Starting /dee2/code/volunteer_pipeline.sh SRR8585539 current disk space = 3087369580544 free memory = 1432796872 SRR8585539 SRAfilesize 90adfa22b357e32e85756be72df75322 SRR8585539.sra SRR8585539.sra file validated SRR8585539 is paired end SRR8585539 is conventional basespace SRR8585539 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8585539_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.605 32.0 27.0 32.0 12.0 32.0 2 27.8175 32.0 27.0 32.0 12.0 32.0 3 28.97875 32.0 27.0 32.0 12.0 37.0 4 34.87125 37.0 32.0 37.0 32.0 37.0 5 33.67625 37.0 32.0 37.0 27.0 37.0 6 37.8585 41.0 37.0 41.0 32.0 41.0 7 38.39225 41.0 37.0 41.0 32.0 41.0 8 39.3635 41.0 41.0 41.0 37.0 41.0 9 35.6995 41.0 32.0 41.0 22.0 41.0 10-14 38.7783 41.0 40.2 41.0 35.0 41.0 15-19 38.642250000000004 41.0 38.6 41.0 33.0 41.0 20-24 39.18645 41.0 39.4 41.0 34.8 41.0 25-29 38.88304999999999 41.0 39.4 41.0 33.0 41.0 30-34 36.54595 40.2 33.8 41.0 25.0 41.0 35-39 38.4373 41.0 39.4 41.0 33.0 41.0 40-44 38.67505 41.0 39.4 41.0 34.0 41.0 45-49 37.823699999999995 41.0 38.6 41.0 29.0 41.0 50-54 38.58515 41.0 39.4 41.0 33.0 41.0 55-59 38.66525 41.0 38.6 41.0 33.0 41.0 60-64 38.041450000000005 41.0 38.4 41.0 31.0 41.0 65-69 37.8968 41.0 38.6 41.0 30.0 41.0 70-74 36.44755 40.2 34.0 41.0 25.0 41.0 75-79 35.5505 40.2 34.0 41.0 20.0 41.0 80-84 36.57425 40.2 35.0 41.0 25.0 41.0 85-89 34.53945 38.2 30.0 40.2 23.0 41.0 90-94 36.7474 41.0 35.0 41.0 26.0 41.0 95-99 37.77315 41.0 37.0 41.0 30.0 41.0 100-104 37.321799999999996 41.0 36.0 41.0 27.0 41.0 105-109 36.15615 40.2 33.0 41.0 25.0 41.0 110-114 35.0362 38.6 32.0 41.0 21.0 41.0 115-119 35.87865 38.6 33.0 41.0 24.0 41.0 120-124 34.74665 38.4 31.0 41.0 22.0 41.0 125-129 35.42100000000001 37.8 34.0 41.0 21.0 41.0 130-134 34.628049999999995 39.4 32.0 41.0 21.0 41.0 135-139 21.14515 16.0 12.0 31.0 11.2 36.8 140-144 29.6488 32.0 23.0 39.4 14.0 40.2 145-149 21.03545 18.0 14.0 29.0 9.6 35.8 150 15.5435 12.0 12.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 4.0 24 9.0 25 23.0 26 33.0 27 41.0 28 60.0 29 105.0 30 139.0 31 172.0 32 248.0 33 291.0 34 402.0 35 457.0 36 481.0 37 571.0 38 599.0 39 350.0 40 13.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.875 14.75 14.475 37.9 2 26.55 19.85 32.775 20.825 3 22.075 23.925 23.25 30.75 4 23.025000000000002 31.125000000000004 20.95 24.9 5 21.85 36.15 23.3 18.7 6 17.95 35.875 24.975 21.2 7 12.950000000000001 27.35 38.875 20.825 8 16.675 25.15 31.6 26.575 9 18.099999999999998 24.65 32.85 24.4 10-14 19.650000000000002 31.064999999999998 26.284999999999997 23.0 15-19 18.795 30.075000000000003 27.85 23.28 20-24 18.45 30.145 27.884999999999998 23.52 25-29 18.35 30.37 28.08 23.200000000000003 30-34 19.009999999999998 29.845 28.355000000000004 22.79 35-39 18.685 30.31 27.755000000000003 23.25 40-44 19.075 30.595 27.189999999999998 23.14 45-49 19.255 29.5 27.565 23.68 50-54 18.98 29.575000000000003 27.415 24.03 55-59 19.509999999999998 29.875 27.435 23.18 60-64 19.805 29.225 28.025 22.945 65-69 19.29 29.37 27.305 24.035 70-74 19.98 29.65 27.37 23.0 75-79 19.775000000000002 29.29 27.685 23.25 80-84 19.415 29.520000000000003 27.794999999999998 23.27 85-89 19.955000000000002 29.225 27.705000000000002 23.115 90-94 19.775000000000002 29.255 27.605 23.365 95-99 19.56 29.395 27.46 23.585 100-104 19.55 28.93 27.74 23.78 105-109 19.41 29.445 27.76 23.385 110-114 20.165 28.294999999999998 28.139999999999997 23.400000000000002 115-119 19.509999999999998 28.785 27.955000000000002 23.75 120-124 19.509999999999998 28.725 28.4 23.365 125-129 19.67 28.560000000000002 28.139999999999997 23.630000000000003 130-134 20.085 28.83 28.08 23.005 135-139 22.52 26.47 30.445 20.565 140-144 19.63 27.725 29.34 23.305 145-149 22.400000000000002 27.115000000000002 30.049999999999997 20.435 150 27.675 27.925 31.724999999999998 12.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.5 20 2.0 21 1.0 22 1.0 23 1.5 24 6.0 25 6.5 26 7.0 27 14.5 28 19.0 29 26.5 30 30.0 31 46.0 32 63.5 33 68.0 34 80.0 35 96.0 36 122.0 37 145.5 38 161.5 39 179.5 40 196.5 41 226.0 42 249.0 43 262.5 44 264.5 45 241.5 46 218.0 47 213.5 48 197.5 49 163.5 50 132.0 51 105.0 52 101.0 53 85.5 54 59.5 55 45.0 56 40.0 57 28.0 58 16.5 59 16.0 60 11.0 61 8.5 62 7.0 63 6.0 64 4.5 65 4.0 66 4.5 67 2.5 68 0.5 69 1.0 70 2.5 71 3.0 72 1.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.96038571800885 92.05 2 3.857180088610894 7.3999999999999995 3 0.1563721657544957 0.44999999999999996 4 0.026062027625749284 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0125 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.0875 0.0 0.0 0.0 0.0 124-125 0.125 0.0 0.0 0.0 0.0 126-127 0.1375 0.0 0.0 0.0 0.0 128-129 0.15 0.0 0.0 0.0 0.0 130-131 0.15 0.0 0.0 0.0 0.0 132-133 0.15 0.0 0.0 0.0 0.0 134-135 0.15 0.0 0.0 0.0 0.0 136-137 0.15 0.0 0.0 0.0 0.0 138 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCGTAT 10 0.006973645 144.0 6 GGCCAGC 10 0.006973645 144.0 1 TCGTATT 10 0.006973645 144.0 7 TCTTTCG 10 0.006973645 144.0 3 TTTCGTA 10 0.006973645 144.0 5 >>END_MODULE SRR8585539 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8585539_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.47625 32.0 32.0 32.0 12.0 32.0 2 21.60625 27.0 12.0 32.0 12.0 32.0 3 29.2025 32.0 32.0 32.0 12.0 37.0 4 33.3275 37.0 32.0 37.0 22.0 37.0 5 35.73125 37.0 37.0 37.0 32.0 37.0 6 36.358 41.0 37.0 41.0 22.0 41.0 7 36.20975 41.0 37.0 41.0 22.0 41.0 8 37.66725 41.0 37.0 41.0 27.0 41.0 9 38.997 41.0 41.0 41.0 37.0 41.0 10-14 35.3758 39.4 32.0 41.0 21.0 41.0 15-19 37.0303 40.2 35.8 41.0 27.0 41.0 20-24 36.1871 40.2 35.0 41.0 25.0 41.0 25-29 35.050599999999996 39.4 32.0 41.0 20.0 41.0 30-34 36.87455 41.0 36.0 41.0 26.0 41.0 35-39 35.5941 40.2 34.0 41.0 20.0 41.0 40-44 35.51235 39.4 33.0 41.0 21.0 41.0 45-49 36.04925 41.0 35.0 41.0 22.0 41.0 50-54 36.00825 41.0 34.0 41.0 24.0 41.0 55-59 35.16875 40.2 33.0 41.0 18.0 41.0 60-64 31.594450000000002 35.8 22.0 41.0 14.0 41.0 65-69 33.519999999999996 38.6 29.0 41.0 16.0 41.0 70-74 31.43915 35.0 25.0 41.0 14.0 41.0 75-79 30.120150000000002 34.0 21.0 40.2 14.0 41.0 80-84 32.1711 36.8 26.0 41.0 14.0 41.0 85-89 32.7562 37.0 27.0 41.0 16.0 41.0 90-94 30.0123 34.0 19.0 41.0 12.0 41.0 95-99 30.3849 35.0 22.0 39.4 14.0 41.0 100-104 31.6539 35.0 25.0 40.2 16.0 41.0 105-109 35.749900000000004 40.2 35.0 41.0 21.0 41.0 110-114 29.838849999999997 31.0 25.0 38.4 12.0 40.2 115-119 33.20785 37.0 30.0 41.0 16.0 41.0 120-124 33.64325 38.6 29.0 41.0 18.0 41.0 125-129 26.387349999999998 26.0 19.0 34.8 11.2 39.2 130-134 22.75545 20.0 14.0 31.0 10.4 37.8 135-139 28.21465 30.0 20.0 37.6 12.0 40.2 140-144 20.19325 18.0 12.0 28.0 10.4 36.0 145-149 20.17735 18.0 12.0 26.0 10.4 35.0 150 20.29075 22.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 5.0 20 51.0 21 80.0 22 96.0 23 103.0 24 134.0 25 150.0 26 148.0 27 183.0 28 196.0 29 217.0 30 232.0 31 227.0 32 272.0 33 294.0 34 303.0 35 283.0 36 348.0 37 316.0 38 240.0 39 113.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.2 21.975 16.05 31.775 2 29.625 29.575000000000003 29.625 11.175 3 22.825 31.874999999999996 24.8 20.5 4 23.95 37.824999999999996 21.775 16.45 5 24.8 38.0 22.375 14.825 6 19.400000000000002 38.05 25.0 17.549999999999997 7 19.275000000000002 16.525000000000002 41.85 22.35 8 22.55 23.849999999999998 28.999999999999996 24.6 9 23.875 23.65 30.049999999999997 22.425 10-14 25.374999999999996 28.645 24.884999999999998 21.095 15-19 23.925 27.894999999999996 28.075 20.105 20-24 23.925 27.955000000000002 28.52 19.6 25-29 24.0 28.605000000000004 27.765 19.63 30-34 23.825 28.884999999999998 27.785 19.505 35-39 24.33 28.015 28.050000000000004 19.605 40-44 24.12 28.87 27.339999999999996 19.67 45-49 23.64 28.28 27.68 20.4 50-54 23.77 27.935 28.215 20.080000000000002 55-59 24.235 27.389999999999997 28.02 20.355 60-64 25.230000000000004 27.694999999999997 27.85 19.225 65-69 24.33 27.42 28.360000000000003 19.89 70-74 24.64 27.544999999999998 27.83 19.985 75-79 24.48 27.500000000000004 28.044999999999998 19.975 80-84 24.765 27.71 27.675 19.85 85-89 23.835 27.675 28.525 19.965 90-94 24.279999999999998 28.025 28.275 19.42 95-99 24.23 27.889999999999997 28.765 19.115 100-104 24.45 27.625 28.395 19.53 105-109 23.575 28.249999999999996 28.28 19.895 110-114 25.185000000000002 27.48 28.675 18.66 115-119 24.099999999999998 27.725 28.435 19.74 120-124 23.27 27.63 28.935 20.165 125-129 25.1 27.73 28.71 18.459999999999997 130-134 26.22 26.52 28.975 18.285 135-139 24.4 27.21 29.330000000000002 19.06 140-144 26.625 26.815 29.04 17.52 145-149 25.445 27.13 29.325000000000003 18.099999999999998 150 26.450000000000003 26.325 29.325000000000003 17.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 1.5 23 0.5 24 2.0 25 4.0 26 4.5 27 7.0 28 9.5 29 12.5 30 21.5 31 24.5 32 31.0 33 45.0 34 54.0 35 63.5 36 88.0 37 122.0 38 141.5 39 161.0 40 199.5 41 234.5 42 248.5 43 247.5 44 256.5 45 257.0 46 256.5 47 243.0 48 219.0 49 213.0 50 166.0 51 126.0 52 114.5 53 85.5 54 72.5 55 69.5 56 56.0 57 41.5 58 25.0 59 16.5 60 13.0 61 11.0 62 8.5 63 4.5 64 3.5 65 3.0 66 2.0 67 1.0 68 2.0 69 1.5 70 1.0 71 1.0 72 0.0 73 1.5 74 2.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.11265790152102 94.175 2 2.6811033771590616 5.2 3 0.18045888115493686 0.525 4 0.025779840164990978 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0125 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.025 0.0 0.0 0.0 0.0 134-135 0.025 0.0 0.0 0.0 0.0 136-137 0.025 0.0 0.0 0.0 0.0 138 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCCTT 10 0.006973645 144.0 8 ATGGCTC 10 0.006973645 144.0 2 CGAGGGT 10 0.006973645 144.0 8 TGGCTCG 10 0.006973645 144.0 3 TTATGTA 10 0.006973645 144.0 2 ATCCTTC 10 0.006973645 144.0 9 >>END_MODULE Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621495 spots for SRR8585539.sra Written 1621495 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra Read 1621494 spots for SRR8585539.sra Written 1621494 spots for SRR8585539.sra SRR ids: ['SRR8585539.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_af9rxe93 SRR8585539.sra spots: 32429881 blocks: [[1, 1621494], [1621495, 3242988], [3242989, 4864482], [4864483, 6485976], [6485977, 8107470], [8107471, 9728964], [9728965, 11350458], [11350459, 12971952], [12971953, 14593446], [14593447, 16214940], [16214941, 17836434], [17836435, 19457928], [19457929, 21079422], [21079423, 22700916], [22700917, 24322410], [24322411, 25943904], [25943905, 27565398], [27565399, 29186892], [29186893, 30808386], [30808387, 32429881]] SRR8585539 file size 10904382 SRR8585539 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8585539 SRR8585539_1.fastq SRR8585539_2.fastq Input file: SRR8585539_1.fastq Paired file: SRR8585539_2.fastq trimmed: SRR8585539-trimmed-pair1.fastq, SRR8585539-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:13:26 2025 >> started Thu Feb 13 19:14:02 2025 >> done (35.796s) 32429881 read pairs processed; of these: 3 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 32429878 (100.00%) read pairs available; of these: 925140 ( 2.85%) trimmed read pairs available after processing 31504738 (97.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 8 0.00% 25 5 0.00% 26 6 0.00% 27 12 0.00% 28 4 0.00% 29 6 0.00% 30 3 0.00% 31 10 0.00% 32 13 0.00% 33 6 0.00% 34 8 0.00% 35 11 0.00% 36 11 0.00% 37 6 0.00% 38 12 0.00% 39 12 0.00% 40 13 0.00% 41 12 0.00% 42 20 0.00% 43 23 0.00% 44 20 0.00% 45 16 0.00% 46 15 0.00% 47 19 0.00% 48 17 0.00% 49 13 0.00% 50 20 0.00% 51 16 0.00% 52 21 0.00% 53 14 0.00% 54 21 0.00% 55 21 0.00% 56 28 0.00% 57 30 0.00% 58 21 0.00% 59 27 0.00% 60 30 0.00% 61 28 0.00% 62 32 0.00% 63 36 0.00% 64 39 0.00% 65 32 0.00% 66 31 0.00% 67 32 0.00% 68 28 0.00% 69 34 0.00% 70 32 0.00% 71 30 0.00% 72 35 0.00% 73 37 0.00% 74 35 0.00% 75 30 0.00% 76 27 0.00% 77 30 0.00% 78 40 0.00% 79 47 0.00% 80 27 0.00% 81 41 0.00% 82 36 0.00% 83 39 0.00% 84 40 0.00% 85 32 0.00% 86 41 0.00% 87 42 0.00% 88 28 0.00% 89 33 0.00% 90 47 0.00% 91 27 0.00% 92 44 0.00% 93 38 0.00% 94 30 0.00% 95 31 0.00% 96 22 0.00% 97 29 0.00% 98 32 0.00% 99 27 0.00% 100 22 0.00% 101 40 0.00% 102 26 0.00% 103 43 0.00% 104 40 0.00% 105 28 0.00% 106 29 0.00% 107 26 0.00% 108 36 0.00% 109 31 0.00% 110 35 0.00% 111 36 0.00% 112 36 0.00% 113 35 0.00% 114 36 0.00% 115 31 0.00% 116 41 0.00% 117 22 0.00% 118 25 0.00% 119 19 0.00% 120 23 0.00% 121 51 0.00% 122 39 0.00% 123 37 0.00% 124 27 0.00% 125 28 0.00% 126 32 0.00% 127 25 0.00% 128 29 0.00% 129 27 0.00% 130 29 0.00% 131 51 0.00% 132 67 0.00% 133 35 0.00% 134 41 0.00% 135 34 0.00% 136 34 0.00% 137 17 0.00% 138 18 0.00% 139 26 0.00% 140 247 0.00% 141 15885 0.05% 142 16204 0.05% 143 17061 0.05% 144 17643 0.05% 145 18111 0.06% 146 19641 0.06% 147 25150 0.08% 148 65747 0.20% 149 726263 2.24% 150 31504738 97.15% 32429878 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=39 prefix-density=0.20 prefix-fanout=2.5 sequence=GTCAGGGTACAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=74.07 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.2 sequence=CAACACAAACTTCCTCATAAACTTACCAACCCTCCTTTCCATTCTCACATACTTGGCCCCTTCTTTCTCCTCTCCGCGCTTCCTCTCTCCACTGATAACCAGCACATTGTCATCCTCCACTTGAACCTTGATGTCCCCTGATTTCAGTCCCGGCATGTCAATAACGAACGCATAAGAGTTTGGATACTCTTTCACATCAGCTGGTGTTGATGCCATTGCCTTGGCATCACGTACGTAAGTGCGTGTTGGCGCATTGAAGGA criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=5.02 fanout-score-rank=26 prefix-density=0.86 prefix-fanout=1.9 sequence=CTGCAAGTGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=222.99 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=12.3 sequence=ACAACAACAAAGAGCTGTCGGAAGCAAGAAATTAGAAGATGCACAA SRR8585539 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:14:52 Started mapping on | Feb 13 19:14:52 Finished on | Feb 13 19:21:30 Mapping speed, Million of reads per hour | 293.34 Number of input reads | 32429878 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 29319760 Uniquely mapped reads % | 90.41% Average mapped length | 295.85 Number of splices: Total | 27388969 Number of splices: Annotated (sjdb) | 26415084 Number of splices: GT/AG | 26793653 Number of splices: GC/AG | 387491 Number of splices: AT/AC | 25770 Number of splices: Non-canonical | 182055 Mismatch rate per base, % | 1.30% Deletion rate per base | 0.11% Deletion average length | 3.09 Insertion rate per base | 0.07% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1470398 % of reads mapped to multiple loci | 4.53% Number of reads mapped to too many loci | 45830 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.73% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1639720 1639720 1639720 N_multimapping 1470398 1470398 1470398 N_noFeature 1075110 28779542 1291121 N_ambiguous 576739 3149 251469 UnstrandedReadsAssigned:27667911 PositiveStrandReadsAssigned:537069 NegativeStrandReadsAssigned:27777170 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8585539 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8585539-trimmed-pair1.fastq SRR8585539-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,429,878 reads, 26,629,834 reads pseudoaligned [quant] estimated average fragment length: 265.51 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR8585539.ke.tsv 34699 SRR8585539.se.tsv 87100 total ==> SRR8585539.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.49 1544 18.4862 Potri.005G024800.1.v4.1 1035 770.49 982 26.7576 Potri.004G059700.1.v4.1 961 696.495 0 0 Potri.007G009000.2.v4.1 1416 1151.49 0 0 Potri.003G141000.2.v4.1 2943 2678.49 1551.35 12.1596 Potri.016G087400.1.v4.1 270 45.015 3005.5 1401.72 Potri.015G069301.1.v4.1 564 299.652 0 0 Potri.010G195200.1.v4.1 1773 1508.49 2486.97 34.6123 Potri.012G127500.1.v4.1 977 712.49 1974 58.1662 ==> SRR8585539.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 331 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 35 SRR8585539 completed mapping pipeline successfully