 Started mapping on | Feb 13 19:13:15 Finished on | Feb 13 19:13:38 Mapping speed, Million of reads per hour | 3046.62 Number of input reads | 19464499 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 18109109 Uniquely mapped reads % | 93.04% Average mapped length | 99.56 Number of splices: Total | 5172334 Number of splices: Annotated (sjdb) | 5081702 Number of splices: GT/AG | 5073923 Number of splices: GC/AG | 73696 Number of splices: AT/AC | 5226 Number of splices: Non-canonical | 19489 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.16 Insertion rate per base | 0.02% Insertion average length | 1.92 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 906575 % of reads mapped to multiple loci | 4.66% Number of reads mapped to too many loci | 181432 % of reads mapped to too many loci | 0.93% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.36% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 448815 448815 448815 N_multimapping 906575 906575 906575 N_noFeature 896973 17898100 1002437 N_ambiguous 172094 722 66265 UnstrandedReadsAssigned:17040042 PositiveStrandReadsAssigned:210287 NegativeStrandReadsAssigned:17040407 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8481851 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR8481851-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,464,499 reads, 17,705,804 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52401 SRR8481851.ke.tsv 34699 SRR8481851.se.tsv 87100 total ==> SRR8481851.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1917 70.1256 Potri.005G024800.1.v4.1 1035 936 361 27.0745 Potri.004G059700.1.v4.1 961 862 21 1.71018 Potri.007G009000.2.v4.1 1416 1317 1 0.053302 Potri.003G141000.2.v4.1 2943 2844 571 14.0941 Potri.016G087400.1.v4.1 270 171 571 234.406 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 131 5.49345 Potri.012G127500.1.v4.1 977 878 229 18.3092 ==> SRR8481851.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 890 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 167 Potri.001G212900.v4.1 1917 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 15 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 12 SRR8481851 completed mapping pipeline successfully