Starting /dee2/code/volunteer_pipeline.sh SRR8742315 current disk space = 3087383875584 free memory = 1403841196 SRR8742315 SRAfilesize 227e0c8cad17a1aa5edbf2060cc69a7a SRR8742315.sra SRR8742315.sra file validated SRR8742315 is paired end SRR8742315 is conventional basespace SRR8742315 read1 length is 69-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8742315_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 69-76 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.734 32.0 32.0 32.0 32.0 32.0 2 31.754 32.0 32.0 32.0 32.0 32.0 3 31.74225 32.0 32.0 32.0 32.0 32.0 4 31.79 32.0 32.0 32.0 32.0 32.0 5 31.71025 32.0 32.0 32.0 32.0 32.0 6 35.395 36.0 36.0 36.0 36.0 36.0 7 35.48175 36.0 36.0 36.0 36.0 36.0 8 35.4655 36.0 36.0 36.0 36.0 36.0 9 35.53525 36.0 36.0 36.0 36.0 36.0 10-11 35.4575 36.0 36.0 36.0 36.0 36.0 12-13 35.442499999999995 36.0 36.0 36.0 36.0 36.0 14-15 35.434125 36.0 36.0 36.0 36.0 36.0 16-17 35.360625 36.0 36.0 36.0 36.0 36.0 18-19 35.370000000000005 36.0 36.0 36.0 36.0 36.0 20-21 35.433125000000004 36.0 36.0 36.0 36.0 36.0 22-23 35.378 36.0 36.0 36.0 36.0 36.0 24-25 35.318 36.0 36.0 36.0 36.0 36.0 26-27 35.315875 36.0 36.0 36.0 36.0 36.0 28-29 35.398125 36.0 36.0 36.0 36.0 36.0 30-31 35.315875 36.0 36.0 36.0 36.0 36.0 32-33 35.280874999999995 36.0 36.0 36.0 36.0 36.0 34-35 35.232 36.0 36.0 36.0 36.0 36.0 36-37 35.2825 36.0 36.0 36.0 36.0 36.0 38-39 35.207499999999996 36.0 36.0 36.0 36.0 36.0 40-41 35.240125 36.0 36.0 36.0 36.0 36.0 42-43 35.235749999999996 36.0 36.0 36.0 36.0 36.0 44-45 35.144625000000005 36.0 36.0 36.0 36.0 36.0 46-47 35.0765 36.0 36.0 36.0 36.0 36.0 48-49 35.029250000000005 36.0 36.0 36.0 36.0 36.0 50-51 35.073499999999996 36.0 36.0 36.0 36.0 36.0 52-53 34.98650000000001 36.0 36.0 36.0 34.0 36.0 54-55 34.843 36.0 36.0 36.0 34.0 36.0 56-57 34.826 36.0 36.0 36.0 34.0 36.0 58-59 34.8185 36.0 36.0 36.0 32.0 36.0 60-61 34.883125 36.0 36.0 36.0 32.0 36.0 62-63 34.880875 36.0 36.0 36.0 34.0 36.0 64-65 34.893875 36.0 36.0 36.0 34.0 36.0 66-67 34.715125 36.0 36.0 36.0 32.0 36.0 68-69 34.664375 36.0 36.0 36.0 32.0 36.0 70-71 34.693017958091325 36.0 36.0 36.0 32.0 36.0 72-73 34.59347194767273 36.0 36.0 36.0 32.0 36.0 74-75 34.64071806340378 36.0 36.0 36.0 32.0 36.0 76 33.691620111731844 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 3.0 24 9.0 25 7.0 26 19.0 27 18.0 28 34.0 29 42.0 30 56.0 31 64.0 32 100.0 33 173.0 34 434.0 35 3039.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.725 11.35 9.225 43.7 2 22.025 15.975 36.55 25.45 3 19.325 19.375 24.0 37.3 4 24.15 28.975 20.925 25.95 5 23.275000000000002 30.925000000000004 24.325 21.475 6 19.025 33.475 26.05 21.45 7 15.299999999999999 23.075000000000003 42.575 19.05 8 17.95 22.125 32.275 27.650000000000002 9 18.8 22.45 33.300000000000004 25.45 10-11 22.112499999999997 32.475 21.912499999999998 23.5 12-13 21.762500000000003 24.349999999999998 27.6125 26.275 14-15 20.5 26.0125 27.975 25.5125 16-17 21.405351337834457 26.531632908227053 26.969242310577645 25.09377344336084 18-19 20.724999999999998 27.175 26.674999999999997 25.424999999999997 20-21 21.25 25.887500000000003 27.200000000000003 25.662499999999998 22-23 21.7875 25.9625 26.775 25.474999999999998 24-25 21.425 25.4 27.775 25.4 26-27 21.4 25.575 26.8375 26.187500000000004 28-29 21.125 25.674999999999997 26.575 26.625 30-31 21.392848212053014 26.056514128532132 27.369342335583895 25.18129532383096 32-33 22.225 25.887500000000003 26.4125 25.474999999999998 34-35 21.712500000000002 26.700000000000003 26.55 25.0375 36-37 20.75 26.3125 27.4125 25.525 38-39 21.125 26.7125 25.8 26.3625 40-41 20.8 27.437499999999996 26.2625 25.5 42-43 21.512500000000003 27.1 26.787499999999998 24.6 44-45 21.8125 26.6125 26.424999999999997 25.15 46-47 21.775 26.424999999999997 26.1625 25.637500000000003 48-49 20.5375 25.8125 26.887499999999996 26.7625 50-51 21.7375 26.787499999999998 26.775 24.7 52-53 21.4 26.650000000000002 27.075 24.875 54-55 21.45 26.900000000000002 25.887500000000003 25.7625 56-57 21.025 27.3875 25.687500000000004 25.900000000000002 58-59 21.55 26.5125 27.3 24.637500000000003 60-61 22.1 26.387500000000003 26.75 24.762500000000003 62-63 21.6 25.45 26.937499999999996 26.0125 64-65 21.125 26.3 26.787499999999998 25.7875 66-67 20.925 27.450000000000003 26.424999999999997 25.2 68-69 21.5625 26.3 26.85 25.2875 70-71 21.433037389020885 26.84756783793923 26.672502188320617 25.04689258471927 72-73 22.089664699233957 26.72359663443426 26.032902172548035 25.15383649378375 74-75 21.628431242540778 23.259514653229015 28.35167749635327 26.76037660787694 76 23.09124767225326 0.0 39.25512104283054 37.6536312849162 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 5.5 25 7.5 26 6.5 27 10.0 28 14.5 29 16.0 30 29.5 31 39.5 32 41.0 33 50.0 34 60.5 35 69.0 36 83.0 37 97.5 38 120.5 39 151.5 40 160.5 41 186.5 42 211.5 43 223.0 44 263.5 45 284.0 46 288.0 47 288.5 48 275.5 49 278.0 50 281.0 51 249.5 52 218.5 53 193.0 54 168.5 55 160.0 56 160.5 57 133.5 58 103.0 59 101.0 60 79.0 61 43.5 62 26.5 63 25.5 64 21.0 65 15.0 66 10.0 67 10.0 68 8.5 69 5.0 70 4.5 71 4.0 72 3.5 73 4.5 74 3.0 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.025 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.025 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 69 1.0 70 1.0 71 6.0 72 21.0 73 74.0 74 253.0 75 959.0 76 2685.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 95.08021390374331 88.9 2 3.7433155080213902 7.000000000000001 3 0.6684491978609626 1.875 4 0.32085561497326204 1.2 5 0.08021390374331551 0.375 6 0.053475935828877004 0.3 7 0.053475935828877004 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCA 7 0.17500000000000002 No Hit GTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGGCAT 7 0.17500000000000002 No Hit GTCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGC 6 0.15 No Hit GTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGC 6 0.15 No Hit CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACT 5 0.125 No Hit GTCAATTCCTTTAAGTTTCAGCCTTGCGACCATACTCCCCCCAGAACCCA 5 0.125 No Hit GATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR8742315 read2 length is 66-76 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR8742315_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 66-76 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.53325 32.0 32.0 32.0 32.0 32.0 2 31.41575 32.0 32.0 32.0 32.0 32.0 3 31.358 32.0 32.0 32.0 32.0 32.0 4 31.4955 32.0 32.0 32.0 32.0 32.0 5 31.39225 32.0 32.0 32.0 32.0 32.0 6 35.1075 36.0 36.0 36.0 36.0 36.0 7 35.19325 36.0 36.0 36.0 36.0 36.0 8 34.96175 36.0 36.0 36.0 36.0 36.0 9 35.14625 36.0 36.0 36.0 36.0 36.0 10-11 35.00675 36.0 36.0 36.0 36.0 36.0 12-13 35.082499999999996 36.0 36.0 36.0 36.0 36.0 14-15 35.020125 36.0 36.0 36.0 36.0 36.0 16-17 35.0035 36.0 36.0 36.0 36.0 36.0 18-19 34.95575 36.0 36.0 36.0 36.0 36.0 20-21 34.889250000000004 36.0 36.0 36.0 36.0 36.0 22-23 34.859750000000005 36.0 36.0 36.0 36.0 36.0 24-25 34.961625 36.0 36.0 36.0 36.0 36.0 26-27 34.794875000000005 36.0 36.0 36.0 36.0 36.0 28-29 34.817875 36.0 36.0 36.0 36.0 36.0 30-31 34.824 36.0 36.0 36.0 36.0 36.0 32-33 34.790499999999994 36.0 36.0 36.0 36.0 36.0 34-35 34.75 36.0 36.0 36.0 36.0 36.0 36-37 34.757000000000005 36.0 36.0 36.0 36.0 36.0 38-39 34.684875 36.0 36.0 36.0 36.0 36.0 40-41 34.695 36.0 36.0 36.0 36.0 36.0 42-43 34.714 36.0 36.0 36.0 36.0 36.0 44-45 34.548625 36.0 36.0 36.0 36.0 36.0 46-47 34.583375000000004 36.0 36.0 36.0 36.0 36.0 48-49 34.578875 36.0 36.0 36.0 34.0 36.0 50-51 34.548 36.0 36.0 36.0 34.0 36.0 52-53 34.5145 36.0 36.0 36.0 32.0 36.0 54-55 34.426375 36.0 36.0 36.0 32.0 36.0 56-57 34.485625 36.0 36.0 36.0 32.0 36.0 58-59 34.43625 36.0 36.0 36.0 32.0 36.0 60-61 34.305125000000004 36.0 36.0 36.0 32.0 36.0 62-63 34.342625 36.0 36.0 36.0 32.0 36.0 64-65 34.266000000000005 36.0 36.0 36.0 32.0 36.0 66-67 34.27291641660415 36.0 36.0 36.0 32.0 36.0 68-69 34.28562306951519 36.0 36.0 36.0 32.0 36.0 70-71 34.28953953953954 36.0 36.0 36.0 32.0 36.0 72-73 34.176640964181985 36.0 36.0 36.0 32.0 36.0 74-75 34.22562448018134 36.0 36.0 36.0 32.0 36.0 76 33.34610962054427 36.0 36.0 36.0 27.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 9.0 17 10.0 18 8.0 19 3.0 20 10.0 21 9.0 22 13.0 23 15.0 24 13.0 25 23.0 26 22.0 27 32.0 28 36.0 29 65.0 30 61.0 31 83.0 32 109.0 33 176.0 34 465.0 35 2835.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.88488488488489 18.86886886886887 15.14014014014014 31.106106106106107 2 31.23280820205051 23.455863965991497 30.307576894223555 15.003750937734434 3 23.80595148787197 26.131532883220803 27.45686421605401 22.605651412853213 4 27.875 32.6 20.625 18.9 5 29.9 34.475 18.95 16.675 6 23.425 36.575 19.975 20.025000000000002 7 24.125 18.5 36.25 21.125 8 25.2 23.1 25.724999999999998 25.974999999999998 9 25.75 23.599999999999998 27.55 23.1 10-11 26.575 30.062499999999996 21.1375 22.225 12-13 26.8125 23.3875 25.937500000000004 23.8625 14-15 25.4875 26.55 26.637499999999996 21.325 16-17 26.625 26.075 24.8125 22.4875 18-19 27.05 25.7875 25.55 21.6125 20-21 26.137500000000003 26.575 24.837500000000002 22.45 22-23 26.525 26.5625 24.9875 21.925 24-25 25.525 26.424999999999997 25.275 22.775000000000002 26-27 27.3 26.05 25.4 21.25 28-29 25.924999999999997 27.224999999999998 25.275 21.575 30-31 26.900000000000002 25.75 25.5625 21.7875 32-33 25.637500000000003 26.7625 25.374999999999996 22.225 34-35 26.224999999999998 27.3875 24.1625 22.225 36-37 26.775 26.5 24.637500000000003 22.0875 38-39 26.424999999999997 26.4125 25.7125 21.45 40-41 26.5625 26.237500000000004 25.974999999999998 21.224999999999998 42-43 27.125 26.450000000000003 25.137500000000003 21.2875 44-45 26.5375 25.587500000000002 26.337500000000002 21.5375 46-47 25.924999999999997 26.887499999999996 25.6 21.587500000000002 48-49 25.2625 26.737499999999997 25.0625 22.9375 50-51 25.837500000000002 28.075 24.725 21.3625 52-53 26.6625 26.237500000000004 25.900000000000002 21.2 54-55 26.150000000000002 26.8 24.7375 22.3125 56-57 26.525 26.637499999999996 25.087500000000002 21.75 58-59 26.0 26.0625 26.0125 21.925 60-61 27.287499999999998 26.5875 25.0375 21.087500000000002 62-63 26.075 26.1125 25.2375 22.575 64-65 26.1625 25.8625 25.825 22.15 66-67 26.128266033254157 26.328291036379547 25.54069258657332 22.00275034379297 68-69 26.050525262631314 26.625812906453227 25.662831415707853 21.660830415207606 70-71 26.001001001001 27.52752752752753 25.012512512512515 21.45895895895896 72-73 25.92267135325132 26.286718553853877 25.21968365553603 22.570926437358775 74-75 26.801922050186867 23.78537106246663 26.281366791243993 23.13134009610251 76 29.39823687236489 0.0 38.36719049444232 32.23457263319279 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 1.5 25 3.0 26 4.0 27 8.0 28 14.0 29 13.5 30 16.0 31 22.5 32 32.0 33 40.5 34 52.0 35 67.0 36 77.0 37 81.5 38 100.5 39 139.5 40 169.5 41 206.0 42 229.0 43 243.0 44 274.0 45 285.5 46 286.0 47 282.5 48 274.5 49 259.0 50 239.0 51 221.5 52 177.0 53 154.0 54 167.5 55 168.0 56 167.5 57 141.0 58 108.0 59 99.5 60 87.5 61 68.5 62 52.0 63 33.0 64 19.0 65 19.5 66 17.0 67 14.5 68 13.0 69 13.5 70 10.5 71 5.5 72 5.5 73 7.0 74 4.5 75 2.0 76 3.0 77 3.0 78 1.5 79 1.0 80 1.5 81 0.5 82 0.5 83 1.0 84 2.0 85 2.0 86 0.5 87 0.0 88 0.0 89 1.0 90 1.0 91 1.0 92 2.0 93 1.0 94 0.0 95 1.0 96 2.0 97 1.5 98 0.5 99 21.5 100 43.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.025 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 66 1.0 67 0.0 68 2.0 69 1.0 70 0.0 71 5.0 72 16.0 73 74.0 74 310.0 75 982.0 76 2609.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 95.98937583001327 90.35 2 3.266932270916335 6.15 3 0.5046480743691899 1.425 4 0.10624169986719788 0.4 5 0.05312084993359894 0.25 6 0.05312084993359894 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02656042496679947 1.125 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 45 1.125 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGTAA 6 0.15 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAAGCTGACTGGCGGGATCCCCTCG 6 0.15 No Hit ACCAGGTCCAGACATAGTAAGGATTGACAGACTGAGAGCTCTTTCTTGAT 5 0.125 No Hit CTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAAGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 41 0.0 0.0 0.0 0.0 0.0 42 0.0 0.0 0.0 0.0 0.0 43 0.0 0.0 0.0 0.0 0.0 44 0.0 0.0 0.0 0.0 0.0 45 0.0 0.0 0.0 0.0 0.0 46 0.0 0.0 0.0 0.0 0.0 47 0.0 0.0 0.0 0.0 0.0 48 0.0 0.0 0.0 0.0 0.0 49 0.0 0.0 0.0 0.0 0.0 50 0.0 0.0 0.0 0.0 0.0 51 0.0 0.0 0.0 0.0 0.0 52 0.0 0.0 0.0 0.0 0.0 53 0.0 0.0 0.0 0.0 0.0 54 0.0 0.0 0.0 0.0 0.0 55 0.0 0.0 0.0 0.0 0.0 56 0.0 0.0 0.0 0.0 0.0 57 0.0 0.0 0.0 0.0 0.0 58 0.0 0.0 0.0 0.0 0.0 59 0.0 0.0 0.0 0.0 0.0 60 0.0 0.0 0.0 0.0 0.0 61 0.0 0.0 0.0 0.0 0.0 62 0.0 0.0 0.0 0.0 0.0 63 0.0 0.0 0.0 0.0 0.0 64 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495676 spots for SRR8742315.sra Written 1495676 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra Read 1495664 spots for SRR8742315.sra Written 1495664 spots for SRR8742315.sra SRR ids: ['SRR8742315.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t2zn4qt4 SRR8742315.sra spots: 29913292 blocks: [[1, 1495664], [1495665, 2991328], [2991329, 4486992], [4486993, 5982656], [5982657, 7478320], [7478321, 8973984], [8973985, 10469648], [10469649, 11965312], [11965313, 13460976], [13460977, 14956640], [14956641, 16452304], [16452305, 17947968], [17947969, 19443632], [19443633, 20939296], [20939297, 22434960], [22434961, 23930624], [23930625, 25426288], [25426289, 26921952], [26921953, 28417616], [28417617, 29913292]] SRR8742315 file size 5676279 SRR8742315 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR8742315 SRR8742315_1.fastq SRR8742315_2.fastq Input file: SRR8742315_1.fastq Paired file: SRR8742315_2.fastq trimmed: SRR8742315-trimmed-pair1.fastq, SRR8742315-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:09:02 2025 >> started Thu Feb 13 19:09:27 2025 >> done (25.412s) 29913292 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 96469 ( 0.32%) empty read pairs filtered out after trimming by size control 29816823 (99.68%) read pairs available; of these: 5083 ( 0.02%) trimmed read pairs available after processing 29811740 (99.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 3 0.00% 22 0 0.00% 23 9 0.00% 24 4 0.00% 25 5 0.00% 26 9 0.00% 27 10 0.00% 28 11 0.00% 29 15 0.00% 30 18 0.00% 31 15 0.00% 32 17 0.00% 33 16 0.00% 34 16 0.00% 35 63 0.00% 36 72 0.00% 37 84 0.00% 38 86 0.00% 39 97 0.00% 40 118 0.00% 41 134 0.00% 42 133 0.00% 43 124 0.00% 44 160 0.00% 45 223 0.00% 46 174 0.00% 47 205 0.00% 48 310 0.00% 49 285 0.00% 50 403 0.00% 51 405 0.00% 52 450 0.00% 53 466 0.00% 54 512 0.00% 55 668 0.00% 56 765 0.00% 57 868 0.00% 58 1099 0.00% 59 1144 0.00% 60 1315 0.00% 61 1347 0.00% 62 1628 0.01% 63 1643 0.01% 64 2016 0.01% 65 2104 0.01% 66 2291 0.01% 67 2680 0.01% 68 2803 0.01% 69 3283 0.01% 70 4395 0.01% 71 7508 0.03% 72 20976 0.07% 73 234424 0.79% 74 2324513 7.80% 75 14135854 47.41% 76 13058845 43.80% 29816823 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=27 prefix-density=0.57 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=14.24 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=1.2 sequence=GAGGGAGGGCGGAGCTTTTGGTTTTTTTTTCATGTTGTCAAAGAGTTGAACAATAAAAATAGATGGCGAGTACCTGATCGAATTGATCGGGTCATGTAGGAACAAGGTTCAAGTCTACCGGTCTGTTAGGATGCCTCAGCTGCATACATCACTGCACTTCCACTTGACACCTATCGTAATGATAAACGGCTCGTCTCGCCGTGACCTTCTCTTGAATTCTCAAAACTTCTGTCGCTCCATCCCCGCAGGGGCAGAGAACCCGTCGCTGTCTCGGCTGTGCTACCGGAGGCTCTGGGGAAGTCGGAATAGGAGAGCACTCATCTTGGGGTGGGCTTACTACTTAGATGCTTTCAGCAGTTATCCGCTCCGCACTTGGCTACCCAGCGTTTACCGTGGGCACAATAACTGGTACACCAGAGGTGCGTCCTTCCCGGTCCTCTCGTAC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=27 prefix-density=0.40 prefix-fanout=1.9 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=17.64 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.6 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR8742315 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:09:55 Started mapping on | Feb 13 19:09:55 Finished on | Feb 13 19:12:27 Mapping speed, Million of reads per hour | 706.19 Number of input reads | 29816823 Average input read length | 151 UNIQUE READS: Uniquely mapped reads number | 22484821 Uniquely mapped reads % | 75.41% Average mapped length | 150.39 Number of splices: Total | 8881537 Number of splices: Annotated (sjdb) | 8783839 Number of splices: GT/AG | 8708049 Number of splices: GC/AG | 148626 Number of splices: AT/AC | 6366 Number of splices: Non-canonical | 18496 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.02% Deletion average length | 2.20 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1549967 % of reads mapped to multiple loci | 5.20% Number of reads mapped to too many loci | 4572341 % of reads mapped to too many loci | 15.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.59% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5782035 5782035 5782035 N_multimapping 1549967 1549967 1549967 N_noFeature 2002875 22058518 2098282 N_ambiguous 471169 2547 138045 UnstrandedReadsAssigned:20010777 PositiveStrandReadsAssigned:423756 NegativeStrandReadsAssigned:20248494 Dataset is classified negative stranded MeadianReadLen=76 20thPercentileLength=75 echo kmer=71 SRR8742315 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR8742315-trimmed-pair1.fastq SRR8742315-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,816,823 reads, 24,102,987 reads pseudoaligned [quant] estimated average fragment length: 200.802 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52401 SRR8742315.ke.tsv 34699 SRR8742315.se.tsv 87100 total ==> SRR8742315.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1818.2 283 4.51508 Potri.005G024800.1.v4.1 1035 835.198 105 3.64687 Potri.004G059700.1.v4.1 961 761.198 47 1.7911 Potri.007G009000.2.v4.1 1416 1216.2 0 0 Potri.003G141000.2.v4.1 2943 2743.2 302.122 3.19481 Potri.016G087400.1.v4.1 270 91.3734 1293.18 410.544 Potri.015G069301.1.v4.1 564 364.637 0 0 Potri.010G195200.1.v4.1 1773 1573.2 1 0.018439 Potri.012G127500.1.v4.1 977 777.198 3721 138.883 ==> SRR8742315.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 20 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 294 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 52 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR8742315 completed mapping pipeline successfully