Starting /dee2/code/volunteer_pipeline.sh SRR8481852 current disk space = 3087382876160 free memory = 1489937804 SRR8481852 SRAfilesize 87a4313272b70e49acabd9f27a16bcc7 SRR8481852.sra SRR8481852.sra file validated SRR8481852 is single end SRR8481852 is conventional basespace SRR8481852 read1 length is 50-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8481852_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50-100 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.683 34.0 33.0 34.0 31.0 34.0 2 33.0785 34.0 34.0 34.0 31.0 34.0 3 33.333 34.0 34.0 34.0 31.0 34.0 4 36.611 37.0 37.0 37.0 35.0 37.0 5 36.57825 37.0 37.0 37.0 35.0 37.0 6 36.62625 37.0 37.0 37.0 35.0 37.0 7 36.618 37.0 37.0 37.0 35.0 37.0 8 36.59725 37.0 37.0 37.0 35.0 37.0 9 38.52225 39.0 39.0 39.0 37.0 39.0 10-11 38.54775 39.0 39.0 39.0 37.5 39.0 12-13 38.442499999999995 39.0 39.0 39.0 37.0 39.0 14-15 40.151624999999996 41.0 40.0 41.0 38.0 41.0 16-17 40.147999999999996 41.0 40.0 41.0 38.0 41.0 18-19 40.229875 41.0 40.0 41.0 39.0 41.0 20-21 40.1755 41.0 40.0 41.0 38.5 41.0 22-23 40.090500000000006 41.0 40.0 41.0 38.0 41.0 24-25 40.073499999999996 41.0 40.0 41.0 38.0 41.0 26-27 40.116875 41.0 40.0 41.0 38.0 41.0 28-29 40.06225 41.0 40.0 41.0 38.0 41.0 30-31 40.068250000000006 41.0 40.0 41.0 38.0 41.0 32-33 40.042125 41.0 40.0 41.0 38.0 41.0 34-35 39.935874999999996 41.0 40.0 41.0 38.0 41.0 36-37 39.927875 41.0 40.0 41.0 38.0 41.0 38-39 39.973625 41.0 40.0 41.0 38.0 41.0 40-41 39.924375 41.0 40.0 41.0 38.0 41.0 42-43 39.880125 41.0 40.0 41.0 38.0 41.0 44-45 39.803625 41.0 40.0 41.0 38.0 41.0 46-47 39.80975 41.0 40.0 41.0 37.5 41.0 48-49 39.744749999999996 41.0 40.0 41.0 37.5 41.0 50-51 39.68058417729432 41.0 40.0 41.0 37.0 41.0 52-53 39.586896724181045 41.0 40.0 41.0 37.0 41.0 54-55 39.435483870967744 41.0 39.0 41.0 36.0 41.0 56-57 39.31207801950488 41.0 39.0 41.0 36.0 41.0 58-59 39.15578894723681 41.0 39.0 41.0 35.0 41.0 60-61 39.032383095773945 40.5 38.5 41.0 35.0 41.0 62-63 38.70192548137034 40.0 37.5 41.0 35.0 41.0 64-65 38.54276069017254 40.0 37.0 41.0 35.0 41.0 66-67 38.2033008252063 39.0 37.0 41.0 35.0 41.0 68-69 37.82583145786447 39.0 36.0 41.0 34.5 41.0 70-71 37.47661915478869 38.0 35.5 40.5 34.5 41.0 72-73 37.04576144036009 37.0 35.0 39.5 34.0 41.0 74-75 36.60127531882971 37.0 35.0 39.0 34.0 41.0 76-77 34.213481740870435 34.5 33.0 36.5 30.5 38.5 78-79 35.5607803901951 36.0 35.0 37.0 33.0 39.0 80-81 35.387318659329665 35.0 35.0 37.0 33.0 39.0 82-83 35.14107053526763 35.0 35.0 36.5 34.0 38.0 84-85 34.943971985992995 35.0 35.0 36.0 33.5 37.0 86-87 34.68634317158579 35.0 35.0 36.0 33.0 37.0 88-89 34.567408704352175 35.0 35.0 35.5 33.0 36.0 90-91 34.43009004502251 35.0 35.0 35.0 33.0 36.0 92-93 34.29664832416208 35.0 35.0 35.0 33.0 36.0 94-95 34.2456228114057 35.0 35.0 35.0 33.0 36.0 96-97 34.20235117558779 35.0 35.0 35.0 33.0 36.0 98-99 34.01313156578289 35.0 35.0 35.0 32.0 35.0 100 31.329164582291146 34.0 31.0 35.0 25.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 1.0 20 2.0 21 1.0 22 2.0 23 3.0 24 3.0 25 1.0 26 10.0 27 7.0 28 13.0 29 10.0 30 23.0 31 32.0 32 32.0 33 59.0 34 78.0 35 115.0 36 232.0 37 770.0 38 1973.0 39 630.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.447395301327887 14.04494382022472 11.159346271705822 46.348314606741575 2 19.900000000000002 14.35 41.075 24.675 3 18.15 20.375 27.750000000000004 33.725 4 21.25 27.375 23.225 28.15 5 21.9 31.974999999999998 24.6 21.525 6 18.725 37.275000000000006 23.925 20.075000000000003 7 14.099999999999998 30.325000000000003 37.525 18.05 8 17.549999999999997 24.55 34.2 23.7 9 16.55 22.05 36.525 24.875 10-11 19.175 32.925 26.35 21.55 12-13 19.475 26.3 28.6625 25.5625 14-15 19.0125 28.0625 28.875 24.05 16-17 19.3125 28.575 28.4 23.7125 18-19 19.8875 28.549999999999997 28.525 23.0375 20-21 19.9125 28.95 27.650000000000002 23.4875 22-23 20.225 28.975 28.925 21.875 24-25 19.325 28.487499999999997 28.462500000000002 23.724999999999998 26-27 19.775000000000002 29.3375 27.4125 23.474999999999998 28-29 19.7 28.825 27.750000000000004 23.724999999999998 30-31 18.8375 29.3375 28.4 23.425 32-33 19.950000000000003 28.875 27.462500000000002 23.7125 34-35 20.05 29.7875 27.775 22.3875 36-37 19.575 29.512500000000003 28.075 22.8375 38-39 19.112499999999997 29.4 27.462500000000002 24.025 40-41 19.725 29.8375 27.400000000000002 23.0375 42-43 19.8875 28.849999999999998 27.6 23.6625 44-45 19.5 28.6625 28.475 23.3625 46-47 20.150000000000002 29.5375 26.987499999999997 23.325000000000003 48-49 20.1 28.0875 27.8875 23.925 50-51 19.62745343167896 28.55356919614952 27.415926990873857 24.40305038129766 52-53 20.005001250312578 29.444861215303824 27.206801700425103 23.34333583395849 54-55 20.305076269067268 29.132283070767688 27.106776694173547 23.455863965991497 56-57 19.72993248312078 27.94448612153038 27.84446111527882 24.48112028007002 58-59 20.16754188547137 28.51962990747687 27.66941735433858 23.643410852713178 60-61 19.654913728432106 29.232308077019255 26.944236059014752 24.168542135533883 62-63 20.05501375343836 29.232308077019255 28.794698674668666 21.91797949487372 64-65 20.24256064016004 28.33208302075519 27.956989247311824 23.468367091772944 66-67 20.255063765941486 28.40710177544386 27.656914228557138 23.680920230057513 68-69 19.94248562140535 29.107276819204802 27.53188297074269 23.418354588647162 70-71 20.280070017504375 28.857214303575894 27.419354838709676 23.443360840210055 72-73 19.10477619404851 29.232308077019255 27.619404851212803 24.043510877719427 74-75 20.29257314328582 29.48237059264816 27.031757939484873 23.193298324581146 76-77 19.70985492746373 29.877438719359677 27.238619309654826 23.17408704352176 78-79 19.597298649324664 28.414207103551774 28.101550775387697 23.88694347173587 80-81 20.372686343171587 28.70185092546273 27.47623811905953 23.449224612306153 82-83 19.3471735867934 29.33966983491746 27.97648824412206 23.336668334167083 84-85 20.16008004002001 29.027013506753374 27.5887943971986 23.224112056028016 86-87 20.27263631815908 27.726363181590795 28.40170085042521 23.59929964982491 88-89 19.85992996498249 27.763881940970485 28.51425712856428 23.861930965482742 90-91 20.76038019009505 27.963981990995496 27.426213106553277 23.84942471235618 92-93 20.147573786893446 27.826413206603302 28.51425712856428 23.51175587793897 94-95 20.610305152576288 28.676838419209606 27.326163081540773 23.386693346673336 96-97 19.809904952476238 27.788894447223612 28.42671335667834 23.974487243621812 98-99 20.01000500250125 28.91445722861431 27.47623811905953 23.59929964982491 100 19.79350289599597 27.524553009317554 29.690254343993956 22.99168975069252 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.5 23 3.5 24 4.0 25 6.0 26 9.0 27 14.0 28 17.5 29 17.0 30 22.0 31 34.5 32 42.0 33 51.0 34 65.0 35 80.0 36 101.5 37 135.0 38 160.5 39 168.0 40 178.5 41 201.5 42 224.0 43 251.0 44 276.0 45 260.0 46 244.5 47 256.5 48 234.5 49 187.0 50 167.5 51 141.0 52 101.0 53 77.5 54 64.0 55 47.5 56 34.0 57 30.0 58 23.5 59 15.0 60 12.0 61 10.5 62 6.5 63 5.0 64 3.5 65 1.5 66 2.0 67 3.0 68 3.0 69 2.0 70 0.5 71 0.0 72 0.0 73 1.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.6753376688344171 >>END_MODULE >>Sequence Length Distribution warn #Length Count 50-51 1.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 1.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 3998.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69879518072288 99.3 2 0.2761044176706827 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0251004016064257 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra Rejected 806504 READS because READLEN < 1 Read 806504 spots for SRR8481852.sra Written 806504 spots for SRR8481852.sra SRR ids: ['SRR8481852.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2knxucdd SRR8481852.sra spots: 16130080 blocks: [[1, 806504], [806505, 1613008], [1613009, 2419512], [2419513, 3226016], [3226017, 4032520], [4032521, 4839024], [4839025, 5645528], [5645529, 6452032], [6452033, 7258536], [7258537, 8065040], [8065041, 8871544], [8871545, 9678048], [9678049, 10484552], [10484553, 11291056], [11291057, 12097560], [12097561, 12904064], [12904065, 13710568], [13710569, 14517072], [14517073, 15323576], [15323577, 16130080]] SRR8481852 file size 3836837 SRR8481852 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8481852 SRR8481852_1.fastq Input file: SRR8481852_1.fastq trimmed: SRR8481852-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 19:12:51 2025 >> started Thu Feb 13 19:12:59 2025 >> done (7.682s) 16130080 reads processed; of these: 353 ( 0.00%) short reads filtered out after trimming by size control 371 ( 0.00%) empty reads filtered out after trimming by size control 16129356 (100.00%) reads available; of these: 320968 ( 1.99%) trimmed reads available after processing 15808388 (98.01%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 38 0.00% 20 57 0.00% 21 30 0.00% 22 507 0.00% 23 33 0.00% 24 8 0.00% 25 15 0.00% 26 59 0.00% 27 90 0.00% 28 47 0.00% 29 12 0.00% 30 10 0.00% 31 15 0.00% 32 30 0.00% 33 156 0.00% 34 23 0.00% 35 24 0.00% 36 26 0.00% 37 50 0.00% 38 36 0.00% 39 17 0.00% 40 72 0.00% 41 66 0.00% 42 14 0.00% 43 24 0.00% 44 23 0.00% 45 28 0.00% 46 34 0.00% 47 36 0.00% 48 35 0.00% 49 39 0.00% 50 36 0.00% 51 50 0.00% 52 36 0.00% 53 38 0.00% 54 51 0.00% 55 58 0.00% 56 62 0.00% 57 71 0.00% 58 67 0.00% 59 162 0.00% 60 166 0.00% 61 210 0.00% 62 255 0.00% 63 182 0.00% 64 223 0.00% 65 199 0.00% 66 262 0.00% 67 257 0.00% 68 269 0.00% 69 321 0.00% 70 309 0.00% 71 400 0.00% 72 391 0.00% 73 466 0.00% 74 550 0.00% 75 655 0.00% 76 707 0.00% 77 66 0.00% 78 41 0.00% 79 26 0.00% 80 37 0.00% 81 48 0.00% 82 64 0.00% 83 66 0.00% 84 93 0.00% 85 105 0.00% 86 165 0.00% 87 172 0.00% 88 234 0.00% 89 346 0.00% 90 349 0.00% 91 531 0.00% 92 753 0.00% 93 1136 0.01% 94 1721 0.01% 95 2744 0.02% 96 4920 0.03% 97 10169 0.06% 98 27308 0.17% 99 269680 1.67% 100 15800459 97.96% 16129356 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=4.38 fanout-score-rank=15 prefix-density=0.27 prefix-fanout=3.2 sequence=TTTCTCAATTTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=156.04 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.7 sequence=AAAACAACAACTCAACCCCAAGGGTTTTATTTTTAAGGAATAGCAGCACTCCCTTCACATAGCACAGCACAAACAAGAAATCAAGACACGAACATTCAGTGGTTCAAAACCAGCATTTATTGCACATTACATTACTTTATTCCCATGAAATAGCCCGGCCGAAGTCGTTACTCCTGAGCATTTAGTAGAGAAAGTAGTCTATCACAAGACGCTGTGACAAAGTAGGCAAAAATCCTTCTGCAAATGCAGCAAGAGCAGCAGAATCGAGGTACTCTTGCAAACCTGACTTGCTCTCAAATGTAGATTCAAAGGCATGAGTGTATCCTCGGTTTAGCTCCGCAGACTCCATGCCCAAATCCGTGCCCCAATTGAAACTCTTCATGGTTGGAATGAGATCGAGCAGATTGGTATAGTCATTAATGTAGTTGTCGATTTGTTCTCGTGTGATCTCATCCTTGA Started job on | Feb 13 19:13:17 Started mapping on | Feb 13 19:13:17 Finished on | Feb 13 19:13:37 Mapping speed, Million of reads per hour | 2903.28 Number of input reads | 16129356 Average input read length | 99 UNIQUE READS: Uniquely mapped reads number | 15120874 Uniquely mapped reads % | 93.75% Average mapped length | 99.54 Number of splices: Total | 4237427 Number of splices: Annotated (sjdb) | 4164870 Number of splices: GT/AG | 4155329 Number of splices: GC/AG | 59338 Number of splices: AT/AC | 5220 Number of splices: Non-canonical | 17540 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.13 Insertion rate per base | 0.02% Insertion average length | 1.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 700385 % of reads mapped to multiple loci | 4.34% Number of reads mapped to too many loci | 67713 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.48% % of reads unmapped: other | 0.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 308097 308097 308097 N_multimapping 700385 700385 700385 N_noFeature 685326 14937967 776334 N_ambiguous 148735 517 56690 UnstrandedReadsAssigned:14286813 PositiveStrandReadsAssigned:182390 NegativeStrandReadsAssigned:14287850 Dataset is classified negative stranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR8481852 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR8481852-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,129,356 reads, 14,749,347 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,218 rounds 52401 SRR8481852.ke.tsv 34699 SRR8481852.se.tsv 87100 total ==> SRR8481852.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1689 69.4005 Potri.005G024800.1.v4.1 1035 936 499 42.0371 Potri.004G059700.1.v4.1 961 862 50 4.57373 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 517 14.3341 Potri.016G087400.1.v4.1 270 171 629.651 290.343 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 283 13.3303 Potri.012G127500.1.v4.1 977 878 158 14.1896 ==> SRR8481852.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 551 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 199 Potri.001G212900.v4.1 1278 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 64 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 6 SRR8481852 completed mapping pipeline successfully