Starting /dee2/code/volunteer_pipeline.sh SRR8585541 current disk space = 3087309709312 free memory = 1542953448 SRR8585541 SRAfilesize 718017ad999fd12ba8eb289e26e6b026 SRR8585541.sra SRR8585541.sra file validated SRR8585541 is paired end SRR8585541 is conventional basespace SRR8585541 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8585541_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0325 32.0 32.0 32.0 32.0 32.0 2 31.375 32.0 32.0 32.0 32.0 32.0 3 35.52625 37.0 37.0 37.0 32.0 37.0 4 35.8175 37.0 37.0 37.0 32.0 37.0 5 36.16 37.0 37.0 37.0 37.0 37.0 6 39.63275 41.0 41.0 41.0 37.0 41.0 7 39.65375 41.0 41.0 41.0 37.0 41.0 8 39.962 41.0 41.0 41.0 37.0 41.0 9 39.80425 41.0 41.0 41.0 37.0 41.0 10-14 39.853300000000004 41.0 41.0 41.0 37.0 41.0 15-19 39.699250000000006 41.0 41.0 41.0 37.0 41.0 20-24 39.38605 41.0 41.0 41.0 37.0 41.0 25-29 39.495799999999996 41.0 41.0 41.0 37.0 41.0 30-34 39.37949999999999 41.0 41.0 41.0 36.0 41.0 35-39 39.697649999999996 41.0 41.0 41.0 37.0 41.0 40-44 39.5359 41.0 41.0 41.0 37.0 41.0 45-49 39.0223 41.0 41.0 41.0 34.0 41.0 50-54 38.624649999999995 41.0 40.2 41.0 33.0 41.0 55-59 38.878699999999995 41.0 41.0 41.0 33.0 41.0 60-64 39.018299999999996 41.0 41.0 41.0 35.0 41.0 65-69 39.25045 41.0 41.0 41.0 36.0 41.0 70-74 38.9565 41.0 41.0 41.0 33.0 41.0 75-79 37.7577 41.0 37.0 41.0 30.0 41.0 80-84 38.69785 41.0 41.0 41.0 32.0 41.0 85-89 38.2228 41.0 39.4 41.0 32.0 41.0 90-94 38.286199999999994 41.0 39.4 41.0 31.0 41.0 95-99 38.771049999999995 41.0 41.0 41.0 32.0 41.0 100-104 38.71565 41.0 41.0 41.0 34.0 41.0 105-109 37.23610000000001 41.0 36.0 41.0 27.0 41.0 110-114 37.3189 41.0 37.0 41.0 28.0 41.0 115-119 36.55785000000001 40.2 36.0 41.0 25.0 41.0 120-124 35.7636 40.2 36.0 41.0 22.0 41.0 125-129 37.06225 41.0 37.0 41.0 28.0 41.0 130-134 35.93155 40.2 35.0 41.0 22.0 41.0 135-139 34.855599999999995 40.2 31.0 41.0 21.0 41.0 140-144 32.98365 37.4 28.0 40.2 18.0 41.0 145-149 32.975750000000005 36.8 29.0 40.2 18.0 41.0 150 35.082 37.0 32.0 41.0 22.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 12.0 26 24.0 27 36.0 28 37.0 29 53.0 30 77.0 31 92.0 32 108.0 33 127.0 34 146.0 35 160.0 36 232.0 37 286.0 38 446.0 39 839.0 40 1321.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.275000000000002 13.950000000000001 17.95 38.824999999999996 2 26.724999999999998 19.725 33.825 19.725 3 21.875 24.775 23.925 29.425 4 24.075 31.574999999999996 19.925 24.425 5 22.5 34.1 24.375 19.025 6 17.325 36.35 26.6 19.725 7 12.55 24.9 40.550000000000004 22.0 8 15.299999999999999 25.374999999999996 31.924999999999997 27.400000000000002 9 17.4 24.55 31.175000000000004 26.875 10-14 19.675 30.43 25.945 23.95 15-19 19.285 28.694999999999997 28.355000000000004 23.665 20-24 19.265 29.080000000000002 27.900000000000002 23.755000000000003 25-29 18.935 29.465000000000003 28.025 23.575 30-34 18.925 29.049999999999997 28.249999999999996 23.775 35-39 19.085 29.535 27.889999999999997 23.49 40-44 19.73 29.695 27.175 23.400000000000002 45-49 19.485 29.020000000000003 27.66 23.835 50-54 19.175 28.455000000000002 28.115000000000002 24.255 55-59 19.125 29.270000000000003 28.060000000000002 23.544999999999998 60-64 19.115 29.17 27.744999999999997 23.97 65-69 19.439999999999998 29.2 27.845 23.515 70-74 19.56 29.360000000000003 27.279999999999998 23.799999999999997 75-79 19.35 28.555000000000003 27.779999999999998 24.315 80-84 19.36 28.794999999999998 27.79 24.055 85-89 20.27 28.77 27.529999999999998 23.43 90-94 19.775000000000002 28.98 27.42 23.825 95-99 19.25 28.235 28.23 24.285 100-104 19.555 29.044999999999998 26.995 24.404999999999998 105-109 19.685 28.52 28.04 23.755000000000003 110-114 19.965 28.815 27.485 23.735 115-119 20.424999999999997 28.810000000000002 27.750000000000004 23.015 120-124 20.044999999999998 28.139999999999997 27.6 24.215 125-129 20.255000000000003 28.02 28.225 23.5 130-134 19.869999999999997 28.68 27.865000000000002 23.585 135-139 19.950000000000003 28.455000000000002 27.97 23.625 140-144 20.119999999999997 28.415000000000003 28.26 23.205000000000002 145-149 20.565 28.310000000000002 28.1 23.025000000000002 150 19.925 28.249999999999996 28.199999999999996 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 1.0 23 0.5 24 2.0 25 6.0 26 10.0 27 8.5 28 9.0 29 13.5 30 24.5 31 31.0 32 38.0 33 51.0 34 68.5 35 90.0 36 106.5 37 142.0 38 166.5 39 180.5 40 201.5 41 240.5 42 272.5 43 262.0 44 257.0 45 246.5 46 229.0 47 227.5 48 203.5 49 173.0 50 146.5 51 120.5 52 104.5 53 82.0 54 68.0 55 51.5 56 35.5 57 37.5 58 27.5 59 13.0 60 10.0 61 6.5 62 5.5 63 3.5 64 1.0 65 2.0 66 3.0 67 5.0 68 4.0 69 1.0 70 1.0 71 1.0 72 1.5 73 1.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.425 #Duplication Level Percentage of deduplicated Percentage of total 1 92.48038950500406 85.475 2 6.951582364078983 12.85 3 0.4868812550716798 1.35 4 0.054097917230186636 0.2 5 0.027048958615093318 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGATCCCTACGCCACACACATGACGGTTTATGTGCTTAATGACCGCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTATCA 10 0.006973645 144.0 6 AGTGAGC 10 0.006973645 144.0 5 >>END_MODULE SRR8585541 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8585541_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.64375 32.0 32.0 32.0 27.0 32.0 2 31.1575 32.0 32.0 32.0 32.0 32.0 3 32.39375 37.0 32.0 37.0 12.0 37.0 4 32.0725 37.0 32.0 37.0 12.0 37.0 5 34.255 37.0 37.0 37.0 27.0 37.0 6 34.544 41.0 32.0 41.0 12.0 41.0 7 36.3845 41.0 37.0 41.0 22.0 41.0 8 38.1815 41.0 37.0 41.0 32.0 41.0 9 38.6775 41.0 41.0 41.0 32.0 41.0 10-14 38.66725 41.0 40.2 41.0 34.0 41.0 15-19 37.73125 41.0 37.8 41.0 29.0 41.0 20-24 38.9236 41.0 41.0 41.0 34.0 41.0 25-29 38.6625 41.0 40.2 41.0 34.0 41.0 30-34 38.667199999999994 41.0 40.2 41.0 35.0 41.0 35-39 37.66575 41.0 37.0 41.0 28.0 41.0 40-44 37.333 41.0 36.0 41.0 26.0 41.0 45-49 36.251 40.2 34.8 41.0 22.0 41.0 50-54 36.8913 41.0 37.0 41.0 26.0 41.0 55-59 36.92885 41.0 36.0 41.0 25.0 41.0 60-64 34.978 40.2 33.0 41.0 21.0 41.0 65-69 36.43075 40.2 36.0 41.0 25.0 41.0 70-74 37.55045 41.0 37.0 41.0 27.0 41.0 75-79 34.0769 37.4 28.0 41.0 21.0 41.0 80-84 36.85895 40.2 36.0 41.0 27.0 41.0 85-89 33.1846 37.8 27.0 41.0 15.0 41.0 90-94 36.658049999999996 41.0 34.0 41.0 26.0 41.0 95-99 35.2976 39.2 33.0 41.0 22.0 41.0 100-104 33.75025 37.8 30.0 41.0 21.0 41.0 105-109 36.66205 41.0 37.0 41.0 26.0 41.0 110-114 32.609350000000006 37.8 26.0 41.0 14.0 41.0 115-119 33.4985 37.0 29.0 41.0 16.0 41.0 120-124 32.10295 37.0 26.0 41.0 12.0 41.0 125-129 33.85475 37.0 30.0 41.0 16.0 41.0 130-134 32.8378 37.0 27.0 41.0 18.0 41.0 135-139 30.007599999999996 32.0 24.0 37.6 14.0 41.0 140-144 27.813049999999997 30.0 20.0 37.0 12.0 41.0 145-149 25.514100000000003 27.0 16.0 34.0 12.0 39.4 150 27.4615 27.0 22.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 13.0 21 33.0 22 39.0 23 66.0 24 67.0 25 67.0 26 91.0 27 91.0 28 85.0 29 111.0 30 143.0 31 139.0 32 163.0 33 194.0 34 220.0 35 288.0 36 339.0 37 475.0 38 602.0 39 610.0 40 164.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.7 19.575 16.875 32.85 2 25.424999999999997 31.775 30.599999999999998 12.2 3 23.0 31.374999999999996 24.4 21.224999999999998 4 23.474999999999998 37.95 21.575 17.0 5 23.825 38.3 22.975 14.899999999999999 6 19.900000000000002 37.925 25.55 16.625 7 19.1 17.9 41.6 21.4 8 22.05 23.425 28.375 26.150000000000002 9 22.2 24.099999999999998 30.675 23.025000000000002 10-14 24.44 27.639999999999997 25.545 22.375 15-19 23.855 27.68 27.735 20.73 20-24 23.085 28.720000000000002 27.66 20.535 25-29 22.945 28.825 27.700000000000003 20.53 30-34 22.825 28.615000000000002 27.605 20.955 35-39 22.8 29.509999999999998 27.71 19.98 40-44 23.635 28.24 27.834999999999997 20.29 45-49 24.03 28.165000000000003 27.644999999999996 20.16 50-54 24.55 27.860000000000003 27.325 20.265 55-59 23.775 27.99 27.77 20.465 60-64 24.54 28.53 27.500000000000004 19.43 65-69 23.505000000000003 27.87 27.82 20.805 70-74 24.295 27.855 27.49 20.36 75-79 24.555 28.535 27.639999999999997 19.27 80-84 23.855 28.595 27.189999999999998 20.36 85-89 24.235 28.549999999999997 27.735 19.48 90-94 24.11 28.000000000000004 27.375 20.515 95-99 24.255 28.22 28.08 19.445 100-104 23.755000000000003 28.605000000000004 27.87 19.77 105-109 23.375 28.285 27.915 20.424999999999997 110-114 23.735 28.610000000000003 28.275 19.38 115-119 24.615000000000002 27.875 27.315 20.195 120-124 23.665 27.765 28.685 19.885 125-129 24.175 27.325 28.425 20.075000000000003 130-134 24.044999999999998 27.83 28.07 20.055 135-139 23.715 28.1 28.59 19.595000000000002 140-144 23.880000000000003 28.349999999999998 28.555000000000003 19.215 145-149 23.665 28.76 29.38 18.195 150 23.75 28.849999999999998 27.725 19.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.0 24 1.5 25 5.5 26 7.5 27 6.0 28 6.0 29 10.5 30 15.0 31 18.0 32 25.5 33 35.5 34 48.5 35 66.0 36 89.0 37 103.0 38 126.5 39 177.5 40 217.0 41 225.0 42 255.0 43 284.5 44 275.5 45 284.0 46 275.5 47 237.5 48 212.0 49 178.0 50 151.0 51 140.5 52 119.0 53 92.0 54 80.0 55 64.0 56 44.0 57 30.0 58 18.0 59 16.0 60 14.0 61 10.0 62 7.0 63 5.0 64 3.0 65 1.5 66 1.0 67 2.5 68 2.5 69 1.0 70 1.5 71 1.5 72 1.5 73 2.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.8 #Duplication Level Percentage of deduplicated Percentage of total 1 93.97654584221749 88.14999999999999 2 5.570362473347548 10.45 3 0.39978678038379534 1.125 4 0.026652452025586353 0.1 5 0.0 0.0 6 0.0 0.0 7 0.026652452025586353 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.0 0.0 0.0 0.0 0.0 124-125 0.0 0.0 0.0 0.0 0.0 126-127 0.0 0.0 0.0 0.0 0.0 128-129 0.0 0.0 0.0 0.0 0.0 130-131 0.0 0.0 0.0 0.0 0.0 132-133 0.0 0.0 0.0 0.0 0.0 134-135 0.0 0.0 0.0 0.0 0.0 136-137 0.0 0.0 0.0 0.0 0.0 138 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAATGG 10 0.006973645 144.0 3 >>END_MODULE Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933878 spots for SRR8585541.sra Written 1933878 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra Read 1933877 spots for SRR8585541.sra Written 1933877 spots for SRR8585541.sra SRR ids: ['SRR8585541.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a3imtues SRR8585541.sra spots: 38677541 blocks: [[1, 1933877], [1933878, 3867754], [3867755, 5801631], [5801632, 7735508], [7735509, 9669385], [9669386, 11603262], [11603263, 13537139], [13537140, 15471016], [15471017, 17404893], [17404894, 19338770], [19338771, 21272647], [21272648, 23206524], [23206525, 25140401], [25140402, 27074278], [27074279, 29008155], [29008156, 30942032], [30942033, 32875909], [32875910, 34809786], [34809787, 36743663], [36743664, 38677541]] SRR8585541 file size 13009307 SRR8585541 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8585541 SRR8585541_1.fastq SRR8585541_2.fastq Input file: SRR8585541_1.fastq Paired file: SRR8585541_2.fastq trimmed: SRR8585541-trimmed-pair1.fastq, SRR8585541-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:26:55 2025 >> started Thu Feb 13 19:27:38 2025 >> done (43.402s) 38677541 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 2 ( 0.00%) empty read pairs filtered out after trimming by size control 38677529 (100.00%) read pairs available; of these: 754091 ( 1.95%) trimmed read pairs available after processing 37923438 (98.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 4 0.00% 23 11 0.00% 24 5 0.00% 25 12 0.00% 26 9 0.00% 27 7 0.00% 28 9 0.00% 29 6 0.00% 30 13 0.00% 31 12 0.00% 32 14 0.00% 33 17 0.00% 34 19 0.00% 35 18 0.00% 36 14 0.00% 37 10 0.00% 38 17 0.00% 39 19 0.00% 40 19 0.00% 41 22 0.00% 42 11 0.00% 43 25 0.00% 44 26 0.00% 45 25 0.00% 46 29 0.00% 47 24 0.00% 48 13 0.00% 49 23 0.00% 50 33 0.00% 51 19 0.00% 52 39 0.00% 53 34 0.00% 54 38 0.00% 55 38 0.00% 56 32 0.00% 57 25 0.00% 58 36 0.00% 59 31 0.00% 60 44 0.00% 61 29 0.00% 62 41 0.00% 63 55 0.00% 64 41 0.00% 65 47 0.00% 66 55 0.00% 67 36 0.00% 68 40 0.00% 69 34 0.00% 70 43 0.00% 71 59 0.00% 72 47 0.00% 73 46 0.00% 74 36 0.00% 75 49 0.00% 76 54 0.00% 77 48 0.00% 78 48 0.00% 79 37 0.00% 80 38 0.00% 81 44 0.00% 82 56 0.00% 83 51 0.00% 84 44 0.00% 85 47 0.00% 86 51 0.00% 87 32 0.00% 88 26 0.00% 89 55 0.00% 90 42 0.00% 91 35 0.00% 92 42 0.00% 93 43 0.00% 94 47 0.00% 95 36 0.00% 96 39 0.00% 97 38 0.00% 98 35 0.00% 99 30 0.00% 100 32 0.00% 101 45 0.00% 102 34 0.00% 103 23 0.00% 104 44 0.00% 105 38 0.00% 106 44 0.00% 107 30 0.00% 108 29 0.00% 109 28 0.00% 110 28 0.00% 111 40 0.00% 112 30 0.00% 113 36 0.00% 114 23 0.00% 115 29 0.00% 116 27 0.00% 117 29 0.00% 118 20 0.00% 119 28 0.00% 120 25 0.00% 121 25 0.00% 122 33 0.00% 123 29 0.00% 124 30 0.00% 125 33 0.00% 126 42 0.00% 127 22 0.00% 128 19 0.00% 129 13 0.00% 130 15 0.00% 131 38 0.00% 132 29 0.00% 133 34 0.00% 134 29 0.00% 135 23 0.00% 136 23 0.00% 137 13 0.00% 138 15 0.00% 139 9 0.00% 140 100 0.00% 141 8258 0.02% 142 8809 0.02% 143 9005 0.02% 144 9764 0.03% 145 10235 0.03% 146 11569 0.03% 147 15500 0.04% 148 45333 0.12% 149 631896 1.63% 150 37923438 98.05% 38677529 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=40 prefix-density=0.23 prefix-fanout=2.1 sequence=TCATTTATAATCTTCGAATCGATGATTTCACCGTACTGGCTAAACGCTTCTTGAAGGGATTGGTCAGTAGTGGCCCATGCTAGGCCACCAACAAAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=58.12 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=8.7 sequence=CAAAAACCCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCGTCAAATCTTGGGACTTTAGACACCTTTTGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAACGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGCTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACCTGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTACTCAATTTCCTTGGCCAATTGTTCAGTAGTGAGATCTGGGAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCTGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAA criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=6.06 fanout-score-rank=24 prefix-density=1.45 prefix-fanout=1.0 sequence=CTACACTGCTGACATCGTTGAGACTGAGAA criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=142.48 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=19.1 sequence=CAACAACAAAGAGCTGTCGGAAGCAAGAAATTAGAAGATGCACAAT SRR8585541 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:29:13 Started mapping on | Feb 13 19:29:13 Finished on | Feb 13 19:35:45 Mapping speed, Million of reads per hour | 355.20 Number of input reads | 38677529 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 35808097 Uniquely mapped reads % | 92.58% Average mapped length | 288.64 Number of splices: Total | 34796033 Number of splices: Annotated (sjdb) | 33735294 Number of splices: GT/AG | 34089857 Number of splices: GC/AG | 482616 Number of splices: AT/AC | 28046 Number of splices: Non-canonical | 195514 Mismatch rate per base, % | 1.24% Deletion rate per base | 0.10% Deletion average length | 3.10 Insertion rate per base | 0.07% Insertion average length | 2.85 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1600781 % of reads mapped to multiple loci | 4.14% Number of reads mapped to too many loci | 115133 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.81% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1268651 1268651 1268651 N_multimapping 1600781 1600781 1600781 N_noFeature 1237512 35138455 1450486 N_ambiguous 741264 3544 283106 UnstrandedReadsAssigned:33829321 PositiveStrandReadsAssigned:666098 NegativeStrandReadsAssigned:34074505 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8585541 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8585541-trimmed-pair1.fastq SRR8585541-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,677,529 reads, 32,389,368 reads pseudoaligned [quant] estimated average fragment length: 260.27 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,213 rounds 52401 SRR8585541.ke.tsv 34699 SRR8585541.se.tsv 87100 total ==> SRR8585541.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.73 1487 14.2961 Potri.005G024800.1.v4.1 1035 775.73 701 15.2797 Potri.004G059700.1.v4.1 961 701.73 27 0.650579 Potri.007G009000.2.v4.1 1416 1156.73 0 0 Potri.003G141000.2.v4.1 2943 2683.73 1755.33 11.0593 Potri.016G087400.1.v4.1 270 44.1831 3376.19 1292.04 Potri.015G069301.1.v4.1 564 304.906 0 0 Potri.010G195200.1.v4.1 1773 1513.73 1252 13.9849 Potri.012G127500.1.v4.1 977 717.73 173 4.0756 ==> SRR8585541.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 381 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 47 SRR8585541 completed mapping pipeline successfully