Starting /dee2/code/volunteer_pipeline.sh SRR8585540 current disk space = 3087659941888 free memory = 1398666892 SRR8585540 SRAfilesize 2d4e3e41e38269265ec28741b2cf6dc7 SRR8585540.sra SRR8585540.sra file validated SRR8585540 is paired end SRR8585540 is conventional basespace SRR8585540 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8585540_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.015 32.0 32.0 32.0 32.0 32.0 2 31.5025 32.0 32.0 32.0 32.0 32.0 3 35.42875 37.0 37.0 37.0 32.0 37.0 4 35.9225 37.0 37.0 37.0 32.0 37.0 5 36.175 37.0 37.0 37.0 37.0 37.0 6 39.72625 41.0 41.0 41.0 37.0 41.0 7 39.7495 41.0 41.0 41.0 37.0 41.0 8 39.9045 41.0 41.0 41.0 37.0 41.0 9 39.7385 41.0 41.0 41.0 37.0 41.0 10-14 39.85425 41.0 41.0 41.0 37.0 41.0 15-19 39.7478 41.0 41.0 41.0 37.0 41.0 20-24 39.44715 41.0 41.0 41.0 37.0 41.0 25-29 39.56185000000001 41.0 41.0 41.0 37.0 41.0 30-34 39.433800000000005 41.0 41.0 41.0 36.0 41.0 35-39 39.60755 41.0 41.0 41.0 37.0 41.0 40-44 39.55844999999999 41.0 41.0 41.0 37.0 41.0 45-49 39.15745 41.0 41.0 41.0 36.0 41.0 50-54 38.85765 41.0 41.0 41.0 34.0 41.0 55-59 38.942 41.0 41.0 41.0 34.0 41.0 60-64 39.139399999999995 41.0 41.0 41.0 35.0 41.0 65-69 39.365849999999995 41.0 41.0 41.0 37.0 41.0 70-74 39.01855 41.0 41.0 41.0 34.0 41.0 75-79 38.0264 41.0 37.0 41.0 30.0 41.0 80-84 38.8897 41.0 41.0 41.0 32.0 41.0 85-89 38.39995 41.0 39.4 41.0 32.0 41.0 90-94 38.435300000000005 41.0 40.2 41.0 32.0 41.0 95-99 38.9755 41.0 41.0 41.0 33.0 41.0 100-104 38.841150000000006 41.0 41.0 41.0 34.0 41.0 105-109 37.44154999999999 41.0 37.0 41.0 28.0 41.0 110-114 37.491299999999995 41.0 37.0 41.0 29.0 41.0 115-119 36.76715 40.2 36.0 41.0 26.0 41.0 120-124 36.09275 40.2 36.0 41.0 24.0 41.0 125-129 37.309549999999994 41.0 37.0 41.0 29.0 41.0 130-134 36.126900000000006 40.2 35.0 41.0 24.0 41.0 135-139 35.092949999999995 40.2 32.0 41.0 21.0 41.0 140-144 33.31545 37.4 28.0 40.2 20.0 41.0 145-149 33.3523 36.8 29.0 40.2 18.0 41.0 150 35.351 41.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 5.0 25 9.0 26 25.0 27 23.0 28 28.0 29 65.0 30 62.0 31 96.0 32 121.0 33 109.0 34 145.0 35 150.0 36 219.0 37 262.0 38 401.0 39 825.0 40 1453.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.65 13.3 17.925 38.125 2 26.424999999999997 19.225 33.625 20.724999999999998 3 21.15 24.625 25.0 29.225 4 23.7 31.0 21.575 23.724999999999998 5 22.625 33.650000000000006 24.8 18.925 6 17.5 34.300000000000004 26.825 21.375 7 13.05 24.7 39.425 22.825 8 15.975 24.275 33.0 26.75 9 16.75 24.6 31.95 26.700000000000003 10-14 19.830000000000002 29.985 26.32 23.865 15-19 19.205 28.21 28.865000000000002 23.72 20-24 19.415 28.860000000000003 28.37 23.355 25-29 19.79 28.999999999999996 28.175 23.035 30-34 19.400000000000002 29.705 27.505000000000003 23.39 35-39 19.38 29.580000000000002 27.72 23.32 40-44 19.68 29.244999999999997 27.884999999999998 23.189999999999998 45-49 19.48 29.475 27.455000000000002 23.59 50-54 19.33 29.81 27.455000000000002 23.405 55-59 19.455 29.215000000000003 27.865000000000002 23.465 60-64 19.805 28.694999999999997 27.865000000000002 23.635 65-69 19.695 28.51 27.97 23.825 70-74 19.45 28.804999999999996 28.255000000000003 23.49 75-79 19.97 28.49 28.51 23.03 80-84 19.975 28.215 28.015 23.794999999999998 85-89 19.885 29.09 27.68 23.345 90-94 20.169999999999998 29.110000000000003 27.465 23.255 95-99 20.165 28.29 27.6 23.945 100-104 19.535 28.410000000000004 28.27 23.785 105-109 19.825 28.494999999999997 28.17 23.51 110-114 20.09 28.939999999999998 27.915 23.055 115-119 20.47 28.62 27.68 23.23 120-124 20.424999999999997 28.345 27.405 23.825 125-129 20.11 28.655 27.765 23.47 130-134 19.98 28.925 27.775 23.32 135-139 20.66 27.815 27.994999999999997 23.53 140-144 20.135 28.64 28.07 23.155 145-149 20.49 27.675 28.199999999999996 23.635 150 21.15 27.025 28.249999999999996 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 2.0 25 6.5 26 8.0 27 11.0 28 19.0 29 20.5 30 21.0 31 32.5 32 42.0 33 55.0 34 73.0 35 91.5 36 109.5 37 134.0 38 173.5 39 189.5 40 189.5 41 206.0 42 229.0 43 239.0 44 255.0 45 259.5 46 249.5 47 233.5 48 216.0 49 192.0 50 160.0 51 135.0 52 100.0 53 78.5 54 61.5 55 49.5 56 48.0 57 30.0 58 19.0 59 16.5 60 12.0 61 8.0 62 3.0 63 2.5 64 2.0 65 2.5 66 1.5 67 1.5 68 1.5 69 0.5 70 0.5 71 1.5 72 1.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.625 #Duplication Level Percentage of deduplicated Percentage of total 1 92.5506072874494 85.725 2 6.963562753036437 12.9 3 0.4588394062078272 1.275 4 0.026990553306342778 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGCAG 10 0.006973645 144.0 9 >>END_MODULE SRR8585540 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8585540_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.82625 32.0 32.0 32.0 32.0 32.0 2 31.2825 32.0 32.0 32.0 32.0 32.0 3 32.595 37.0 32.0 37.0 27.0 37.0 4 32.5125 37.0 32.0 37.0 12.0 37.0 5 34.5275 37.0 37.0 37.0 32.0 37.0 6 34.81375 37.0 32.0 41.0 12.0 41.0 7 36.49075 41.0 37.0 41.0 27.0 41.0 8 38.388 41.0 37.0 41.0 32.0 41.0 9 39.0295 41.0 41.0 41.0 37.0 41.0 10-14 38.94735 41.0 40.2 41.0 34.0 41.0 15-19 37.988600000000005 41.0 38.6 41.0 31.0 41.0 20-24 39.12089999999999 41.0 41.0 41.0 36.0 41.0 25-29 38.8763 41.0 40.2 41.0 35.0 41.0 30-34 38.90665 41.0 40.2 41.0 35.0 41.0 35-39 38.0265 41.0 37.0 41.0 30.0 41.0 40-44 37.5455 41.0 36.0 41.0 27.0 41.0 45-49 36.4849 40.2 36.6 41.0 24.0 41.0 50-54 37.1899 41.0 37.0 41.0 27.0 41.0 55-59 37.12935 41.0 36.0 41.0 28.0 41.0 60-64 35.20915 40.2 33.0 41.0 22.0 41.0 65-69 36.8706 40.2 36.0 41.0 27.0 41.0 70-74 37.838049999999996 41.0 37.0 41.0 31.0 41.0 75-79 34.32115 38.4 31.0 41.0 22.0 41.0 80-84 37.1554 41.0 36.0 41.0 29.0 41.0 85-89 33.5861 37.8 29.0 41.0 15.0 41.0 90-94 36.96405 41.0 36.0 41.0 26.0 41.0 95-99 35.55165 39.2 33.0 41.0 25.0 41.0 100-104 34.162499999999994 37.8 31.0 41.0 21.0 41.0 105-109 36.90665 41.0 37.0 41.0 26.0 41.0 110-114 33.041549999999994 37.8 29.0 41.0 14.0 41.0 115-119 33.971349999999994 37.8 30.0 41.0 16.0 41.0 120-124 32.502700000000004 37.0 27.0 41.0 12.0 41.0 125-129 34.24640000000001 37.8 31.0 41.0 16.0 41.0 130-134 33.2945 37.0 28.0 41.0 18.0 41.0 135-139 30.455199999999998 33.0 24.0 37.6 14.0 41.0 140-144 28.104249999999997 30.0 20.0 37.0 12.0 41.0 145-149 26.029500000000002 26.0 16.0 34.0 12.0 39.4 150 28.00875 32.0 22.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 6.0 21 22.0 22 26.0 23 37.0 24 52.0 25 83.0 26 82.0 27 85.0 28 109.0 29 90.0 30 138.0 31 142.0 32 177.0 33 181.0 34 210.0 35 295.0 36 339.0 37 460.0 38 583.0 39 663.0 40 219.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.625000000000004 21.725 17.925 29.725 2 26.5 31.225 30.25 12.025 3 21.525 33.125 24.425 20.925 4 24.099999999999998 36.25 22.400000000000002 17.25 5 25.900000000000002 38.725 21.6 13.775 6 19.45 38.725 25.05 16.775000000000002 7 19.425 18.025 41.975 20.575 8 22.3 24.025 29.175 24.5 9 23.45 24.275 29.5 22.775000000000002 10-14 24.279999999999998 28.299999999999997 25.895000000000003 21.525 15-19 23.56 27.800000000000004 28.125 20.515 20-24 22.98 28.355000000000004 27.505000000000003 21.16 25-29 23.31 28.475 27.66 20.555 30-34 22.895 29.175 27.705000000000002 20.225 35-39 23.68 28.15 27.785 20.385 40-44 23.89 28.084999999999997 27.375 20.65 45-49 24.19 28.54 27.589999999999996 19.68 50-54 23.785 27.560000000000002 27.794999999999998 20.86 55-59 23.925 27.57 27.52 20.985 60-64 23.705000000000002 27.189999999999998 28.78 20.325 65-69 23.615 27.400000000000002 27.57 21.415 70-74 23.395 27.925 27.87 20.810000000000002 75-79 24.15 28.305000000000003 27.894999999999996 19.650000000000002 80-84 24.525 28.144999999999996 27.389999999999997 19.939999999999998 85-89 23.95 28.884999999999998 27.785 19.38 90-94 23.485 28.225 27.68 20.61 95-99 24.32 27.860000000000003 27.935 19.885 100-104 24.175 28.08 27.74 20.005 105-109 23.615 27.834999999999997 28.294999999999998 20.255000000000003 110-114 24.005000000000003 27.71 28.804999999999996 19.48 115-119 24.0 27.905 28.57 19.525000000000002 120-124 23.31 28.360000000000003 28.59 19.74 125-129 23.630000000000003 27.925 28.43 20.015 130-134 23.655 27.54 28.910000000000004 19.895 135-139 24.169999999999998 28.305000000000003 28.444999999999997 19.08 140-144 24.125 28.255000000000003 28.175 19.445 145-149 23.695 29.13 28.79 18.385 150 24.15 28.675 28.449999999999996 18.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 5.0 26 5.5 27 4.0 28 6.0 29 12.0 30 16.0 31 20.5 32 26.5 33 35.0 34 50.0 35 68.0 36 87.5 37 113.0 38 135.5 39 158.5 40 185.5 41 224.0 42 268.5 43 272.5 44 269.0 45 274.5 46 269.5 47 262.5 48 239.5 49 197.5 50 160.0 51 130.0 52 107.0 53 94.5 54 73.5 55 57.5 56 46.5 57 31.5 58 25.5 59 19.5 60 11.0 61 8.0 62 7.0 63 5.0 64 3.5 65 1.5 66 2.0 67 2.0 68 0.0 69 0.0 70 0.5 71 0.5 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.50267379679144 87.425 2 6.149732620320856 11.5 3 0.32085561497326204 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.026737967914438502 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAATCTAAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAATCT 10 0.006973645 144.0 1 >>END_MODULE Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644535 spots for SRR8585540.sra Written 1644535 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra Read 1644533 spots for SRR8585540.sra Written 1644533 spots for SRR8585540.sra SRR ids: ['SRR8585540.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l80oz0o_ SRR8585540.sra spots: 32890662 blocks: [[1, 1644533], [1644534, 3289066], [3289067, 4933599], [4933600, 6578132], [6578133, 8222665], [8222666, 9867198], [9867199, 11511731], [11511732, 13156264], [13156265, 14800797], [14800798, 16445330], [16445331, 18089863], [18089864, 19734396], [19734397, 21378929], [21378930, 23023462], [23023463, 24667995], [24667996, 26312528], [26312529, 27957061], [27957062, 29601594], [29601595, 31246127], [31246128, 32890662]] SRR8585540 file size 11059626 SRR8585540 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8585540 SRR8585540_1.fastq SRR8585540_2.fastq Input file: SRR8585540_1.fastq Paired file: SRR8585540_2.fastq trimmed: SRR8585540-trimmed-pair1.fastq, SRR8585540-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:00:48 2025 >> started Thu Feb 13 19:01:24 2025 >> done (36.264s) 32890662 read pairs processed; of these: 2 ( 0.00%) short read pairs filtered out after trimming by size control 1 ( 0.00%) empty read pairs filtered out after trimming by size control 32890659 (100.00%) read pairs available; of these: 675183 ( 2.05%) trimmed read pairs available after processing 32215476 (97.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 2 0.00% 23 5 0.00% 24 5 0.00% 25 7 0.00% 26 1 0.00% 27 6 0.00% 28 12 0.00% 29 6 0.00% 30 8 0.00% 31 15 0.00% 32 11 0.00% 33 10 0.00% 34 8 0.00% 35 10 0.00% 36 8 0.00% 37 16 0.00% 38 11 0.00% 39 23 0.00% 40 21 0.00% 41 14 0.00% 42 11 0.00% 43 20 0.00% 44 18 0.00% 45 17 0.00% 46 19 0.00% 47 18 0.00% 48 23 0.00% 49 17 0.00% 50 29 0.00% 51 26 0.00% 52 31 0.00% 53 19 0.00% 54 34 0.00% 55 22 0.00% 56 31 0.00% 57 29 0.00% 58 32 0.00% 59 29 0.00% 60 31 0.00% 61 24 0.00% 62 31 0.00% 63 27 0.00% 64 21 0.00% 65 20 0.00% 66 32 0.00% 67 34 0.00% 68 38 0.00% 69 32 0.00% 70 29 0.00% 71 47 0.00% 72 30 0.00% 73 33 0.00% 74 30 0.00% 75 43 0.00% 76 30 0.00% 77 32 0.00% 78 35 0.00% 79 34 0.00% 80 37 0.00% 81 36 0.00% 82 42 0.00% 83 31 0.00% 84 39 0.00% 85 41 0.00% 86 39 0.00% 87 35 0.00% 88 37 0.00% 89 29 0.00% 90 47 0.00% 91 29 0.00% 92 48 0.00% 93 28 0.00% 94 33 0.00% 95 30 0.00% 96 33 0.00% 97 21 0.00% 98 30 0.00% 99 33 0.00% 100 29 0.00% 101 25 0.00% 102 24 0.00% 103 37 0.00% 104 20 0.00% 105 20 0.00% 106 23 0.00% 107 24 0.00% 108 22 0.00% 109 24 0.00% 110 24 0.00% 111 38 0.00% 112 32 0.00% 113 36 0.00% 114 27 0.00% 115 19 0.00% 116 23 0.00% 117 25 0.00% 118 19 0.00% 119 19 0.00% 120 22 0.00% 121 30 0.00% 122 34 0.00% 123 24 0.00% 124 27 0.00% 125 26 0.00% 126 23 0.00% 127 25 0.00% 128 14 0.00% 129 10 0.00% 130 13 0.00% 131 28 0.00% 132 31 0.00% 133 22 0.00% 134 26 0.00% 135 17 0.00% 136 20 0.00% 137 12 0.00% 138 11 0.00% 139 9 0.00% 140 115 0.00% 141 10353 0.03% 142 11150 0.03% 143 11620 0.04% 144 12240 0.04% 145 12810 0.04% 146 14019 0.04% 147 17584 0.05% 148 43477 0.13% 149 538917 1.64% 150 32215476 97.95% 32890659 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=3.22 fanout-score-rank=23 prefix-density=0.33 prefix-fanout=2.5 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=47.81 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.7 sequence=TCTTTTTTCAAGGGACCAAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTAACTGGGTCAGAAAGGTGGTCAGCAAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=28 prefix-density=0.46 prefix-fanout=1.8 sequence=CAGGACAAGGAGGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=62.18 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=20.6 sequence=AAGAAAAGAAAA SRR8585540 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:02:51 Started mapping on | Feb 13 19:02:51 Finished on | Feb 13 19:07:47 Mapping speed, Million of reads per hour | 400.02 Number of input reads | 32890659 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 30423314 Uniquely mapped reads % | 92.50% Average mapped length | 288.53 Number of splices: Total | 28823177 Number of splices: Annotated (sjdb) | 27939192 Number of splices: GT/AG | 28221210 Number of splices: GC/AG | 414385 Number of splices: AT/AC | 24741 Number of splices: Non-canonical | 162841 Mismatch rate per base, % | 1.24% Deletion rate per base | 0.10% Deletion average length | 3.09 Insertion rate per base | 0.07% Insertion average length | 2.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1361437 % of reads mapped to multiple loci | 4.14% Number of reads mapped to too many loci | 40103 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1105908 1105908 1105908 N_multimapping 1361437 1361437 1361437 N_noFeature 1037379 29957074 1228162 N_ambiguous 536522 3284 259351 UnstrandedReadsAssigned:28849413 PositiveStrandReadsAssigned:462956 NegativeStrandReadsAssigned:28935801 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8585540 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8585540-trimmed-pair1.fastq SRR8585540-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,890,659 reads, 27,480,623 reads pseudoaligned [quant] estimated average fragment length: 253.505 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,117 rounds 52401 SRR8585540.ke.tsv 34699 SRR8585540.se.tsv 87100 total ==> SRR8585540.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.49 1771 26.0138 Potri.005G024800.1.v4.1 1035 782.495 1355 44.9065 Potri.004G059700.1.v4.1 961 708.499 38 1.3909 Potri.007G009000.2.v4.1 1416 1163.49 0 0 Potri.003G141000.2.v4.1 2943 2690.49 1084.24 10.4507 Potri.016G087400.1.v4.1 270 47.375 2378.22 1301.83 Potri.015G069301.1.v4.1 564 311.657 0 0 Potri.010G195200.1.v4.1 1773 1520.49 1108.97 18.9142 Potri.012G127500.1.v4.1 977 724.495 1897 67.9021 ==> SRR8585540.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 267 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 128 SRR8585540 completed mapping pipeline successfully