Starting /dee2/code/volunteer_pipeline.sh SRR8585542 current disk space = 3087317336064 free memory = 1536514244 SRR8585542 SRAfilesize b512a20a6f3ca749aae62b48f3012400 SRR8585542.sra SRR8585542.sra file validated SRR8585542 is paired end SRR8585542 is conventional basespace SRR8585542 read1 length is 107-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8585542_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 107-150 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.465 32.0 27.0 32.0 12.0 32.0 2 28.775 32.0 27.0 32.0 12.0 32.0 3 29.15 32.0 27.0 32.0 12.0 37.0 4 30.60875 32.0 27.0 37.0 12.0 37.0 5 30.5225 32.0 27.0 37.0 12.0 37.0 6 31.51575 32.0 27.0 41.0 12.0 41.0 7 31.3635 32.0 27.0 41.0 12.0 41.0 8 31.98775 32.0 27.0 41.0 12.0 41.0 9 32.009 37.0 27.0 41.0 12.0 41.0 10-14 31.471449999999997 33.0 27.0 41.0 12.0 41.0 15-19 30.642999999999994 32.0 23.0 40.2 12.0 41.0 20-24 29.7695 32.0 22.0 37.0 12.0 41.0 25-29 26.15285 27.0 14.0 37.0 12.0 41.0 30-34 24.1375 23.0 12.0 34.0 12.0 39.4 35-39 23.423299999999998 22.0 12.0 32.0 12.0 37.0 40-44 22.6934 22.0 12.0 32.0 12.0 37.0 45-49 22.166 22.0 12.0 27.0 12.0 37.0 50-54 21.662149999999997 22.0 12.0 27.0 12.0 37.0 55-59 21.483300000000003 22.0 12.0 27.0 12.0 37.0 60-64 21.184350000000002 22.0 12.0 27.0 12.0 37.0 65-69 20.871950000000002 22.0 12.0 27.0 12.0 37.0 70-74 20.4429 16.0 12.0 27.0 12.0 37.0 75-79 19.898649999999996 14.0 12.0 27.0 12.0 34.0 80-84 19.697 12.0 12.0 27.0 12.0 35.0 85-89 19.200449999999996 12.0 12.0 22.0 12.0 33.0 90-94 19.03275 12.0 12.0 22.0 12.0 32.0 95-99 18.5989 12.0 12.0 22.0 12.0 32.0 100-104 18.41775 12.0 12.0 22.0 12.0 32.0 105-109 18.264098582699702 12.0 12.0 22.0 12.0 32.0 110-114 18.020773697074493 12.0 12.0 22.0 12.0 32.0 115-119 17.76487975951904 12.0 12.0 22.0 12.0 32.0 120-124 17.594098194679315 12.0 12.0 22.0 12.0 32.0 125-129 17.015687069311433 12.0 12.0 22.0 12.0 32.0 130-134 16.425307038539067 12.0 12.0 22.0 11.2 32.0 135-139 15.902719269771035 12.0 12.0 22.0 8.0 31.0 140-144 15.276131007334508 12.0 12.0 22.0 8.0 27.0 145-149 14.9181044163311 12.0 12.0 22.0 8.0 27.0 150 14.894643759474482 12.0 12.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores warn #Quality Count 12 10.0 13 39.0 14 43.0 15 49.0 16 76.0 17 113.0 18 194.0 19 377.0 20 561.0 21 807.0 22 796.0 23 595.0 24 275.0 25 59.0 26 6.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.14457228614307 15.407703851925964 13.83191595797899 31.615807903951975 2 33.800000000000004 12.425 26.575 27.200000000000003 3 21.44650929181316 16.675037669512808 31.215469613259668 30.662983425414364 4 23.65 28.249999999999996 23.225 24.875 5 22.8 24.525 31.924999999999997 20.75 6 26.1 30.5 24.275 19.125 7 13.850000000000001 26.174999999999997 34.300000000000004 25.674999999999997 8 15.325 25.3 30.55 28.825 9 23.95 21.95 31.75 22.35 10-14 17.945 26.950000000000003 31.385 23.72 15-19 19.3 26.009999999999998 32.550000000000004 22.14 20-24 19.73 32.42 27.215 20.635 25-29 19.675 30.769999999999996 27.994999999999997 21.560000000000002 30-34 20.44 28.345 29.375 21.84 35-39 21.275 28.03 28.465 22.23 40-44 20.965 27.939999999999998 29.14 21.955 45-49 20.76 28.804999999999996 28.055000000000003 22.38 50-54 21.59 27.779999999999998 28.12 22.509999999999998 55-59 21.385 28.595 27.82 22.2 60-64 21.075 28.83 27.944999999999997 22.15 65-69 21.025 27.889999999999997 27.700000000000003 23.385 70-74 20.78 28.16 27.505000000000003 23.555 75-79 20.905 27.96 27.0 24.135 80-84 21.349999999999998 27.465 27.500000000000004 23.685000000000002 85-89 21.385 27.49 26.645000000000003 24.48 90-94 21.295 27.295 26.029999999999998 25.380000000000003 95-99 21.125 26.71 26.875 25.290000000000003 100-104 21.285 26.57 26.02 26.125 105-109 21.048157223583537 26.61399209881482 25.54383157473621 26.79401910286543 110-114 21.447882246920997 26.06388304796235 25.187744067287476 27.300490637829178 115-119 21.52805611222445 25.260521042084168 24.97995991983968 28.2314629258517 120-124 21.266038492381718 25.370890136327183 24.157979149959903 29.205092221331196 125-129 21.424987456096336 25.28349222277973 23.712995484194682 29.578524836929255 130-134 20.419032306687434 25.081645983017637 23.493945636336232 31.0053760739587 135-139 21.086245914005534 24.862962031682173 23.85717877797335 30.193613276338947 140-144 20.57030580885687 24.348833694392667 23.230389440274067 31.850471056476398 145-149 20.894165193230613 24.551654458196516 22.788582975498866 31.765597373074005 150 19.858514401212734 23.597776654876203 22.637695805962608 33.90601313794846 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.5 7 1.0 8 3.0 9 3.0 10 2.5 11 5.5 12 7.5 13 8.5 14 8.5 15 7.5 16 9.0 17 11.0 18 13.5 19 11.5 20 8.5 21 11.5 22 14.0 23 17.5 24 24.0 25 23.5 26 20.5 27 31.0 28 32.0 29 27.0 30 38.5 31 50.5 32 54.0 33 57.0 34 60.5 35 76.5 36 99.0 37 101.5 38 101.0 39 128.5 40 148.5 41 166.5 42 189.5 43 182.0 44 182.5 45 188.5 46 181.0 47 163.5 48 160.5 49 156.5 50 142.0 51 127.5 52 114.0 53 108.0 54 89.5 55 85.5 56 77.0 57 61.5 58 54.5 59 47.0 60 44.5 61 33.5 62 27.0 63 24.5 64 18.0 65 21.0 66 19.5 67 13.0 68 15.5 69 15.5 70 16.5 71 13.5 72 7.0 73 4.5 74 4.0 75 4.5 76 3.5 77 4.0 78 3.5 79 2.5 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 1.0 86 1.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.44999999999999996 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 107 1.0 108 1.0 109 0.0 110 2.0 111 2.0 112 0.0 113 2.0 114 0.0 115 0.0 116 0.0 117 0.0 118 0.0 119 0.0 120 1.0 121 0.0 122 1.0 123 2.0 124 0.0 125 1.0 126 2.0 127 0.0 128 0.0 129 2.0 130 1.0 131 2.0 132 1.0 133 0.0 134 0.0 135 2.0 136 0.0 137 0.0 138 2.0 139 0.0 140 3.0 141 1.0 142 5.0 143 1.0 144 2.0 145 5.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3958.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0 0.0 0.0 0.0 0.0 120-121 0.0 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.05 0.0 0.0 0.0 0.0 128-129 0.05 0.0 0.0 0.0 0.0 130-131 0.07500000000000001 0.0 0.0 0.0 0.0 132-133 0.125 0.0 0.0 0.0 0.0 134-135 0.125 0.0 0.0 0.0 0.0 136-137 0.125 0.0 0.0 0.0 0.0 138 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTTTC 10 0.007094481 143.175 4 AGAGTAT 10 0.007094481 143.175 4 GTATGCC 50 0.0 130.48862 2 TATGCCG 50 0.0 130.48862 3 TGCCGTC 50 0.0 128.8575 5 CCGTCTT 50 0.0 128.8575 7 ATGCCGT 50 0.0 128.8575 4 GTCTTCT 50 0.0 128.8575 9 GCCGTCT 50 0.0 128.8575 6 CGTCTTC 50 0.0 128.8575 8 AGTATGC 25 5.697726E-6 115.989876 1 CGTATGC 35 3.03157E-5 82.84991 1 TGCTTGA 50 7.982271E-8 25.7715 15-19 CTGCTTG 50 7.982271E-8 25.7715 10-14 GCTTGAA 55 2.0074185E-7 23.428635 15-19 TCTTCTG 55 2.0074185E-7 23.428635 10-14 TGAAAAA 55 2.0074185E-7 23.428635 15-19 GAAAAAA 65 4.026515E-8 22.026924 20-24 TTCTGCT 60 4.6462992E-7 21.47625 10-14 CTTGAAA 60 4.6462992E-7 21.47625 15-19 >>END_MODULE SRR8585542 read2 length is 107-150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8585542_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 107-150 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.0625 27.0 12.0 32.0 12.0 32.0 2 21.56 27.0 12.0 32.0 12.0 32.0 3 20.99625 12.0 12.0 32.0 12.0 32.0 4 20.78625 12.0 12.0 32.0 12.0 32.0 5 20.5575 12.0 12.0 32.0 12.0 37.0 6 20.05025 12.0 12.0 32.0 12.0 37.0 7 20.538 12.0 12.0 27.0 12.0 37.0 8 20.30875 12.0 12.0 27.0 12.0 37.0 9 20.1045 12.0 12.0 27.0 12.0 37.0 10-14 20.12645 12.0 12.0 28.0 12.0 37.0 15-19 19.5343 12.0 12.0 27.0 12.0 37.0 20-24 19.2073 12.0 12.0 27.0 12.0 37.0 25-29 18.9429 12.0 12.0 27.0 12.0 36.0 30-34 18.7834 12.0 12.0 26.0 12.0 36.0 35-39 18.5425 12.0 12.0 25.0 12.0 33.0 40-44 18.28385 12.0 12.0 22.0 12.0 32.0 45-49 18.1252 12.0 12.0 22.0 12.0 32.0 50-54 18.0367 12.0 12.0 22.0 12.0 32.0 55-59 18.0674 12.0 12.0 23.0 12.0 32.0 60-64 17.774900000000002 12.0 12.0 22.0 12.0 32.0 65-69 17.41685 12.0 12.0 22.0 12.0 31.0 70-74 17.2798 12.0 12.0 22.0 12.0 30.0 75-79 17.1145 12.0 12.0 22.0 12.0 27.0 80-84 17.21445 12.0 12.0 22.0 12.0 27.0 85-89 17.12455 12.0 12.0 22.0 12.0 27.0 90-94 17.12135 12.0 12.0 22.0 12.0 28.0 95-99 16.9921 12.0 12.0 22.0 12.0 28.0 100-104 16.6782 12.0 12.0 22.0 12.0 25.0 105-109 16.359977948145115 12.0 12.0 22.0 12.0 27.0 110-114 15.622903083266602 12.0 12.0 22.0 11.2 25.0 115-119 14.836873747494991 12.0 12.0 18.0 8.0 23.0 120-124 14.197648442197297 12.0 9.6 12.0 8.0 22.0 125-129 14.115715148696301 12.0 8.0 12.0 8.0 23.0 130-134 13.882279682211252 12.0 8.0 12.0 8.0 22.0 135-139 13.780872921427468 12.0 8.0 12.0 8.0 22.0 140-144 13.852853549295258 12.0 8.0 12.0 8.0 22.0 145-149 13.812171071547743 12.0 8.0 12.0 8.0 22.0 150 13.843355229914097 12.0 8.0 12.0 8.0 22.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 12 20.0 13 119.0 14 368.0 15 664.0 16 859.0 17 770.0 18 572.0 19 330.0 20 165.0 21 74.0 22 36.0 23 9.0 24 13.0 25 0.0 26 1.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.567851777666498 21.156735102653982 15.973960941412118 34.3014521782674 2 28.349999999999998 26.05 27.925 17.675 3 31.324999999999996 24.625 22.95 21.099999999999998 4 24.306076519129782 29.732433108277068 26.18154538634659 19.779944986246562 5 28.525 32.324999999999996 20.150000000000002 19.0 6 23.849999999999998 29.799999999999997 27.875 18.475 7 19.3 24.925 37.0 18.775 8 33.25 21.625 24.5 20.625 9 24.25 22.475 27.250000000000004 26.025 10-14 25.21 25.515 25.564999999999998 23.71 15-19 26.740000000000002 24.925 25.145 23.189999999999998 20-24 25.080000000000002 27.065 24.285 23.57 25-29 25.44 26.009999999999998 24.75 23.799999999999997 30-34 23.055 26.424999999999997 24.715 25.805 35-39 24.77 25.130000000000003 24.625 25.474999999999998 40-44 26.095000000000002 24.13 23.549999999999997 26.224999999999998 45-49 24.279999999999998 24.325 24.610000000000003 26.784999999999997 50-54 22.88 24.715 25.775 26.63 55-59 21.985 28.110000000000003 23.78 26.125 60-64 22.535 26.3 24.165 27.0 65-69 22.564999999999998 25.130000000000003 24.18 28.125 70-74 22.535 25.165 23.78 28.52 75-79 22.68 24.65 24.365000000000002 28.305000000000003 80-84 22.439999999999998 24.349999999999998 24.41 28.799999999999997 85-89 22.825 24.44 23.435 29.299999999999997 90-94 22.5 24.615000000000002 22.935 29.95 95-99 21.891094554727736 24.576228811440572 23.1911595579779 30.34151707585379 100-104 22.264999999999997 23.9 23.45 30.385 105-109 21.68325248787318 23.75356303445517 23.028454268140223 31.534730209531432 110-114 21.738259737658957 23.335335936717733 22.769600480624813 32.1568038449985 115-119 21.85370741482966 23.74749498997996 22.5751503006012 31.82364729458918 120-124 21.64194065757819 23.185645549318366 21.566760224538896 33.605653568564556 125-129 21.460110386352234 23.381836427496236 21.394882087305568 33.76317109884596 130-134 21.971562076068935 22.92619203135206 20.86117670702909 34.24106918554992 135-139 21.68577750955542 22.54576543954939 20.981693824180244 34.786763226714946 140-144 21.730149133413946 22.642079806529626 20.757758968158 34.87001209189843 145-149 21.77317504420308 22.374336953776204 19.909067946451124 35.94342005556959 150 20.7933299646286 23.09247094492168 21.3744315310763 34.73976755937342 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 1.0 4 1.0 5 1.0 6 3.0 7 4.0 8 4.0 9 3.5 10 3.5 11 5.0 12 3.5 13 1.0 14 1.5 15 2.5 16 2.5 17 4.5 18 7.0 19 7.0 20 5.5 21 7.0 22 11.0 23 10.5 24 10.0 25 13.5 26 19.0 27 14.5 28 14.5 29 24.5 30 29.0 31 27.0 32 28.5 33 35.0 34 43.5 35 57.0 36 68.5 37 76.5 38 78.5 39 88.0 40 102.5 41 97.5 42 103.0 43 122.0 44 130.5 45 142.0 46 138.5 47 117.5 48 129.5 49 137.5 50 129.0 51 124.0 52 117.5 53 129.0 54 119.5 55 105.0 56 108.0 57 96.5 58 90.0 59 92.5 60 86.0 61 78.5 62 70.5 63 54.5 64 60.5 65 67.0 66 52.5 67 48.0 68 47.5 69 42.5 70 35.5 71 34.5 72 33.0 73 30.5 74 24.5 75 21.5 76 17.0 77 14.0 78 17.0 79 16.5 80 14.5 81 11.0 82 9.5 83 9.5 84 9.0 85 7.5 86 3.5 87 4.5 88 7.5 89 5.5 90 4.0 91 2.5 92 1.5 93 2.0 94 1.5 95 1.0 96 1.0 97 1.0 98 1.0 99 1.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.005028916268544129 140-144 0.005038037180714394 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 107 1.0 108 1.0 109 0.0 110 2.0 111 2.0 112 0.0 113 2.0 114 0.0 115 0.0 116 0.0 117 0.0 118 0.0 119 0.0 120 1.0 121 0.0 122 1.0 123 2.0 124 0.0 125 1.0 126 2.0 127 0.0 128 0.0 129 2.0 130 1.0 131 2.0 132 1.0 133 0.0 134 0.0 135 2.0 136 0.0 137 0.0 138 2.0 139 0.0 140 3.0 141 1.0 142 5.0 143 1.0 144 2.0 145 5.0 146 0.0 147 0.0 148 0.0 149 0.0 150 3958.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 100.0 #Duplication Level Percentage of deduplicated Percentage of total 1 100.0 100.0 2 0.0 0.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.025 0.0 0.0 0.0 0.0 118-119 0.025 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.05 0.0 0.0 0.0 0.0 124-125 0.05 0.0 0.0 0.0 0.0 126-127 0.05 0.0 0.0 0.0 0.0 128-129 0.07500000000000001 0.0 0.0 0.0 0.0 130-131 0.1 0.0 0.0 0.0 0.0 132-133 0.1125 0.0 0.0 0.0 0.0 134-135 0.125 0.0 0.0 0.0 0.0 136-137 0.125 0.0 0.0 0.0 0.0 138 0.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGGAC 10 0.007088928 143.21251 7 AAGGATG 10 0.007088928 143.21251 6 AGCGTGG 10 0.007088928 143.21251 7 AAGAGCG 25 9.153521E-4 85.927505 4 GGAAGAG 35 0.0034793257 61.376785 2 GAAGAGC 40 0.0059041944 53.70469 3 AAAAAAA 150 4.7111826E-10 14.32125 55-59 >>END_MODULE Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050595 spots for SRR8585542.sra Written 2050595 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra Read 2050577 spots for SRR8585542.sra Written 2050577 spots for SRR8585542.sra SRR ids: ['SRR8585542.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ypupkvss SRR8585542.sra spots: 41011558 blocks: [[1, 2050577], [2050578, 4101154], [4101155, 6151731], [6151732, 8202308], [8202309, 10252885], [10252886, 12303462], [12303463, 14354039], [14354040, 16404616], [16404617, 18455193], [18455194, 20505770], [20505771, 22556347], [22556348, 24606924], [24606925, 26657501], [26657502, 28708078], [28708079, 30758655], [30758656, 32809232], [32809233, 34859809], [34859810, 36910386], [36910387, 38960963], [38960964, 41011558]] SRR8585542 file size 13618387 SRR8585542 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8585542 SRR8585542_1.fastq SRR8585542_2.fastq Input file: SRR8585542_1.fastq Paired file: SRR8585542_2.fastq trimmed: SRR8585542-trimmed-pair1.fastq, SRR8585542-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:31:40 2025 >> started Thu Feb 13 19:32:43 2025 >> done (63.701s) 41011558 read pairs processed; of these: 11 ( 0.00%) short read pairs filtered out after trimming by size control 31 ( 0.00%) empty read pairs filtered out after trimming by size control 41011516 (100.00%) read pairs available; of these: 1542540 ( 3.76%) trimmed read pairs available after processing 39468976 (96.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 4 0.00% 21 6 0.00% 22 8 0.00% 23 10 0.00% 24 10 0.00% 25 8 0.00% 26 12 0.00% 27 9 0.00% 28 11 0.00% 29 17 0.00% 30 18 0.00% 31 18 0.00% 32 18 0.00% 33 18 0.00% 34 28 0.00% 35 22 0.00% 36 16 0.00% 37 15 0.00% 38 14 0.00% 39 19 0.00% 40 29 0.00% 41 27 0.00% 42 20 0.00% 43 27 0.00% 44 31 0.00% 45 19 0.00% 46 23 0.00% 47 25 0.00% 48 29 0.00% 49 29 0.00% 50 31 0.00% 51 28 0.00% 52 32 0.00% 53 37 0.00% 54 28 0.00% 55 33 0.00% 56 43 0.00% 57 28 0.00% 58 27 0.00% 59 41 0.00% 60 37 0.00% 61 31 0.00% 62 34 0.00% 63 42 0.00% 64 40 0.00% 65 51 0.00% 66 49 0.00% 67 38 0.00% 68 33 0.00% 69 33 0.00% 70 37 0.00% 71 42 0.00% 72 50 0.00% 73 44 0.00% 74 39 0.00% 75 35 0.00% 76 40 0.00% 77 45 0.00% 78 43 0.00% 79 39 0.00% 80 52 0.00% 81 43 0.00% 82 51 0.00% 83 43 0.00% 84 35 0.00% 85 44 0.00% 86 50 0.00% 87 44 0.00% 88 53 0.00% 89 43 0.00% 90 47 0.00% 91 55 0.00% 92 43 0.00% 93 72 0.00% 94 94 0.00% 95 81 0.00% 96 108 0.00% 97 128 0.00% 98 122 0.00% 99 26693 0.07% 100 28465 0.07% 101 29612 0.07% 102 31331 0.08% 103 33515 0.08% 104 36537 0.09% 105 39403 0.10% 106 42732 0.10% 107 46519 0.11% 108 49323 0.12% 109 52767 0.13% 110 54575 0.13% 111 56148 0.14% 112 57196 0.14% 113 59663 0.15% 114 63037 0.15% 115 66874 0.16% 116 69889 0.17% 117 74623 0.18% 118 79125 0.19% 119 83676 0.20% 120 86247 0.21% 121 87595 0.21% 122 88577 0.22% 123 90347 0.22% 124 91057 0.22% 125 95761 0.23% 126 99110 0.24% 127 103804 0.25% 128 108764 0.27% 129 113424 0.28% 130 116860 0.28% 131 119680 0.29% 132 119580 0.29% 133 120144 0.29% 134 122103 0.30% 135 123916 0.30% 136 124832 0.30% 137 3167 0.01% 138 131363 0.32% 139 136859 0.33% 140 141888 0.35% 141 147307 0.36% 142 150881 0.37% 143 153545 0.37% 144 161516 0.39% 145 225792 0.55% 146 153414 0.37% 147 163619 0.40% 148 215853 0.53% 149 945144 2.30% 150 35384784 86.28% 41011516 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.21 fanout-score-rank=20 prefix-density=0.23 prefix-fanout=3.1 sequence=TCCTTGTCCTGGATCTTGGCCTTCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=61.58 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=14.0 sequence=TTTTTTTTTTCAAAAGCTCGTACACACTAAGACAAAAGCCTTATCCATTTACAAAAGTCTTATCCATTTGTAGATGGAACTTCGACAGCAGCTAGGTCTAGAGGGAAATTATGAGCATTACGTTCATGCATAACTTCCATACCAAGGTTAGCACGGTTAATAATATCAGCCCAGGTATTAATTACACGACCTTGACTATCAACTACAGATTGGTTGAAATTGAAACCATTTAGATTGAAAGCCATAGTGCTAATACCTAAAGCAGTGAACCAGATACCTACTACAGGCCAAGCAGCTAAGAAGAAATGTAAAGAGCGAGAGTTGTTAAAACTAGCATATTGGAAGATCAATCGGCCAAAATAACCATGAGCGGCTACGATATTATAAGTTTCTTCCTCTTGACCAAATCTGTAACCTTCATTAGCAGATTCATTTTCTGTGGTTTCCCTGATCAAACTAGAGGTTACCAAAGAACCATGCATAGCACTGAATAGGGAGCCGCCGAATACAC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=35 prefix-density=0.07 prefix-fanout=2.4 sequence=CTGTGTTGGTGACTGGAGTTCAGACGTGTGCTCTTCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=371.85 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=31.8 sequence=AAGAAGAAGAAG SRR8585542 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:34:10 Started mapping on | Feb 13 19:34:11 Finished on | Feb 13 19:58:03 Mapping speed, Million of reads per hour | 103.10 Number of input reads | 41011516 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 27778717 Uniquely mapped reads % | 67.73% Average mapped length | 291.80 Number of splices: Total | 24942814 Number of splices: Annotated (sjdb) | 24237105 Number of splices: GT/AG | 24405953 Number of splices: GC/AG | 356105 Number of splices: AT/AC | 22636 Number of splices: Non-canonical | 158120 Mismatch rate per base, % | 1.22% Deletion rate per base | 0.09% Deletion average length | 3.00 Insertion rate per base | 0.06% Insertion average length | 2.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1500800 % of reads mapped to multiple loci | 3.66% Number of reads mapped to too many loci | 492316 % of reads mapped to too many loci | 1.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 26.75% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 11731999 11731999 11731999 N_multimapping 1500800 1500800 1500800 N_noFeature 925558 27360197 1093758 N_ambiguous 505233 2661 253118 UnstrandedReadsAssigned:26347926 PositiveStrandReadsAssigned:415859 NegativeStrandReadsAssigned:26431841 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR8585542 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8585542-trimmed-pair1.fastq SRR8585542-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,011,516 reads, 26,336,838 reads pseudoaligned [quant] estimated average fragment length: 228.586 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,307 rounds 52401 SRR8585542.ke.tsv 34699 SRR8585542.se.tsv 87100 total ==> SRR8585542.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.41 4472 80.5014 Potri.005G024800.1.v4.1 1035 807.414 1273 50.8144 Potri.004G059700.1.v4.1 961 733.424 159 6.9871 Potri.007G009000.2.v4.1 1416 1188.41 0 0 Potri.003G141000.2.v4.1 2943 2715.41 1340 15.9046 Potri.016G087400.1.v4.1 270 68.7945 1067.32 500.029 Potri.015G069301.1.v4.1 564 336.485 0 0 Potri.010G195200.1.v4.1 1773 1545.41 900 18.7695 Potri.012G127500.1.v4.1 977 749.414 1599 68.7673 ==> SRR8585542.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 71 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 65 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 680 SRR8585542 completed mapping pipeline successfully